The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	244164	309493	4905849	transposase,protease,tRNA,plate	uncultured_Mediterranean_phage(10.0%)	55	NA	NA
WP_000753958.1|244164_245592_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
WP_000929420.1|245744_246902_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272193.1|246990_247377_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000017194.1|247623_248925_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001186673.1|248961_249786_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094519.1|249815_252488_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018214.1|252724_253519_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246886.1|253969_254695_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000808106.1|254952_255804_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224567.1|255948_256674_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622423.1|256820_257378_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811905.1|257518_258715_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000947413.1|259027_259786_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
WP_000922422.1|259798_260656_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000949017.1|260667_262020_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240935.1|262051_264466_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758966.1|264588_265074_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139265.1|265077_266103_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|266208_266664_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565950.1|266667_267456_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000741212.1|267455_268604_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569412.1|268600_269197_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_001294826.1|269220_272703_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055753.1|272715_273675_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000502119.1|273869_274328_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000524168.1|274566_276330_+	chitinase	NA	NA	NA	NA	NA
WP_001021054.1|276405_278547_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901088.1|278602_278992_+	VOC family protein	NA	NA	NA	NA	NA
WP_000210056.1|279054_280347_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062330.1|280430_280691_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000955207.1|280677_280896_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185319.1|281075_281621_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000560527.1|281617_282040_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000252573.1|282071_282773_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260683.1|282846_284565_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000093986.1|284675_285383_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202315.1|285379_285784_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874215.1|285902_286718_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001287486.1|286756_287410_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594021.1|287402_288434_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001051726.1|288623_289190_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000154871.1|295445_296249_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_000648534.1|296269_297184_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127538.1|297288_298464_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230968.1|298595_299396_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207224.1|299473_300244_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644706.1|300299_301667_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052775.1|301738_302494_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801238.1|302528_303251_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|303247_303715_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|303778_304510_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000367626.1|305041_306097_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000145244.1|306107_307103_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371508.1|307099_308983_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108007.1|308998_309493_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	364138	407824	4905849	lysis,terminase,integrase,tail,portal	Salmonella_phage(90.16%)	61	354908:354924	416415:416431
354908:354924	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|364138_365191_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|365473_366577_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|366588_367839_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_010835868.1|368044_369208_-|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	3.7e-230
WP_016048814.1|369437_369788_-	hypothetical protein	NA	A0A192Y649	Salmonella_phage	100.0	8.3e-61
WP_016048815.1|369858_370527_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	100.0	2.5e-130
WP_010835870.1|370530_370719_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	100.0	4.6e-26
WP_010835871.1|370841_371129_-	hypothetical protein	NA	A0A192Y6Q6	Salmonella_phage	100.0	4.3e-47
WP_010835872.1|371139_371433_-	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	100.0	1.9e-50
WP_016048817.1|371479_371764_-	sigma-70 family RNA polymerase sigma factor	NA	A0A192Y7Y0	Salmonella_phage	100.0	4.0e-45
WP_010835873.1|371763_372471_-	Recombination protein	NA	A0A192Y8X7	Salmonella_phage	100.0	1.1e-139
WP_010835874.1|373162_373528_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	100.0	3.6e-59
WP_023890943.1|373671_374250_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	100.0	8.8e-100
WP_016048819.1|374270_374654_-	hypothetical protein	NA	A0A192Y8Y8	Salmonella_phage	100.0	3.0e-64
WP_000834165.1|374985_375189_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	100.0	9.1e-28
WP_001532928.1|375227_376307_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_001104735.1|376440_377094_-	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	100.0	4.6e-129
WP_001059982.1|377203_377413_+	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_000424138.1|377546_377837_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_010835877.1|378005_378827_+	replication protein	NA	A0A192Y6S6	Salmonella_phage	100.0	5.2e-154
WP_016048822.1|378823_380200_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	100.0	1.5e-254
WP_000248681.1|380272_380479_+	hypothetical protein	NA	A0A192Y802	Salmonella_phage	100.0	1.1e-31
WP_016048823.1|380493_380691_+	hypothetical protein	NA	A0A192Y900	Salmonella_phage	100.0	3.4e-27
WP_023890942.1|380951_381215_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	100.0	8.2e-45
WP_016048826.1|381439_381877_+	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	100.0	1.3e-79
WP_023890941.1|381873_382047_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	98.2	2.0e-31
WP_016048827.1|382013_382190_+	NinE family protein	NA	A0A1V0E5I9	Salmonella_phage	100.0	4.6e-28
WP_016048828.1|382192_382534_+	DUF2591 family protein	NA	A0A192Y677	Salmonella_phage	100.0	1.2e-64
WP_010835878.1|382526_382703_+	protein ninF	NA	A0A192Y808	Salmonella_phage	100.0	6.7e-27
WP_010835879.1|382695_382965_+	hypothetical protein	NA	A0A192Y905	Salmonella_phage	100.0	1.6e-43
WP_000002244.1|382964_383255_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_016048829.1|383251_383647_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y6T7	Salmonella_phage	100.0	3.1e-72
WP_001287665.1|383643_384213_+	HNH endonuclease	NA	A0A192Y683	Salmonella_phage	100.0	1.1e-107
WP_000149880.1|384209_384413_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_016048830.1|384393_384573_+	hypothetical protein	NA	A0A192Y814	Salmonella_phage	100.0	7.1e-24
WP_000027541.1|384569_385088_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_000286100.1|385551_385755_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_023890940.1|385732_386230_+	lysozyme	NA	A0A192Y6U3	Salmonella_phage	100.0	3.8e-91
WP_010835883.1|386226_386694_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	100.0	1.0e-77
WP_016048832.1|386906_387593_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000808100.1|387903_388146_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_016048833.1|388148_388553_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	100.0	4.0e-67
WP_000729925.1|388556_389045_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_010835897.1|389022_390522_+|terminase	terminase large subunit	terminase	I1TEI5	Salmonella_phage	100.0	8.2e-307
WP_010835896.1|390522_392697_+|portal	portal protein	portal	I1TEI6	Salmonella_phage	100.0	0.0e+00
WP_000433852.1|392710_393622_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_010835895.1|393621_394914_+	protein Coat	NA	I1TEI8	Salmonella_phage	100.0	4.2e-243
WP_010835894.1|394952_395162_+	hypothetical protein	NA	I1TEI9	Salmonella_phage	100.0	2.8e-32
WP_010835893.1|395145_395646_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_010835892.1|395605_397024_+	Tail accessory protein	NA	I1TEJ1	Salmonella_phage	100.0	6.4e-277
WP_016048834.1|397027_397729_+	hypothetical protein	NA	I1TEJ2	Salmonella_phage	100.0	9.4e-72
WP_016048835.1|397728_398184_+	DUF2824 family protein	NA	I1TEJ3	Salmonella_phage	100.0	1.8e-87
WP_006819472.1|398186_398876_+	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	3.9e-94
WP_016048836.1|398918_400256_+	phage DNA ejection protein	NA	I1TEJ5	Salmonella_phage	100.0	1.4e-244
WP_016048837.1|400255_402187_+	hypothetical protein	NA	I1TEJ6	Salmonella_phage	100.0	0.0e+00
WP_071533035.1|402325_402619_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|402639_402888_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_016048838.1|403023_405027_+|tail	tailspike protein	tail	I1TEJ8	Salmonella_phage	100.0	0.0e+00
WP_016048812.1|405085_406543_-	O-antigen conversion translocase	NA	I1TED7	Salmonella_phage	100.0	5.8e-241
WP_016048813.1|406532_407465_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	100.0	5.5e-176
WP_000915523.1|407461_407824_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
416415:416431	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 3
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	1015801	1024533	4905849	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1015801_1016920_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1016916_1018863_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1018992_1019214_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1019537_1019858_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1019888_1022165_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1022356_1022815_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_085983316.1|1023277_1024533_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 4
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	1074617	1173423	4905849	tRNA,lysis,protease,terminase,integrase,holin,tail,portal	Salmonella_phage(41.07%)	101	1077526:1077545	1149311:1149330
WP_001154025.1|1074617_1075421_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1075413_1076736_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1076716_1077421_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1077420_1081887_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1077526:1077545	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1082231_1084073_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1084332_1084881_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1084908_1085556_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1085617_1086808_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1086992_1088084_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1088690_1090091_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1090291_1090753_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1091069_1092284_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1092528_1093965_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1094042_1095245_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1095439_1096732_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1096776_1097025_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1097065_1097305_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_161976234.1|1097347_1098457_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.2	1.4e-173
WP_001668146.1|1101477_1101777_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1101798_1101957_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_077905303.1|1101949_1102210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1102259_1102670_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1102789_1103029_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1102994_1103369_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1103453_1104437_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1104439_1105189_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1105199_1105547_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1105543_1105855_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1105932_1106223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1106514_1106748_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1106859_1107081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1107163_1107766_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1107974_1108586_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1108582_1108729_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1108718_1109516_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1109582_1109900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1110073_1110199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1110334_1110784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1111144_1111831_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1112106_1112436_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1112419_1112872_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1112889_1113369_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1113576_1114110_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1114066_1116205_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1116201_1116408_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1116434_1117952_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1117875_1119957_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1120047_1120371_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1120363_1120663_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1120643_1121210_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1121206_1121608_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1121619_1122369_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1122414_1122813_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1122809_1123139_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077905305.1|1123218_1126206_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_000978296.1|1126202_1126535_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1126633_1127131_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1127247_1127781_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1127870_1128566_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1128575_1129313_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1129210_1129915_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1129986_1132434_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_031615525.1|1132412_1133336_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_000178849.1|1133374_1133617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1133670_1136109_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1136108_1136690_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1137165_1138134_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1138781_1139408_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1139476_1139776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1139760_1140447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1140717_1140909_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1141335_1143948_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1144155_1145166_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1145331_1145874_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1145870_1146980_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1147078_1149187_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1149199_1151107_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1149311:1149330	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1151121_1152375_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1152379_1154020_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1154016_1154580_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1154835_1155003_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1155102_1155621_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1155689_1157450_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1157635_1158088_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1158159_1159212_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1159568_1160078_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1160294_1160900_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1160886_1163040_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1163058_1163505_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1163628_1165683_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1165718_1166177_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1166271_1166934_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1167107_1167521_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1167565_1167883_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1167940_1169152_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1169366_1169915_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1169940_1170720_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1170768_1171050_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1171046_1171376_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1171462_1172122_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1172742_1173423_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	1962099	1968908	4905849	integrase,tail	Salmonella_phage(33.33%)	11	1956962:1956984	1966677:1966699
1956962:1956984	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1962099_1962981_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1963453_1963642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1963706_1963874_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1964130_1964664_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1964717_1964948_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1965137_1965632_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1965691_1966546_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1966919_1967273_-	YebY family protein	NA	NA	NA	NA	NA
1966677:1966699	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1967289_1968165_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1968165_1968540_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1968677_1968908_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	2044358	2123017	4905849	capsid,plate,head,protease,terminase,integrase,portal,holin,tail,transposase	Salmonella_phage(81.16%)	103	2050896:2050911	2124640:2124655
WP_138645089.1|2044358_2044817_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	31.3	3.7e-08
WP_000659236.1|2044997_2046203_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2046281_2047769_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2048025_2049429_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2049443_2049851_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2049850_2050219_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2050290_2051775_+	alpha-amylase	NA	NA	NA	NA	NA
2050896:2050911	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2051814_2052240_-	lipoprotein	NA	NA	NA	NA	NA
WP_000790504.1|2053626_2053860_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2054124_2054511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2054630_2054945_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2055161_2056844_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2056836_2057832_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2057824_2058532_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_138020332.1|2058531_2059902_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2059923_2060367_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2060363_2061581_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2061685_2062153_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2062157_2063162_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2063158_2063572_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2063571_2063949_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2063948_2064686_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2064695_2064965_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2064973_2065768_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2066049_2066673_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2066711_2066960_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2067034_2067262_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2067571_2068387_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2068365_2070078_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2070242_2070488_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2070504_2071416_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2071591_2072512_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2072500_2072971_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2072951_2074382_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2074455_2075151_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2075242_2075542_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2076191_2077388_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2077648_2077837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2077847_2078060_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2078514_2079783_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2079785_2080205_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2080331_2080493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2081686_2081899_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2081895_2082309_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2082356_2082470_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2082544_2082778_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2082891_2083497_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2083466_2085029_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2085015_2085603_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2085605_2086685_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2086677_2087091_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2087095_2087629_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2087628_2088687_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2088683_2090024_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2090057_2091986_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2092070_2092364_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2092393_2092750_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2092749_2094246_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2094235_2094400_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2094403_2094964_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2094960_2095473_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2095444_2095849_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2095845_2096169_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2096171_2096372_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2096422_2097628_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2097642_2098293_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2098270_2099512_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2099511_2099694_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2099705_2101439_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2101435_2101930_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2102055_2102406_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2102456_2102789_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2103251_2103644_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2103640_2104255_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2104254_2104536_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2104522_2104909_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2105054_2105312_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2105462_2106215_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2106228_2107218_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2107225_2108086_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2108102_2108492_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2108488_2109382_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2109381_2109864_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2109865_2110684_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2110680_2110905_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2110901_2112059_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2112055_2112610_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2112638_2112863_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2112960_2113656_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2113861_2114200_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2114162_2114387_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2114926_2115298_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2115355_2116183_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2116319_2116859_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2116929_2117463_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2117464_2117722_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2117732_2118314_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2118317_2118887_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2118911_2119154_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2119155_2120145_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2120436_2121234_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024159751.1|2121605_2121896_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
WP_001219015.1|2122543_2123017_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2124640:2124655	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	2268548	2340534	4905849	tRNA,capsid,head,terminase,integrase,holin,tail,portal	Cronobacter_phage(54.05%)	73	2270060:2270081	2300067:2300088
WP_001517981.1|2268548_2269910_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.4	2.3e-207
2270060:2270081	attL	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
WP_033574042.1|2270191_2271514_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_058815650.1|2272574_2274275_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	5.4e-222
WP_000200789.1|2274277_2274823_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267956.1|2274794_2275520_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_058815646.1|2275509_2276064_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.5	1.2e-90
WP_138020336.1|2276076_2278182_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	68.8	2.6e-197
WP_001001828.1|2278191_2278779_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|2278771_2279956_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_023210885.1|2279952_2280282_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	73.3	2.2e-39
WP_023210886.1|2280278_2282246_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.6	8.3e-267
WP_000411500.1|2282433_2282691_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000376378.1|2282837_2283170_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_000175558.1|2283169_2283511_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154426.1|2283507_2283804_-|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000166745.1|2283816_2284272_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_033574048.1|2284268_2285396_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	1.8e-173
WP_033574049.1|2285392_2286097_-	phage protein	NA	F1BUL6	Cronobacter_phage	59.1	8.9e-70
WP_033574050.1|2286093_2286576_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	3.0e-37
WP_077917291.1|2286572_2287025_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	63.3	8.0e-48
WP_000505908.1|2287118_2287310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574052.1|2287328_2288027_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.0	2.3e-62
WP_033574053.1|2288037_2289057_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.5	5.5e-137
WP_033574054.1|2289091_2289910_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	1.4e-45
WP_033574055.1|2290053_2291838_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.4	1.9e-249
WP_033574056.1|2291834_2292854_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	7.9e-136
WP_033574057.1|2292853_2293183_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	58.2	1.5e-27
WP_033574064.1|2293228_2294200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574058.1|2294334_2296989_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	46.8	2.1e-241
WP_033574059.1|2297249_2297819_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	48.4	1.8e-44
WP_033574060.1|2297828_2298164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574061.1|2298160_2298436_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.4	5.2e-42
WP_033574062.1|2298553_2298853_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	86.9	3.9e-43
WP_033574063.1|2298968_2299982_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	89.3	3.2e-177
WP_010989041.1|2300367_2301414_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	75.2	1.6e-147
2300067:2300088	attR	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
WP_001669236.1|2301449_2301866_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_001542166.1|2301987_2302323_-	membrane protein	NA	NA	NA	NA	NA
WP_001273389.1|2302884_2303784_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_000129590.1|2303836_2304889_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858692.1|2305142_2306414_+	MFS transporter	NA	NA	NA	NA	NA
WP_000642793.1|2306410_2307415_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001012658.1|2307411_2308377_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434062.1|2308350_2309097_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001188957.1|2309132_2309933_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001182156.1|2309919_2310717_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000837534.1|2311126_2311441_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000765279.1|2311703_2312711_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945364.1|2312726_2315216_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000698773.1|2315229_2315913_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830686.1|2315968_2316499_-	fimbrial protein YehD	NA	NA	NA	NA	NA
WP_000760404.1|2316777_2317059_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005424.1|2317336_2318446_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000195332.1|2318610_2320644_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2320884_2321343_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2321514_2322045_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2322101_2322569_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2322615_2323335_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2323331_2325017_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2325239_2325971_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2326030_2326138_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2326118_2326850_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2326833_2327781_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_001278110.1|2327773_2328943_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000155869.1|2328946_2329864_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871560.1|2330044_2332342_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000095232.1|2332608_2334339_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000911555.1|2334396_2335344_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001017057.1|2335509_2336097_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_000930540.1|2336228_2336825_+	DedA family protein	NA	NA	NA	NA	NA
WP_000169608.1|2336873_2337635_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001081453.1|2337700_2339137_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000698460.1|2339454_2339538_+	protein YohP	NA	NA	NA	NA	NA
WP_001264832.1|2339595_2340534_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	2399833	2410139	4905849	holin,tail	Salmonella_phage(44.44%)	9	NA	NA
WP_000806401.1|2399833_2400337_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2400364_2400655_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_138020337.1|2401703_2402249_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.2e-11
WP_000554739.1|2402251_2403493_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2404085_2404415_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2404711_2406043_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2406071_2406440_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2406454_2407444_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2407772_2410139_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
>prophage 9
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	2751156	2854127	4905849	tRNA,capsid,lysis,head,protease,terminase,integrase,portal,holin,tail,transposase	Salmonella_phage(34.43%)	108	2778012:2778027	2849216:2849231
WP_000940032.1|2751156_2751888_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2752006_2752810_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2752954_2753833_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2754014_2755058_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2755061_2755880_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2755890_2756904_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2756904_2757891_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2757881_2758520_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2758645_2759923_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2759917_2761057_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2761252_2762506_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2762830_2764021_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2764202_2765747_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2766107_2767439_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2767521_2769666_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2769721_2771182_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2771230_2771569_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2771645_2772983_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2772979_2773744_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2773745_2775176_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000502119.1|2775891_2776350_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000970045.1|2776537_2780425_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2778012:2778027	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2780446_2780680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2780680_2782225_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2782275_2782827_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2782851_2783487_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2783490_2784852_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2784862_2785756_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2785871_2786720_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2786758_2787676_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2787697_2788894_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2789009_2789936_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2789973_2790234_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2790345_2790726_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2790725_2791457_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2791468_2792197_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2792208_2793114_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2793110_2793791_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2794064_2795039_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2795055_2796855_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_138020340.1|2797259_2798723_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	2.9e-248
WP_001542312.1|2800026_2800164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2800876_2801041_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2801620_2801686_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2801748_2801961_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2802067_2802295_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2802391_2802970_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2802959_2803784_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2803780_2806153_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2806206_2806449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2806487_2809850_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2809911_2810559_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2810456_2811194_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2811200_2811899_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2811908_2812238_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2812240_2815336_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2815307_2815646_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2815642_2816038_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2816088_2816835_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2816842_2817244_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2817352_2818483_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2818531_2819110_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2819137_2819521_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2819531_2819891_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2819948_2820977_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2821031_2821379_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2821391_2822888_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2822877_2824458_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2824454_2824658_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2824641_2826573_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2826544_2827090_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2827376_2827778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2828013_2828466_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2828483_2828936_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2828919_2829249_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2829524_2830211_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2830425_2830614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2831120_2831684_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2831956_2832634_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2832630_2832771_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2832767_2833379_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2833587_2834190_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2834224_2834473_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2834589_2834823_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2835065_2835698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2835805_2836504_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2836517_2837213_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2837209_2838094_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2838185_2838560_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2838519_2838762_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2838861_2839257_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2839315_2840155_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2840147_2840534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2840533_2841196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2841652_2841811_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2841832_2842183_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2842309_2845237_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2845199_2846357_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2846399_2846639_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2846679_2846964_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2846941_2848171_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2848668_2849148_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2849144_2850101_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2849216:2849231	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2850100_2850751_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2850782_2851358_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2851354_2851519_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989191.1|2851782_2853405_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2853389_2854127_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	2971355	2977943	4905849		Escherichia_phage(33.33%)	9	NA	NA
WP_000633913.1|2971355_2972000_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103697.1|2972228_2973200_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000340829.1|2973204_2973597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457496.1|2973601_2974873_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|2974872_2975310_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|2975306_2975555_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	38.8	2.3e-12
WP_001302618.1|2975972_2976875_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032155763.1|2976878_2977184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086160.1|2977259_2977943_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.0	2.6e-26
>prophage 11
NZ_CP040648	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009880 chromosome, complete genome	4905849	4466297	4486717	4905849	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4466297_4467026_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4467222_4467513_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4467761_4468217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4468213_4468819_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4468823_4470569_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4470571_4471204_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4471196_4472312_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4472302_4472662_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4472825_4474373_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4474372_4475302_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4475298_4475661_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4475988_4476711_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4476720_4477764_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4477751_4477961_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4477960_4478914_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4478913_4481268_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4481364_4481493_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4481452_4481770_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4481821_4482346_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4482345_4483773_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4483762_4483960_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4483956_4484412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033566939.1|4484571_4484886_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	48.2	3.2e-19
WP_001270441.1|4484898_4485504_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4485506_4485794_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4486369_4486717_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
