The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040500	Lactobacillus paragasseri JV-V03 chromosome, complete genome	1967870	605225	699073	1967870	terminase,plate,integrase,transposase,tail,holin,portal,protease,bacteriocin	Lactobacillus_phage(62.07%)	109	659376:659435	697037:697126
WP_003649214.1|605225_605453_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003649213.1|605462_605660_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003649212.1|605675_606014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649210.1|606735_607020_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003649209.1|607175_607373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649208.1|607386_607617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649207.1|607800_608115_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003649206.1|608250_611052_+	cation-transporting P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.3	5.1e-76
WP_003649205.1|611124_611973_+	patatin family protein	NA	NA	NA	NA	NA
WP_035429810.1|612074_613571_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003649203.1|613554_614289_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.5	7.2e-14
WP_003649202.1|614379_614910_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035429807.1|615027_615897_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003649200.1|615913_616906_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003647609.1|616905_617796_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003647608.1|617806_618607_+	phosphate ABC transporter ATP-binding protein	NA	M1I1R0	Paramecium_bursaria_Chlorella_virus	26.0	2.1e-06
WP_035429803.1|618617_619373_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	6.1e-16
WP_003649198.1|619390_620074_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003649197.1|620208_621747_+	YfcC family protein	NA	NA	NA	NA	NA
WP_003649196.1|621827_622295_+	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	34.0	1.6e-19
WP_035429800.1|622417_622759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649194.1|622817_623741_+	ribokinase	NA	NA	NA	NA	NA
WP_003649193.1|623744_624443_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003649192.1|624558_625482_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_003647599.1|625481_626210_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003649191.1|626276_626603_-	enterocin A Immunity superfamily protein	NA	NA	NA	NA	NA
WP_003649190.1|626866_627646_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_020806808.1|627757_630163_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003649188.1|630328_630985_+	nitroreductase	NA	NA	NA	NA	NA
WP_050748014.1|631097_631802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649186.1|631852_633232_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003649185.1|633329_633899_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.1	1.0e-07
WP_035429793.1|633982_635293_-	amino acid permease	NA	NA	NA	NA	NA
WP_003649183.1|635406_636123_+	lysozyme	NA	NA	NA	NA	NA
WP_035429787.1|636136_637372_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.0	2.4e-33
WP_003649181.1|637371_638703_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_077410211.1|638878_639064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003649180.1|639179_640322_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	28.5	2.5e-29
WP_003649179.1|640359_640869_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003649178.1|640861_641308_-	flavodoxin	NA	NA	NA	NA	NA
WP_003649177.1|641494_642319_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003649176.1|642334_643258_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003649175.1|643316_644225_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	5.1e-78
WP_035429784.1|644343_645177_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_003649173.1|645301_646264_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	9.1e-25
WP_003649172.1|646256_647804_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003649171.1|647817_648228_+	OsmC family protein	NA	NA	NA	NA	NA
WP_101890871.1|648343_648754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649169.1|648821_649433_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_003649168.1|649437_650103_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	1.7e-22
WP_035429778.1|650112_651387_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003649166.1|651516_653901_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_080518320.1|654023_654437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003649164.1|655126_657661_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.7	5.7e-66
WP_003649163.1|657748_658519_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003649162.1|658564_659260_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
659376:659435	attL	GGTCTTCTAAACCGTGGGTCGTGAGTTCGAATCTCACCCAAATCACTGATATGACGCTCC	NA	NA	NA	NA
WP_003649161.1|659499_660603_-|integrase	site-specific integrase	integrase	X2CYE9	Lactobacillus_phage	59.9	1.2e-124
WP_003649159.1|660813_661344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003649158.1|661389_662127_-	hypothetical protein	NA	A0A1S5SGE4	Streptococcus_phage	35.8	6.1e-29
WP_003649157.1|662135_662594_-	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	88.7	2.6e-78
WP_003649156.1|662593_662941_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	61.1	2.3e-31
WP_003649155.1|663088_663304_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003649154.1|663390_663720_+	DUF771 domain-containing protein	NA	X2CYF0	Lactobacillus_phage	88.7	7.3e-51
WP_003648018.1|663722_664025_+	hypothetical protein	NA	X2CY60	Lactobacillus_phage	45.5	1.3e-14
WP_003649153.1|664018_664228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649151.1|664561_664891_+	hypothetical protein	NA	A9D9K5	Lactobacillus_prophage	94.5	7.6e-56
WP_003649150.1|664890_665751_+	DUF1351 domain-containing protein	NA	A9D9K7	Lactobacillus_prophage	93.0	9.3e-146
WP_003649149.1|665756_666578_+	hypothetical protein	NA	A9D9L0	Lactobacillus_prophage	93.4	2.0e-121
WP_003649148.1|666587_667508_+	hypothetical protein	NA	A9D9L3	Lactobacillus_prophage	76.8	1.4e-131
WP_003649147.1|667513_667795_+	hypothetical protein	NA	Q20DG0	Lactobacillus_phage	58.1	7.4e-28
WP_003649146.1|668019_668289_+	hypothetical protein	NA	Q9T1H3	Lactobacillus_phage	36.8	8.5e-05
WP_003649145.1|668291_668540_+	hypothetical protein	NA	X2CYF2	Lactobacillus_phage	48.8	3.0e-12
WP_003649143.1|668781_669243_+	RusA family crossover junction endodeoxyribonuclease	NA	X2CXX1	Lactobacillus_phage	95.4	2.6e-78
WP_003649142.1|669245_669473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649140.1|669663_669951_+	hypothetical protein	NA	Q20DE9	Lactobacillus_phage	87.5	2.6e-44
WP_003649139.1|669953_670163_+	hypothetical protein	NA	Q20DE8	Lactobacillus_phage	92.8	7.2e-28
WP_003649138.1|670179_670722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649136.1|672020_672491_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	39.9	3.1e-26
WP_003649135.1|672465_672909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649134.1|672957_673467_+	hypothetical protein	NA	A9D9R6	Lactobacillus_prophage	91.1	1.4e-80
WP_003649133.1|673429_674659_+|terminase	PBSX family phage terminase large subunit	terminase	X2CYF4	Lactobacillus_phage	96.6	9.3e-240
WP_003649132.1|674649_676062_+|portal	phage portal protein	portal	Q20DD7	Lactobacillus_phage	98.7	3.7e-269
WP_138665923.1|677655_677889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649129.1|678034_678589_+	hypothetical protein	NA	Q20DD5	Lactobacillus_phage	100.0	2.9e-92
WP_003649128.1|678593_679649_+	hypothetical protein	NA	Q20DD4	Lactobacillus_phage	98.3	2.3e-194
WP_003648042.1|679657_680047_+	hypothetical protein	NA	X2CXX4	Lactobacillus_phage	97.7	7.3e-66
WP_003648043.1|680043_680406_+	hypothetical protein	NA	Q20DD2	Lactobacillus_phage	99.2	3.2e-63
WP_003648044.1|680402_680837_+	HK97 gp10 family phage protein	NA	Q20DD1	Lactobacillus_phage	100.0	5.8e-80
WP_003648045.1|680833_681241_+	hypothetical protein	NA	Q20DD0	Lactobacillus_phage	100.0	5.1e-70
WP_003648046.1|681215_681443_+	hypothetical protein	NA	Q20DC9	Lactobacillus_phage	100.0	2.0e-31
WP_003649126.1|681442_682798_+|tail	phage tail protein	tail	Q20DC8	Lactobacillus_phage	98.0	4.7e-245
WP_003649125.1|682809_683280_+|tail	phage tail tube protein	tail	A9D9V4	Lactobacillus_prophage	98.7	8.5e-85
WP_003649124.1|683291_683711_+	hypothetical protein	NA	A9D9V7	Lactobacillus_prophage	98.6	5.8e-69
WP_003649123.1|683947_687361_+	tape measure protein	NA	X2CYG3	Lactobacillus_phage	96.5	2.1e-225
WP_003649122.1|687353_688043_+	hypothetical protein	NA	A9D9W2	Lactobacillus_prophage	94.8	3.7e-113
WP_003649121.1|688039_689086_+	hypothetical protein	NA	X2CXX6	Lactobacillus_phage	99.4	4.2e-201
WP_003649120.1|689064_689427_+	DUF2577 domain-containing protein	NA	X2CXE6	Lactobacillus_phage	97.5	5.6e-60
WP_035429767.1|689407_689800_+	DUF2634 domain-containing protein	NA	X2CXN6	Lactobacillus_phage	96.9	1.3e-65
WP_003649118.1|689796_690948_+|plate	baseplate J/gp47 family protein	plate	X2CYG4	Lactobacillus_phage	98.4	5.3e-213
WP_003649117.1|690937_691498_+	DUF2313 domain-containing protein	NA	Q20DB9	Lactobacillus_phage	99.5	1.5e-96
WP_003649116.1|691510_693679_+	hypothetical protein	NA	X2CXX7	Lactobacillus_phage	95.8	0.0e+00
WP_003649115.1|693718_694237_+	hypothetical protein	NA	Q65YW0	Lactobacillus_phage	97.7	3.8e-86
WP_003648057.1|694236_694431_+	XkdX family protein	NA	X2CXN7	Lactobacillus_phage	100.0	7.1e-30
WP_035424966.1|694447_694807_+	hypothetical protein	NA	Q65YV9	Lactobacillus_phage	95.8	2.2e-56
WP_003649113.1|694817_695096_+	hypothetical protein	NA	X2CYG5	Lactobacillus_phage	97.8	3.6e-43
WP_003649112.1|695092_695524_+|holin	phage holin	holin	X2CY69	Lactobacillus_phage	99.3	5.1e-68
WP_003649111.1|695533_696466_+	lysin	NA	Q65YV6	Lactobacillus_phage	99.7	7.4e-181
WP_119724383.1|696714_696822_-	type I toxin-antitoxin system Fst family toxin	NA	Q65YV5	Lactobacillus_phage	97.1	2.8e-12
WP_035429764.1|697261_699073_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.3	1.3e-93
697037:697126	attR	GGTCTTCTAAACCGTGGGTCGTGAGTTCGAATCTCACCCAAATCACTGATATGACGCTCCGTATGGGGCGTCTTTTTTTGTGCAATTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP040500	Lactobacillus paragasseri JV-V03 chromosome, complete genome	1967870	1298077	1334700	1967870	terminase,integrase,tail,head,holin,portal	Lactobacillus_phage(50.0%)	47	1297857:1297875	1334785:1334803
1297857:1297875	attL	TATTTATGGAGATGAGGGG	NA	NA	NA	NA
WP_119724382.1|1298077_1298182_+	type I toxin-antitoxin system Fst family toxin	NA	Q65YV5	Lactobacillus_phage	81.8	5.3e-08
WP_119724381.1|1298206_1298395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648543.1|1298428_1299376_-	lysin	NA	Q6SE63	Lactobacillus_prophage	60.2	3.6e-106
WP_003648542.1|1299388_1299787_-|holin	phage holin	holin	Q6SEB6	Lactobacillus_prophage	92.4	1.2e-58
WP_003648541.1|1299786_1299981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035429615.1|1299973_1300216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648539.1|1300230_1300629_-	hypothetical protein	NA	Q6SEB9	Lactobacillus_prophage	79.2	5.9e-55
WP_003648538.1|1300686_1301115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648537.1|1301134_1303651_-	hypothetical protein	NA	Q6SEC0	Lactobacillus_prophage	42.4	6.2e-65
WP_003648536.1|1303650_1304025_-	hypothetical protein	NA	Q6SEC1	Lactobacillus_prophage	63.7	3.6e-38
WP_003648535.1|1304017_1306420_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	91.1	0.0e+00
WP_003648534.1|1306419_1307235_-	hypothetical protein	NA	Q6SEC3	Lactobacillus_prophage	87.2	4.0e-130
WP_003648533.1|1307222_1310636_-|tail	phage tail tape measure protein	tail	A0A0A1ENQ9	Lactobacillus_phage	65.0	3.7e-113
WP_003648532.1|1310628_1310949_-	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	48.0	4.8e-15
WP_003648531.1|1310996_1311383_-	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	38.0	2.4e-16
WP_003648530.1|1311382_1312012_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_119724385.1|1312012_1312399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648528.1|1312398_1312764_-	hypothetical protein	NA	A0A0A1ENQ3	Lactobacillus_phage	45.5	1.0e-16
WP_003648527.1|1312756_1313068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648526.1|1313057_1313399_-|head,tail	phage head-tail connector protein	head,tail	Q6SED1	Lactobacillus_prophage	62.8	1.6e-32
WP_003648525.1|1313413_1314322_-	hypothetical protein	NA	A0A0A1ELG8	Lactobacillus_phage	48.3	5.5e-64
WP_003648524.1|1314335_1314929_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_003648523.1|1315000_1315225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138665926.1|1315302_1316013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648520.1|1317052_1318459_-|portal	phage portal protein	portal	Q6SED7	Lactobacillus_prophage	51.0	1.1e-122
WP_035429878.1|1318471_1319701_-|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	51.7	9.3e-123
WP_003648518.1|1319687_1320197_-|terminase	terminase small subunit	terminase	Q20DD9	Lactobacillus_phage	54.1	2.9e-38
WP_003648517.1|1320260_1320917_-	hypothetical protein	NA	Q20DE0	Lactobacillus_phage	100.0	1.9e-119
WP_003648516.1|1321097_1321715_-	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	98.0	8.5e-117
WP_035429609.1|1322153_1322600_-	hypothetical protein	NA	Q6SEE2	Lactobacillus_prophage	65.8	3.1e-52
WP_003648514.1|1322623_1322965_-	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	83.6	2.4e-49
WP_003648512.1|1323488_1323719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648510.1|1324178_1325492_-	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	49.3	6.7e-111
WP_003648509.1|1325484_1326294_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	59.5	8.6e-77
WP_003648508.1|1326303_1326609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648507.1|1326622_1327204_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_003648506.1|1327203_1327971_-	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	56.7	4.5e-67
WP_003648504.1|1328122_1328296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648503.1|1328478_1329747_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	58.7	6.0e-133
WP_003648501.1|1329865_1330138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035429601.1|1330155_1330632_-	hypothetical protein	NA	A0A0A1EL06	Lactobacillus_phage	35.2	1.2e-22
WP_035429598.1|1330921_1331131_-	helix-turn-helix domain-containing protein	NA	Q6SE97	Lactobacillus_prophage	81.2	4.0e-26
WP_003648497.1|1331136_1331346_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003648496.1|1331623_1331953_+	helix-turn-helix transcriptional regulator	NA	Q6SEF6	Lactobacillus_prophage	59.5	3.2e-14
WP_003648495.1|1331942_1332347_+	hypothetical protein	NA	Q6SEF7	Lactobacillus_prophage	93.3	4.2e-72
WP_138665928.1|1333035_1333311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003648492.1|1333515_1334700_+|integrase	site-specific integrase	integrase	Q6SEG4	Lactobacillus_prophage	64.0	1.6e-143
1334785:1334803	attR	TATTTATGGAGATGAGGGG	NA	NA	NA	NA
