The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	248413	297097	4775122	integrase,transposase	Streptococcus_phage(20.0%)	49	262899:262958	297207:297266
WP_000006255.1|248413_248911_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|249134_250874_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|250833_251604_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|251674_252730_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252781_253075_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|253077_253476_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|253485_253938_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|254243_254510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|254442_254979_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|255035_256493_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|256753_257212_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|257303_258548_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|258605_259007_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|259045_260101_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|260388_261492_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|261503_262757_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262899:262958	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|263328_263670_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|263690_264008_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|264026_264248_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|264256_264733_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|264748_265207_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|265304_265544_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|265620_266088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|266110_266554_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|266553_266781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|267184_268006_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|268097_268961_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|269289_270183_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|270603_271755_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|274101_275118_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275325_276729_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|276715_277648_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|277756_278803_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|280024_280363_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|280385_280736_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|280829_281984_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|282278_283187_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|283201_285169_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|285395_286778_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286789_288400_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|288404_289163_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|289301_290306_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|291500_292232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|292322_292949_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|293220_293919_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293945_294800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294918_295143_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|295139_295580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|295696_297097_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
297207:297266	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	315291	351199	4775122	integrase,transposase	Acinetobacter_phage(25.0%)	21	319058:319117	349915:351245
WP_085947771.1|315291_316453_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_085955200.1|316553_317715_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.4e-50
319058:319117	attL	TGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGC	NA	NA	NA	NA
WP_085947917.1|319068_320342_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000286435.1|321491_322184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560319.1|322617_322890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064753882.1|322936_325843_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000995793.1|328881_332997_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
WP_072145210.1|334768_336256_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001066941.1|337012_337753_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|338037_339015_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_071530077.1|339327_339555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990665.1|339854_340496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010892534.1|342028_342265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538310.1|342610_342901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|342890_343790_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|343839_346065_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|346066_347155_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000813634.1|347734_347953_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|347954_348260_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|348260_349067_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_085947917.1|349925_351199_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
349915:351245	attR	TGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCCACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTGACCGCCCAGTGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTCTCTCCGTTATCACAGCAGAACTCGAACCCGTCAGAGCACCATCGCTGATTGCTTTCTTTCACGGCCACTCTGCCTGTATGTGCCCGTTTCGATGGCGGTACAGCAGGTTTTCGCTCAAGCAACAGCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCGCAGGCATACCATCAAGTTCTGCCTGTCTGCGAAGCAGCGCCCATACCCGACGATAACCATACGTTGGCAGCTCTCCGATAACATGGTGTATACGGAGAAGCACATCCGTATCATCAGTGTGACGACTGCGGCGGCCATCCATCCAGTCATCGGTTCGTCTGAGAATGACGTGCAACTGCGCACGCGACACCCGGAGACAACGGCTGACTAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACTTTTTTGCCCGTCCATATTCAACGGCTTCTTTGAGGAGTTCATTTTCCATCGTTTTCTTGCCGAGCAGGCGCTGGAGTTCTTTAATCTGCTTCATGGCGGCAGCAAGTTCAGAGGCAGGAACAACCTGTTCTCCGGCGGCGACAGCAGTAAGACTTCCTTCCTGGTATTGCTTACGCCAGAGAAATAACTGGCTGGCTGCTACACCATGTTGCCGGGCAACGAGGGAGACCGTCATCCCCGGTTCAAAGCTCTGCTGAACAATTGCGATCTTTTCCTGTGTGGTACGCCGTCTGCGTTTCTCCGGCCCTAAGACATCAATCATCTGTTCTCCAATGACTAGTCTAAAAACTAGTATTAAGACTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGTCTA	NA	NA	NA	NA
>prophage 3
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	605801	668760	4775122	transposase,lysis,tRNA,integrase,terminase,protease	Enterobacteria_phage(50.0%)	65	651418:651464	672720:672766
WP_001297298.1|605801_606428_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|606395_607082_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|607078_609493_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|609923_614204_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|614243_614612_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|615302_615563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|616794_617889_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|617957_618884_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|619113_619596_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|619673_620489_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|620578_622360_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|622372_623149_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|623248_624127_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|624295_625750_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|625809_627171_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|627227_628529_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|628550_629696_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|629923_630709_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|630719_631955_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|631976_633026_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|633342_635010_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|635019_636279_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|636289_637105_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|637101_637995_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|638189_639257_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|639253_639763_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|639880_640603_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|640605_641100_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|641273_642659_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|642694_643216_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|643323_643536_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|643537_644404_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|644874_645417_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|645636_646329_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|646359_648963_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|648941_649982_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|649992_650508_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|650510_651143_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
651418:651464	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|651477_652641_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|652760_653024_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|653346_653442_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|653504_654666_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|654977_655310_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|655357_655507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|655564_657091_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|657555_658107_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|658116_658914_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|659030_659132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|659128_659584_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|659583_659754_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|659746_660037_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|660033_660396_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|660392_660533_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|660618_661002_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|661399_662416_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|662420_663488_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|664060_664276_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|664275_664773_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|664989_665172_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|665262_665556_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|665846_666257_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|666542_666749_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|666913_667108_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|667496_668042_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|668016_668760_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
672720:672766	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	894078	944423	4775122	portal,lysis,terminase,holin,integrase,head,tail,protease,capsid	Enterobacteria_phage(75.36%)	70	892356:892371	917156:917171
892356:892371	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533640.1|894078_895149_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|895126_895345_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|895384_895552_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|895640_895922_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|896113_896662_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|896658_896880_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|897271_897463_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|897435_897618_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|897614_898295_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|898291_899077_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|899082_899379_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|899453_899597_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|899565_899730_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|899802_900171_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|900353_900554_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|900820_901303_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|901303_901627_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|902091_902526_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|902541_903381_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|903493_904207_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|904307_904508_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|904626_904920_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|904952_905852_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|905848_906550_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|906546_906837_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|906910_907351_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|907347_908220_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|908216_908390_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|908356_908539_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|908535_908706_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|908698_909310_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|909306_909513_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|909490_910156_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|910152_910776_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_012767708.1|910887_911082_+	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_000783735.1|911452_911776_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|911759_912236_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|912452_912635_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|912725_913019_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|913308_913719_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|914004_914211_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|914375_914570_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|914958_915504_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|915478_917404_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
917156:917171	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|917400_917607_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|917603_919205_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|919185_920505_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|920514_920847_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|920902_921928_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|921969_922368_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|922379_922733_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|922744_923323_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|923319_923715_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|923722_924463_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|924478_924901_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|924882_925317_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|925309_927871_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|927867_928197_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|928196_928895_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|928900_929644_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|929580_930213_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515496.1|930273_933672_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_001246632.1|933733_934354_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_001407643.1|934418_936743_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_016063193.1|936742_937327_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_000162952.1|937455_938688_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_000735931.1|939278_940169_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000889231.1|940165_941743_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000767389.1|942598_943075_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_012305461.1|943133_944423_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 5
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	1327831	1349222	4775122	portal,plate,tRNA,integrase,tail	Shigella_phage(26.32%)	31	1319826:1319840	1355925:1355939
1319826:1319840	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1327831_1328938_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1328991_1329453_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1329462_1330116_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1330287_1331538_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1332031_1332697_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1332697_1333402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1333859_1334753_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1334843_1335971_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1335951_1336197_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1336233_1336545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1336661_1337003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1336940_1337249_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1337423_1338098_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1338188_1338389_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1338432_1338990_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1339165_1339345_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1339334_1340702_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1340713_1340896_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1340895_1341369_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1341295_1342087_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1342077_1342662_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_010723096.1|1343295_1343709_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1343680_1344283_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1344282_1344777_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1344848_1345403_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1345509_1346343_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1346576_1346741_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1346843_1347167_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1347702_1347813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1347865_1348270_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1348490_1349222_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1355925:1355939	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 6
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	1530039	1570857	4775122	transposase,lysis,tRNA,integrase,tail	Escherichia_phage(43.75%)	46	1531186:1531204	1561561:1561579
WP_010723085.1|1530039_1531056_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1531186:1531204	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1531328_1531586_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1531635_1532586_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1532737_1533490_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1533684_1534200_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1534210_1535737_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1535773_1537219_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1537218_1538529_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1538704_1539613_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1539942_1540506_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1540526_1541759_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1542013_1542997_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1543474_1544848_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1544976_1545912_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1545963_1547199_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1547200_1547416_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1547494_1547704_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1547696_1547891_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1547947_1548757_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1548749_1551350_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1551451_1551727_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1551801_1551972_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1551971_1552193_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1552634_1553123_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1553119_1553275_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|1553285_1553420_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|1553728_1554205_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1554328_1554625_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1554647_1555070_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1555082_1555940_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1555946_1556693_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1556715_1557276_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1557363_1557549_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1557745_1559203_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1559340_1559604_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1559584_1559944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1560051_1560252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1561709_1562690_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1561561:1561579	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_089418980.1|1562732_1562948_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000279097.1|1563012_1566375_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1566374_1566950_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1567047_1567638_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1567954_1568188_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1568256_1568370_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1569148_1569583_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1569723_1570857_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 7
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	1763416	1782627	4775122	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1763416_1764877_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1764965_1766249_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1766853_1766967_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1767035_1767269_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1767585_1768176_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1768273_1768849_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1768848_1769811_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1769761_1770331_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1770719_1770953_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1771010_1771421_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1771572_1771746_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1771917_1772073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1772151_1772217_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1772219_1772408_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1772418_1772631_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1772993_1773491_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1773487_1774021_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1774017_1774329_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1774333_1774549_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1775302_1775518_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1775818_1776031_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1776085_1776175_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1776452_1777205_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1777218_1778268_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1778269_1778548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1778614_1778866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1779082_1779238_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1779309_1779597_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1779596_1779836_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1779860_1780166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1780368_1780701_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1781137_1781287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1781583_1781814_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1781897_1782305_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1782471_1782627_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 8
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	2238786	2247457	4775122		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2238786_2239890_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2239897_2241145_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2241141_2241699_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2241698_2242580_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2242637_2243537_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2243536_2244622_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2244994_2245888_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2246062_2247457_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 9
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	2596854	2608064	4775122	tail,integrase	Enterobacteria_phage(50.0%)	17	2594829:2594845	2611739:2611755
2594829:2594845	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2596854_2597787_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2598098_2599256_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2599408_2599771_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2599767_2600688_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2600684_2602016_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2602050_2602332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2602630_2603071_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2603097_2603616_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2603665_2603941_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2603940_2604435_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2604431_2604800_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2605157_2605520_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2605585_2606410_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2606537_2607074_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2607064_2607427_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2607426_2607732_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2607863_2608064_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2611739:2611755	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 10
NZ_CP040643	Escherichia coli strain BE104 chromosome, complete genome	4775122	2988645	2995784	4775122		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2988645_2991207_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2991312_2991969_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2992019_2992787_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2992982_2993891_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2993887_2995054_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2995145_2995784_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
