The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	1131829	1226396	4965236	head,terminase,portal,holin,transposase,tRNA,tail,integrase,capsid	Cronobacter_phage(67.44%)	83	1165669:1165715	1197345:1197391
WP_085983317.1|1131829_1132992_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1133270_1135253_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1135249_1135888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1137601_1138198_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1138775_1140059_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1140318_1142193_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1142358_1143234_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1144350_1146030_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1146252_1147794_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1147923_1148766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1148765_1149329_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1149352_1149988_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_022742808.1|1151557_1152571_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1152581_1153562_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1153558_1153933_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1153929_1154451_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1154563_1154848_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1154942_1155299_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1155452_1156271_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520307.1|1158102_1160172_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1160207_1160423_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1160873_1161701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1162035_1163229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1163618_1164212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1164258_1164426_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1164439_1165504_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
1165669:1165715	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000290918.1|1165831_1166842_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.7	9.5e-174
WP_001047672.1|1166841_1167408_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.7	1.1e-65
WP_000204908.1|1167553_1167757_+	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	1.0e-10
WP_000460879.1|1167794_1168298_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	1.5e-58
WP_000643375.1|1168307_1168535_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996734.1|1168524_1168950_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|1168949_1169351_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000057335.1|1169418_1169649_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000985848.1|1169639_1169969_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	2.0e-11
WP_000279398.1|1169958_1170792_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	68.3	1.6e-105
WP_000171003.1|1170788_1172810_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.9e-298
WP_000960961.1|1172922_1173141_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	3.6e-06
WP_001669965.1|1173114_1173438_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038205.1|1173434_1174496_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.0e-163
WP_001151940.1|1174492_1176268_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000018802.1|1176428_1177232_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
WP_000550496.1|1177293_1178316_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218537.1|1178319_1179021_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447489.1|1179081_1179570_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	5.0e-64
WP_000084220.1|1179566_1180073_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560083.1|1180069_1180777_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_000220203.1|1180773_1181901_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|1181897_1182353_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|1182362_1182656_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|1182652_1182994_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376370.1|1182993_1183326_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_001270303.1|1183297_1183486_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
WP_000411339.1|1183472_1183730_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_079792143.1|1183917_1185888_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	66.3	1.4e-250
WP_001002797.1|1185884_1186214_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|1186210_1187395_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001823.1|1187387_1187975_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000084299.1|1187984_1190090_+|tail	tail protein	tail	S4TP62	Salmonella_phage	69.0	8.8e-198
WP_072209005.1|1190198_1190657_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	93.2	1.6e-75
WP_000267955.1|1190646_1191372_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
WP_000200789.1|1191343_1191889_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_024131633.1|1191891_1193592_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	3.7e-223
WP_000136561.1|1194272_1195391_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_001177838.1|1197016_1197265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989057.1|1197780_1198944_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1197345:1197391	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196159.1|1198951_1201132_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1201128_1202538_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_022742806.1|1202602_1214077_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1214690_1215173_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1215322_1215799_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1215788_1216079_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1216244_1216583_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1216731_1218393_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1218478_1219357_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1219479_1220070_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_022742805.1|1220104_1220710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1220830_1222117_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1222136_1222928_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1223093_1224455_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1224768_1225017_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1225035_1225584_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1225628_1226396_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	1253205	1358768	4965236	head,lysis,terminase,portal,holin,tRNA,transposase,tail,integrase,capsid	Salmonella_phage(35.0%)	112	1245286:1245302	1334208:1334224
1245286:1245302	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1253205_1254243_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1254358_1255048_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1255366_1255750_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1255811_1256399_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1256501_1257401_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1257418_1258753_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1258883_1259621_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_022742804.1|1259605_1261228_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1261312_1261492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1261491_1261656_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1261652_1262228_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1262259_1262910_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1262909_1263866_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1263862_1264342_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_022742803.1|1264839_1266069_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	5.4e-232
WP_001670787.1|1266046_1266331_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1266371_1266611_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_022742802.1|1266653_1267811_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	4.7e-217
WP_031609046.1|1267773_1270701_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	99.0	0.0e+00
WP_001668146.1|1270827_1271127_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1271148_1271307_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001020640.1|1271660_1272356_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_071529734.1|1272329_1272515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1272453_1272678_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_023139406.1|1272706_1273261_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_031609052.1|1273257_1274400_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_000620702.1|1274396_1274621_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_022742797.1|1274617_1275577_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_024150662.1|1275578_1276061_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_000767086.1|1276949_1277339_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_024150661.1|1277355_1278216_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_050196634.1|1278223_1279213_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_022742791.1|1279227_1279806_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_022742790.1|1280006_1280732_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_024150660.1|1280864_1281290_+	subtilase	NA	NA	NA	NA	NA
WP_071786602.1|1281570_1281762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023221874.1|1281816_1282005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294873.1|1282094_1282484_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_021000643.1|1282470_1282752_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_022742788.1|1282751_1283366_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_050955063.1|1283398_1283845_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_031603581.1|1284172_1284676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669689.1|1284932_1285334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1285619_1286165_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623088.1|1286136_1288068_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000201415.1|1288051_1288255_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1288251_1289832_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189498.1|1289821_1291318_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000011260.1|1291330_1291678_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_022742784.1|1291732_1292761_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000201485.1|1292818_1293184_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083293.1|1293194_1293572_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000677089.1|1293558_1294137_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_022742782.1|1294133_1294535_+	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000971953.1|1294542_1295289_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1295339_1295735_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1295731_1296070_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_022742781.1|1296041_1299137_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_000447369.1|1299139_1299469_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1299478_1300177_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1300183_1300921_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1300818_1301466_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1301527_1304890_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1304928_1305171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742779.1|1305224_1307597_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
WP_000593433.1|1307593_1308418_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1308407_1308986_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1309082_1309310_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1309416_1309629_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1309691_1309757_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1310336_1310501_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1311213_1311351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1311883_1313377_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1313781_1315581_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1315597_1316572_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1316845_1317526_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1317522_1318428_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1318439_1319168_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1319179_1319911_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1319910_1320291_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1320402_1320663_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1320700_1321627_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1321742_1322939_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1322960_1323878_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1323916_1324765_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1324880_1325774_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1325784_1327146_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1327149_1327785_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1327809_1328361_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734248.1|1328411_1329956_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001747289.1|1329956_1330190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970045.1|1330211_1334099_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001670672.1|1334748_1336179_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
1334208:1334224	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_001054236.1|1336180_1336945_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625591.1|1336941_1338279_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_000717694.1|1338355_1338694_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000856793.1|1338742_1340203_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_001100652.1|1340258_1342403_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000100008.1|1342485_1343817_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187150.1|1344177_1345722_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000883146.1|1345903_1347094_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919178.1|1347418_1348672_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_001173729.1|1348867_1350007_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000982961.1|1350001_1351279_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000805728.1|1351404_1352043_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000111027.1|1352033_1353020_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000020685.1|1353020_1354034_-	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000017587.1|1354044_1354863_-	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000985204.1|1354866_1355910_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000174944.1|1356091_1356970_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000553467.1|1357114_1357918_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940032.1|1358036_1358768_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	1682511	1712097	4965236	tail,holin,protease	Salmonella_phage(33.33%)	31	NA	NA
WP_000781589.1|1682511_1683006_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1683419_1683911_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1683900_1684164_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1684160_1686647_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1686653_1687349_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1687335_1688205_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1688320_1688770_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1688779_1689382_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1689402_1690020_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1690016_1690676_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1690727_1691465_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1691461_1691674_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1691670_1692150_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1692146_1694078_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1694074_1694632_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_022742763.1|1694628_1695672_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1695715_1696363_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1697092_1697656_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1697847_1698051_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1698353_1699145_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1699441_1699645_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1699813_1702180_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1702508_1703498_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1703512_1703881_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_079792211.1|1703909_1705241_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.1	1.6e-19
WP_001120499.1|1705537_1705867_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1706459_1707701_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1707703_1708231_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1708608_1709052_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1711275_1711566_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1711593_1712097_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	1783980	1793151	4965236	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1783980_1784928_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1784911_1785643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1785623_1785731_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1785790_1786522_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1786744_1788430_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1788426_1789146_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1789192_1789660_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1789716_1790247_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1790418_1790877_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1791117_1793151_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	1861459	1871965	4965236		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1861459_1862863_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1863040_1863934_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1864310_1865396_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1865395_1866295_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1866342_1867221_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1867221_1867773_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1867778_1868771_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1868767_1869541_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1869545_1870625_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1870651_1871965_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	1958670	2008736	4965236	head,terminase,portal,holin,plate,tail,integrase,capsid,protease	Salmonella_phage(83.58%)	72	1953248:1953262	1969378:1969392
1953248:1953262	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1958670_1959144_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1959791_1960082_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1960453_1961251_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1961542_1962532_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1962533_1962776_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1962800_1963370_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1963373_1963955_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1963965_1964223_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1964224_1964758_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1964828_1965368_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1965504_1966332_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1966389_1966761_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1967300_1967525_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1967487_1967826_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1968031_1968727_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_071529734.1|1968700_1968886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1968824_1969049_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1969077_1969632_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1969378:1969392	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1969628_1970786_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1970782_1971007_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1971003_1971822_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1971823_1972306_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1972305_1973199_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1973195_1973585_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_020899399.1|1973601_1974462_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_020899400.1|1974469_1975459_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899401.1|1975472_1976225_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1976375_1976633_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1976778_1977165_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1977151_1977433_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1977432_1978047_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|1978043_1978436_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_097053918.1|1978320_1978599_+	peptidase	NA	Q8SBD8	Shigella_phage	74.4	1.3e-24
WP_001379492.1|1978898_1979231_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1979281_1979632_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929171.1|1979757_1980252_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_000088175.1|1980248_1981982_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000605609.1|1981993_1982176_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_020899404.1|1982175_1983417_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_001193639.1|1983394_1984045_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257526.1|1984059_1985265_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_000601352.1|1985315_1985516_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000927378.1|1985518_1985842_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702410.1|1985838_1986243_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_001135699.1|1986214_1986727_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000779216.1|1986723_1987284_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_000497740.1|1987287_1987452_+	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_001007996.1|1987441_1988938_+|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000515952.1|1988937_1989294_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588854.1|1989290_1989617_+|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
WP_000785390.1|1989701_1991630_+|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000863827.1|1991663_1993004_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_001066630.1|1993000_1994059_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273648.1|1994058_1994592_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_000605051.1|1994596_1995010_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785578.1|1995002_1996082_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_001207832.1|1996084_1996672_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_020899405.1|1996658_1998221_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_022742744.1|1998190_1998796_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|1998909_1999143_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|1999217_1999331_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|1999378_1999792_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|1999788_2000001_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2001194_2001356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2001482_2001902_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2001904_2003173_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2003627_2003840_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2003850_2004039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2004299_2005496_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2006145_2006445_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2006536_2007232_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2007305_2008736_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	2112780	2156369	4965236	head,lysis,terminase,transposase,tail,integrase	Edwardsiella_phage(20.0%)	66	2109712:2109726	2146126:2146140
2109712:2109726	attL	ACTGCTGGATAACGT	NA	NA	NA	NA
WP_000856224.1|2112780_2113011_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2113148_2113523_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2113523_2114399_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2114415_2114769_+	YebY family protein	NA	NA	NA	NA	NA
WP_022742740.1|2115151_2116231_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_001575998.1|2116205_2116484_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_077907869.1|2116544_2116781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139359.1|2117071_2117251_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_023139358.1|2117861_2118194_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_001033921.1|2118186_2118507_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_001534364.1|2118542_2119373_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_022742735.1|2119365_2122056_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_000799627.1|2122196_2122532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2122607_2122814_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|2122817_2123093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|2123353_2123533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783771.1|2123477_2123666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574209.1|2123963_2124362_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033911.1|2124460_2124715_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001534383.1|2124701_2125196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742734.1|2125239_2126247_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_000140163.1|2126239_2126701_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_022742732.1|2126713_2127109_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_023139357.1|2127105_2127378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|2127584_2127737_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_024150651.1|2127929_2128235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742730.1|2128298_2128898_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_021000145.1|2128894_2129089_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_023139355.1|2129085_2129397_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_023139354.1|2129736_2130078_+	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_022742728.1|2130109_2130640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139353.1|2130626_2131556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071590376.1|2131689_2131917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|2132033_2132240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742726.1|2132230_2132776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2133053_2133512_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_001526513.1|2133678_2133981_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001208103.1|2133958_2134447_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_085983312.1|2134467_2134908_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
WP_001113128.1|2135133_2135316_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_022742724.1|2135386_2136139_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_022742723.1|2136104_2137526_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_023139350.1|2137525_2139046_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_000552017.1|2139086_2139776_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139349.1|2139772_2141119_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_001525451.1|2141120_2141603_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_001031915.1|2141602_2142631_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001748493.1|2142634_2142982_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_023139348.1|2142988_2143444_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_022742718.1|2143437_2144022_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_001748490.1|2144018_2144384_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_000094504.1|2144368_2144914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001748488.1|2144894_2146379_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
2146126:2146140	attR	ACGTTATCCAGCAGT	NA	NA	NA	NA
WP_000016414.1|2146379_2146826_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|2146825_2147230_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|2147271_2147454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742717.1|2147437_2149609_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_022742716.1|2149605_2150316_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_000890115.1|2150315_2150618_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|2150614_2151484_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_022742715.1|2151464_2152142_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
WP_001191865.1|2152154_2152511_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_022742714.1|2152507_2153749_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_022742713.1|2153750_2154353_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742712.1|2154342_2155794_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742711.1|2155793_2156369_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
>prophage 8
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	2953313	3052122	4965236	lysis,terminase,portal,holin,tRNA,tail,integrase,protease	Salmonella_phage(43.64%)	100	2977407:2977426	3049195:3049214
WP_000938191.1|2953313_2953994_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2954614_2955274_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2955360_2955690_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2955686_2955968_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2956016_2956796_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2956821_2957370_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2957584_2958796_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2958853_2959171_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2959215_2959632_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2959802_2960465_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2960559_2961018_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2961053_2963108_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2963231_2963678_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2963696_2965850_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2965836_2966442_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2966658_2967168_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2967524_2968577_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2968648_2969101_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2969286_2971047_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2971115_2971634_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2971733_2971901_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2972156_2972720_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2972716_2974357_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2974361_2975615_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2975629_2977537_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2977407:2977426	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2977549_2979658_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2979756_2980866_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2980862_2981405_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_022742665.1|2981570_2982581_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2982788_2985401_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2985827_2986019_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2986289_2986976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2986960_2987260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2987328_2987955_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2988602_2989571_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_022742661.1|2990046_2990628_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_022742660.1|2990627_2993066_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
WP_000178849.1|2993119_2993362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126834981.1|2993400_2994969_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	1.2e-127
WP_000246065.1|2996823_2997528_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_022742655.1|2998172_2998868_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000877926.1|2998957_2999491_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2999607_3000105_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|3000203_3000536_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|3000532_3003520_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|3003599_3003929_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|3003925_3004324_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3004369_3005119_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3005130_3005532_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3005528_3006095_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|3006075_3006375_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|3006367_3006691_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3006781_3008863_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|3008786_3010304_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|3010330_3010537_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3010533_3012672_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3012628_3013162_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3013369_3013849_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3013866_3014319_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3014302_3014632_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3014907_3015594_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3015954_3016404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3016539_3016665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|3016838_3017156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742653.1|3017222_3018020_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_001617856.1|3018009_3018156_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3018152_3018764_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|3018766_3018973_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000807548.1|3019657_3019879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3019990_3020224_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|3020515_3020806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3020883_3021195_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3021191_3021539_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3021549_3022299_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3022301_3023285_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3023369_3023744_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3023709_3023949_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3024068_3024479_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989002.1|3024528_3024789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|3024781_3024940_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|3024961_3025261_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_022742652.1|3025387_3028273_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|3028235_3029393_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3029435_3029675_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3029715_3029964_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|3030008_3031301_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|3031495_3032698_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000544849.1|3034455_3035670_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|3035756_3035990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|3035986_3036448_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3036648_3038049_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3038655_3039747_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3039931_3041122_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|3041183_3041831_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3041858_3042407_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3042666_3044508_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_022742649.1|3044852_3049319_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3049195:3049214	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3049318_3050023_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3050003_3051326_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3051318_3052122_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	3102185	3110917	4965236	protease,transposase	Enterobacteria_phage(14.29%)	8	NA	NA
WP_085983316.1|3102185_3103440_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|3103455_3103731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|3103903_3104362_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000934063.1|3104553_3106830_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3106860_3107181_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3107504_3107726_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3107855_3109802_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3109798_3110917_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	3703559	3748803	4965236	lysis,terminase,portal,coat,integrase,protease	Enterobacteria_phage(79.1%)	68	3695249:3695265	3758018:3758034
3695249:3695265	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_077942643.1|3703559_3703739_-	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	92.3	4.3e-13
WP_000915528.1|3703855_3704218_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3704214_3705147_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3705136_3706594_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3706652_3708656_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3708791_3709040_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3709060_3709354_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3709492_3711469_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3711468_3712905_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3712915_3713605_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3713607_3714063_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3714062_3714764_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3714767_3716186_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3716145_3716646_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3716629_3717190_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3717230_3718523_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000433855.1|3718522_3719434_-	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_000774652.1|3719447_3721625_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3721624_3723124_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3723101_3723590_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3723593_3723998_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3723997_3724387_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3724390_3724633_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3724855_3725386_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_071533034.1|3725339_3725564_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
WP_001687043.1|3725598_3726066_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3726062_3726560_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3726537_3726741_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_071533031.1|3726825_3727059_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
WP_001047566.1|3727171_3727945_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3727941_3728121_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3728101_3728305_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3728301_3728526_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3728522_3729134_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3729126_3729303_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3729295_3729637_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3729639_3729816_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3729782_3729956_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3729952_3730390_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3730463_3730733_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3730729_3732106_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3732102_3732924_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001103492.1|3733106_3733388_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3733498_3733714_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3733824_3734514_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3734678_3735758_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3735796_3736000_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3736363_3736666_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3736678_3737266_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3737479_3737674_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_015974224.1|3737757_3738402_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000713613.1|3738435_3738723_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3738998_3739313_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3739397_3739556_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3739536_3739725_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001046968.1|3739854_3740562_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3740561_3740846_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3740892_3741186_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3741196_3741367_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3741363_3741873_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3741869_3742103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3742089_3742734_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3742733_3743018_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3743010_3743295_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000051897.1|3743733_3744897_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893231.1|3745102_3746353_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3746364_3747468_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3747750_3748803_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3758018:3758034	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 11
NZ_CP040568	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 chromosome, complete genome	4965236	4502269	4549312	4965236	tail,plate,tRNA	Burkholderia_phage(42.86%)	49	NA	NA
WP_001182237.1|4502269_4503268_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4503355_4504666_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4504912_4505428_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4505526_4505736_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4505757_4505871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4505867_4507193_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4507371_4507980_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4508088_4508457_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4508627_4511048_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4511146_4512019_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4512032_4512530_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4512710_4513628_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4513791_4515150_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4515238_4516348_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4516709_4517900_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4518031_4519576_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4519590_4520481_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4520646_4521057_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_022742864.1|4521199_4523296_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4523295_4524033_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4524029_4524698_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4524731_4524974_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4525417_4527067_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4527411_4528761_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4528893_4529241_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4529816_4530104_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4530106_4530712_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4530724_4531039_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4531198_4531654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4531650_4531848_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4531837_4533265_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4533264_4533789_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4533840_4534158_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4534117_4534246_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4534342_4536697_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001269716.1|4537648_4537858_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4537845_4538889_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4538898_4539621_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4539948_4540311_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4540307_4541237_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4541236_4542784_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4542947_4543307_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4543297_4544413_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4544405_4545038_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4545040_4546786_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4546790_4547396_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4547392_4547848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4548096_4548387_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4548583_4549312_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP040569	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 plasmid pCFSAN059542, complete sequence	94033	38156	47452	94033	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_000088645.1|38156_38837_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000091632.1|38981_39170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|39218_39575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|39567_40038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|40548_40971_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_022743179.1|40970_42245_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_001541561.1|42326_43304_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|43300_44506_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|44920_45862_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|45893_46460_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|46516_46852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|47035_47452_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
