The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	1171548	1195055	5457696	holin,integrase,tail,transposase	Stx2-converting_phage(35.29%)	30	1163194:1163208	1195926:1195940
1163194:1163208	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1171548_1172754_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1172755_1174069_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1174065_1175697_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1175697_1176096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1176193_1176607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150578.1|1177002_1178247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1178322_1178625_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1178660_1179416_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1179763_1180330_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1180304_1180916_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1180912_1181578_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1181574_1182198_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1182450_1183194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1183279_1183447_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1183854_1185708_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1185857_1186073_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1186077_1186422_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1186778_1187159_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1187155_1187503_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1187552_1188197_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1188003_1188894_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1188890_1189217_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1189434_1189704_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1189864_1190287_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1190416_1191475_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1191553_1192204_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1192386_1192977_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1192963_1193083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1193478_1193727_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1194572_1195055_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1195926:1195940	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	1472672	1478059	5457696	integrase	Enterobacteria_phage(50.0%)	6	1461621:1461637	1480255:1480271
1461621:1461637	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|1472672_1473203_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1473202_1473670_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1473656_1474337_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1474346_1475483_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1475657_1476815_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1477126_1478059_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1480255:1480271	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	1723678	1798614	5457696	holin,protease,tRNA,terminase,integrase,tail,portal,transposase	Enterobacteria_phage(66.27%)	95	1726153:1726173	1772719:1772739
WP_000569336.1|1723678_1724605_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1724609_1725341_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1725321_1725429_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1725488_1726190_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1726153:1726173	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1726210_1727497_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1727530_1727785_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1727803_1727938_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1727941_1728184_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1728271_1728634_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1728630_1728987_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1729063_1729351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304101.1|1729320_1729497_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
WP_001289954.1|1729498_1730446_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1730442_1730664_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1730762_1731044_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1731054_1731246_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1731218_1731401_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1731400_1732078_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1732074_1732860_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1732865_1733162_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_001478900.1|1733130_1733283_-	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	3.6e-21
WP_000372942.1|1733237_1733381_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1733349_1733514_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1733586_1733955_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1734215_1734797_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1734813_1735086_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1735598_1736150_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1736156_1736438_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1736560_1737208_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1737316_1737535_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1737649_1737946_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000185456.1|1737978_1738917_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|1738913_1739615_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1739611_1739902_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1739972_1740251_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1740383_1740599_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1740609_1740846_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1740802_1741249_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1741245_1741773_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1741769_1741946_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1741948_1742350_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1742309_1742519_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1742511_1743117_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1743113_1743308_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1743300_1743735_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_015971135.1|1743723_1743969_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_000691354.1|1744241_1745189_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1745198_1745468_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1745978_1747925_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1748062_1748242_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1748282_1748528_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1748605_1748821_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1748825_1749359_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1749629_1750199_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1750198_1750345_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1750572_1750758_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1750969_1751242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1751274_1751751_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1751747_1753871_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1753867_1754080_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1754079_1755582_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001450953.1|1755595_1756591_+|protease	Clp protease ClpP	protease	Q9EYD3	Enterobacteria_phage	98.3	9.4e-158
WP_000502242.1|1756509_1757550_+	peptidase	NA	Q8VNN5	Enterobacteria_phage	99.7	5.9e-195
WP_001097065.1|1757637_1757964_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1757956_1758238_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1758240_1758864_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1758876_1759275_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1759282_1760035_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1760048_1760471_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1760497_1760806_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1760849_1763495_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1763491_1763821_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1763820_1764519_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1764529_1765273_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1765218_1765848_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|1766088_1767264_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|1767215_1769561_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1769628_1770228_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_001302809.1|1770292_1771606_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1771607_1771877_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1772244_1772493_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1773007_1774693_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1772719:1772739	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1774689_1775409_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1775455_1775926_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1775967_1776429_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_085952772.1|1776612_1777825_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001302810.1|1779866_1781003_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1780995_1781727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1781745_1783275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1783285_1784374_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1785614_1785932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1785993_1789623_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1789632_1791174_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1791337_1792618_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1796580_1798614_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	1925566	1997963	5457696	holin,head,terminase,integrase,tail,portal,transposase	Escherichia_phage(34.04%)	73	1925073:1925088	1982151:1982166
1925073:1925088	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_085952406.1|1925566_1926780_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|1927151_1929299_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|1929405_1929588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|1930746_1932285_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1932334_1932682_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1932678_1933059_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1933420_1933966_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1933962_1934706_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1934717_1935797_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1935858_1936794_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1937250_1938168_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1938269_1939220_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1941606_1942323_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1942665_1944120_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1944221_1945538_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1945851_1946904_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|1947165_1955148_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|1955637_1956435_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|1956670_1957693_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|1957692_1957896_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|1957954_1960426_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|1960521_1960710_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|1960706_1960895_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|1961375_1961528_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|1961802_1962447_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1962544_1962772_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1962768_1963194_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|1963262_1964300_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|1964331_1964754_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|1964788_1965487_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|1965508_1965733_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1965729_1966086_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|1966118_1966271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|1966267_1966579_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|1966705_1967269_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|1967378_1967483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1967669_1967882_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|1967923_1968109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|1968049_1968328_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|1968329_1969379_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|1969391_1969751_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|1969747_1970437_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|1970467_1970590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|1971070_1971499_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|1971976_1973827_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|1973908_1975122_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|1975441_1975648_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|1975652_1975997_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|1976047_1976581_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|1976736_1976919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1976931_1977063_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1977290_1977476_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|1978002_1978317_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1978398_1978623_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|1979017_1979527_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|1981409_1981616_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1981612_1983205_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
1982151:1982166	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|1983194_1984700_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1984736_1985084_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1985141_1985408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1985389_1986130_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1986143_1986575_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1986601_1987015_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082449.1|1986995_1989575_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000847298.1|1989571_1989901_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1989900_1990599_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|1990609_1991353_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|1991298_1991928_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_001413764.1|1992168_1993344_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_115801853.1|1993295_1995647_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|1995714_1996314_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|1996378_1997692_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|1997693_1997963_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	2055543	2075526	5457696	integrase,tail,transposase	Enterobacteria_phage(79.17%)	28	2068662:2068675	2078668:2078681
WP_032161728.1|2055543_2056677_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|2056627_2056951_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2057108_2058293_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2058292_2058805_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2058859_2059225_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|2059260_2059389_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|2062191_2062680_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2062836_2063409_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|2063452_2063869_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|2065074_2065389_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|2065393_2066353_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|2066429_2069252_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2068662:2068675	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2069258_2069624_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|2069696_2069927_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2070249_2070549_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2070545_2070812_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2070808_2071012_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2071035_2071452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2071544_2071658_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2071654_2071897_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2071908_2072187_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2072197_2072548_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2072569_2072773_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2072844_2072982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2073071_2073476_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2073491_2074142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2074171_2074519_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2074524_2075526_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2078668:2078681	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	2396072	2486096	5457696	holin,capsid,head,protease,terminase,tail,portal,transposase	Stx2-converting_phage(34.48%)	101	NA	NA
WP_001260835.1|2396072_2396894_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2396993_2397077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2397169_2397505_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2397901_2399155_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2399261_2400155_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2400289_2401510_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2401634_2402330_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2402282_2403575_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2403732_2404347_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2404389_2405244_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2405245_2405863_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2405873_2408297_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2408357_2410784_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2410982_2411288_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2411395_2412106_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2412108_2412669_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2412703_2413045_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2413179_2413506_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2413678_2413804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2414494_2414731_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2414818_2417290_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2417382_2417574_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2417570_2417759_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2418159_2418324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2418327_2418546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2418617_2418917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2419269_2419548_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2419549_2419741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2419761_2420133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2420230_2420533_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2420529_2420955_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2420977_2421940_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2421946_2422687_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2423497_2423893_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2423949_2424534_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2424649_2424754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2424942_2425155_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2425322_2425601_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2425602_2426652_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2426664_2427024_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2427020_2427710_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|2427740_2427863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|2428349_2428778_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2429256_2431107_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|2431555_2431762_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2431766_2432111_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2432161_2432695_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2432965_2433535_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2433534_2433681_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2433908_2434094_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2434518_2434746_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2434787_2435153_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2435442_2436006_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2436002_2437664_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2437727_2439665_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2439709_2439931_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_138553724.1|2439876_2442456_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.1	0.0e+00
WP_000125988.1|2442458_2442785_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2442794_2443145_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2443141_2443588_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2443584_2443929_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275509.1|2443987_2444704_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	2.5e-128
WP_001030063.1|2444709_2445084_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2445179_2445389_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212899.1|2445441_2448684_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_000807950.1|2448676_2449018_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179476.1|2449017_2449455_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.2	1.9e-62
WP_000514792.1|2449642_2453119_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001228304.1|2453186_2453786_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2453937_2455251_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|2455252_2455522_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2456548_2457874_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|2458141_2458330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106409364.1|2459471_2459594_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2459700_2460612_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2460677_2461247_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2462212_2463751_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2463800_2464148_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2464144_2464525_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2464864_2465143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2465570_2465717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2465853_2466501_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2466684_2467275_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|2469003_2469432_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|2470025_2470244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|2470745_2471252_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2471297_2471798_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2471883_2472063_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2472443_2473250_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2473249_2474443_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|2474454_2475813_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|2475816_2477412_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2477411_2478974_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2479065_2479110_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2479247_2480129_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2480125_2480746_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2480773_2482357_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2482569_2483442_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2483481_2484072_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2484068_2484827_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2485046_2486096_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	2564216	2679694	5457696	holin,capsid,head,tRNA,terminase,integrase,tail,portal,transposase	Escherichia_phage(36.51%)	145	2554096:2554111	2607953:2607968
2554096:2554111	attL	GAATTTGCCTGAATAT	NA	NA	NA	NA
WP_085948178.1|2564216_2565430_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001156434.1|2566289_2567735_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000444937.1|2567734_2569045_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_000885454.1|2569220_2570129_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|2570458_2571022_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|2571042_2572275_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2572529_2573513_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_124056621.1|2573801_2574032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2573990_2575364_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2575492_2576428_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2576479_2577715_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2577716_2577932_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2578031_2578220_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2578257_2578407_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2578462_2579272_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|2579264_2581865_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|2581966_2582242_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2582316_2582487_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2582486_2582708_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2583149_2583638_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2583634_2583790_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|2583800_2583935_-	phage protein	NA	NA	NA	NA	NA
WP_015695616.1|2583967_2584186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2584222_2584642_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2584721_2584976_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2584972_2585395_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|2585472_2586261_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|2586267_2587014_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|2587036_2587798_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|2587813_2588236_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|2588341_2588554_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|2588639_2588804_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|2588805_2589069_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|2589079_2589241_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|2589319_2589565_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|2589996_2591148_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2591115_2592105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2592104_2593496_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|2593995_2594595_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|2594594_2594885_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|2594881_2595436_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|2595997_2596429_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143079.1|2597003_2598857_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000284522.1|2599006_2599222_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|2599226_2599571_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992137.1|2599621_2600155_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2600425_2600995_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2600994_2601141_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2601368_2601554_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2601978_2602206_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2602247_2602613_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2602902_2603466_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2603462_2605124_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2605187_2607125_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2607169_2607391_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|2607336_2609916_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
2607953:2607968	attR	ATATTCAGGCAAATTC	NA	NA	NA	NA
WP_000125988.1|2609918_2610245_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2610254_2610605_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2610601_2611048_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2611044_2611389_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2611454_2612171_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2612185_2612560_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2612655_2612865_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212822.1|2612912_2616155_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_000807954.1|2616147_2616489_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|2616488_2617187_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|2617197_2617941_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2617886_2618519_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2618860_2620036_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_001230508.1|2622402_2623002_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2623066_2624290_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2624291_2624561_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_010917823.1|2625628_2625976_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|2625960_2626611_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2627193_2628732_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2628781_2629129_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2629125_2629506_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2630468_2630783_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2631421_2632666_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2632758_2632947_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2632943_2633132_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2633696_2633906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2633906_2634545_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2634556_2634709_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2635001_2635340_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2635731_2635974_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2635957_2636383_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2636451_2637495_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2637526_2637949_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2637982_2638699_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2638731_2639013_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2639009_2639237_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2639229_2639541_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2639668_2639887_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2639888_2640446_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2640679_2640892_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2641011_2641356_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2641477_2641750_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2641751_2642801_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2642813_2643119_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2643181_2643736_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2643960_2644158_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2644293_2645007_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2645457_2645889_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2646366_2648217_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|2648664_2648871_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2648875_2649220_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2649270_2649804_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2650074_2650644_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2650643_2650790_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2651012_2651198_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2651723_2652038_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2652119_2652344_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2652359_2652617_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867493.1|2652730_2653276_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2653250_2655176_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2655172_2655379_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2655375_2656977_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2656957_2658277_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2658286_2658619_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2658674_2659700_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2659741_2660140_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2660151_2660505_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2660519_2661053_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2661049_2661445_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2661452_2662205_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2662218_2662641_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2662667_2663081_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2663061_2665674_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2665670_2666000_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2665999_2666698_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2666708_2667452_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2667397_2668027_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514945.1|2668267_2671747_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|2671814_2672414_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2672478_2673702_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2673703_2673973_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2674086_2674662_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2674734_2675364_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2675445_2676087_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001480712.1|2676117_2676252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|2676248_2676563_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2676622_2677906_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2677994_2679455_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2679490_2679694_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	2861661	2910567	5457696	holin,head,capsid,terminase,integrase,tail	Escherichia_phage(32.69%)	65	2854545:2854559	2913449:2913463
2854545:2854559	attL	TTTTGACTTTCTGCT	NA	NA	NA	NA
WP_001295593.1|2861661_2862096_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2862676_2863318_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2863399_2864029_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2864101_2864677_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2864789_2865059_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2865060_2866374_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2866438_2867038_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2867108_2870606_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2870739_2871267_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_010917807.1|2871297_2871504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064732755.1|2871457_2872090_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2872035_2872779_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2872789_2873488_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2873487_2873829_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2873821_2876902_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2876953_2877163_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2877258_2877633_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2877638_2878355_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2878423_2878768_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2878764_2879211_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2879207_2879558_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2879567_2879894_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2882420_2882642_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2882686_2884624_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2884687_2886349_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2886345_2886909_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2887197_2887563_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2887604_2887805_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2887936_2888263_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_001412416.1|2888198_2888381_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.3	2.2e-25
WP_077631024.1|2888371_2888572_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	71.8	7.2e-09
WP_012817877.1|2888663_2888849_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2889071_2889203_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2889297_2889993_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2890266_2890800_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731259.1|2890850_2891195_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2891199_2891415_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2891564_2893418_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|2893537_2893723_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000935548.1|2894214_2895273_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2895423_2895621_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2895862_2896393_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2896401_2896761_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2896773_2897820_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2897821_2898100_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2898169_2898427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2898647_2898860_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2899138_2899897_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2900595_2900760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2900756_2901338_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|2901524_2901947_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|2901978_2903019_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2902990_2903542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2903525_2903753_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2903829_2904237_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2904500_2904800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2904872_2905091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2905113_2905521_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2905498_2905732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2905725_2905869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2906205_2906394_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2906390_2906582_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2906674_2909146_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2909210_2909459_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2909436_2910567_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2913449:2913463	attR	TTTTGACTTTCTGCT	NA	NA	NA	NA
>prophage 9
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	2957263	3129467	5457696	holin,capsid,head,protease,tRNA,terminase,integrase,tail,portal,transposase,lysis	Enterobacteria_phage(32.79%)	206	3115034:3115054	3136124:3136144
WP_001299679.1|2957263_2958520_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2958733_2959357_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2959356_2960208_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2960358_2961306_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2961430_2963110_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2963164_2963443_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2963720_2964305_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2964421_2965513_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|2968334_2969405_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|2969415_2970048_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|2970058_2971477_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|2971789_2971918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|2972023_2973481_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|2973508_2973709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|2973816_2974839_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|2974838_2975819_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|2975815_2976574_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|2976583_2977228_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|2977172_2977454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|2977392_2978247_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|2978272_2980243_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|2980292_2980547_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|2980747_2981344_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|2981395_2982608_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|2982796_2983408_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|2983507_2984422_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2984517_2986254_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|2986645_2987716_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2987725_2989024_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2989386_2990919_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|2990970_2991690_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2991911_2993453_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2993598_2994129_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|2994174_2995443_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2995442_2995862_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2996234_2997146_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2997352_2997814_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2997890_2998550_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2998621_2998915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2999155_2999557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|2999659_3000028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3000547_3001243_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3001266_3002079_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3002082_3002349_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_085948178.1|3003514_3004728_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000361110.1|3004901_3005486_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3005984_3006938_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3007124_3008609_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3008911_3010450_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3010499_3010847_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3010843_3011224_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3011299_3011548_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3011604_3012273_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3012770_3012953_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3013031_3013532_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3013568_3014075_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3014093_3014984_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3015103_3015685_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|3015684_3018600_-	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3018664_3019264_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3019330_3022729_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3022789_3023422_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3023358_3024102_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3024107_3024806_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3024805_3025135_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3025131_3027681_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3027673_3028108_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3028089_3028512_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3028527_3029268_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3029275_3029671_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3029667_3030246_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3030257_3030611_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3030622_3031021_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3031062_3032088_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3032143_3032476_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3032485_3033805_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3033785_3035387_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3035383_3035590_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3035586_3037512_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3037486_3038032_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3038420_3038615_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3038779_3038986_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3039271_3039682_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3039973_3040267_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3040357_3040540_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3040756_3041233_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3041219_3041525_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3041846_3042536_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3042532_3042673_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3042669_3043032_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3043028_3043319_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3043311_3043482_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3043481_3043937_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3044127_3044319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|3044438_3045965_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3046022_3046145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3046209_3046542_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3046609_3046912_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3046908_3047610_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3047606_3048431_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3048534_3048771_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3048760_3049903_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3050016_3051267_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3051438_3052092_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3052101_3052563_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3052616_3053723_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3053758_3054400_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3054403_3055774_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3055942_3056614_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3056613_3058074_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001302829.1|3058377_3058626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133425.1|3058930_3059212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127900.1|3059225_3060887_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000113645.1|3060870_3061227_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3061350_3061533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3061516_3061957_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3061956_3062253_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3062249_3062588_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000171117.1|3062584_3063760_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_000504050.1|3063797_3064370_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3064409_3065567_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3065859_3066084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3066208_3066481_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3066491_3066902_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3066898_3067150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3067520_3069653_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3069649_3069949_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3069954_3070197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3070186_3070378_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3070377_3070563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3070555_3070753_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3070778_3071522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3071579_3071768_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3072132_3073362_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3073610_3074732_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3074780_3076007_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3076256_3077393_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3077376_3078240_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|3078270_3078483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|3078603_3079965_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3080025_3080301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3080380_3080506_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|3082609_3086011_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3086601_3088950_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3088969_3089059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3089071_3089308_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3089253_3089991_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3090044_3090923_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3091225_3091336_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3091445_3091700_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3091716_3092415_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3092414_3092756_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3092748_3095991_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3096043_3096253_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3096348_3096723_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3096728_3097445_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3097503_3097848_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3097844_3098291_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3098287_3098638_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3098647_3098974_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3099053_3101555_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3101500_3101722_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3101766_3103704_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3103767_3105429_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3105425_3105989_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3106278_3106644_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3106685_3106871_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3107000_3107141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3107497_3107722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3107786_3107993_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3108220_3108367_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3108366_3108936_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3109206_3109740_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3109790_3110135_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3110139_3110355_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3110430_3110700_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3110737_3110920_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3111067_3113005_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3113319_3113487_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3114083_3114905_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3114901_3115276_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3115034:3115054	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3115288_3116338_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3116339_3116618_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3116785_3116998_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3117186_3117291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3117406_3117994_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3117996_3118188_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3118189_3118627_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3118613_3118931_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3118884_3119202_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3119191_3119494_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3119490_3119808_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3119804_3120521_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3120554_3120977_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|3121008_3122046_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3122114_3122540_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3122523_3122847_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3122971_3123448_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3123763_3123916_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3124030_3124546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3124678_3125068_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3125129_3125399_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3125367_3126486_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3126652_3127447_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3127443_3128490_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3128645_3129467_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3136124:3136144	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	3356942	3396443	5457696	holin,capsid,terminase,tail,portal,bacteriocin	Escherichia_phage(55.56%)	45	NA	NA
WP_001028088.1|3356942_3357437_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3357457_3358786_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3358868_3358976_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_024177246.1|3359341_3359548_-	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	100.0	1.3e-26
WP_000203825.1|3359934_3360564_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|3360611_3360833_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3360829_3361114_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000426668.1|3361998_3362394_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3362627_3362840_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3362959_3363304_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000971668.1|3363383_3363572_-	hypothetical protein	NA	A0A0P0ZAD9	Stx2-converting_phage	100.0	4.1e-30
WP_000331690.1|3363854_3372236_-	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
WP_000012450.1|3372305_3373571_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3373581_3373833_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3373842_3374289_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3374291_3374948_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3375041_3375443_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3375499_3375640_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3375872_3376607_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3376697_3377315_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3377320_3377599_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3377613_3378882_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3378878_3380504_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3380798_3380987_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3381126_3381396_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3381397_3383335_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3383331_3383982_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3383981_3384545_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3384528_3384990_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3385039_3385429_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3385484_3386699_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3386722_3387730_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3387887_3390032_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3390031_3391738_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3391718_3392525_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3392580_3392784_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3392933_3393227_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3393317_3393503_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3393730_3393877_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3393876_3394446_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3394716_3395250_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3395254_3395470_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3395546_3395819_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3395859_3396039_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000224729.1|3396173_3396443_-	hypothetical protein	NA	A0A0N7C066	Escherichia_phage	100.0	5.4e-44
>prophage 11
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	3399910	3508027	5457696	holin,head,protease,terminase,integrase,tail,portal,transposase	Escherichia_phage(43.16%)	146	3454573:3454588	3509792:3509807
WP_000738068.1|3399910_3400180_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3400191_3401151_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|3401533_3401686_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_015967940.1|3401700_3401946_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
WP_001204880.1|3401934_3402369_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3402361_3402556_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3402552_3403158_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004024.1|3403157_3403880_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|3403954_3404689_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|3404963_3405146_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3405142_3405670_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3405666_3406113_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3406069_3406306_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3406316_3406532_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3406664_3406943_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|3407013_3407283_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_000131484.1|3407282_3408719_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_000065666.1|3408708_3409608_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|3409600_3409747_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438540.1|3409779_3410076_-	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000067727.1|3410217_3410433_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3410508_3411204_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3411705_3412227_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3412795_3412978_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3412955_3413228_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|3413286_3413538_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|3413720_3414089_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|3414161_3414326_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3414294_3414438_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|3414512_3414809_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|3414814_3415600_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|3415596_3416277_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|3416273_3416456_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548547.1|3416428_3416620_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3416630_3416912_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000774248.1|3417010_3417232_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|3417228_3418002_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|3418153_3418342_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3418343_3418559_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3418560_3418779_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3418780_3419068_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3420043_3420343_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3420428_3420713_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3420765_3422076_+|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3422072_3422651_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3422671_3422899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3422936_3424178_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3425985_3426906_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3426905_3427211_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3427364_3427964_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3427960_3430507_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3430506_3431679_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3431808_3432501_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3432473_3433502_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054754.1|3433584_3436329_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_000818441.1|3436400_3437474_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3437522_3437657_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3437684_3437915_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3437889_3438078_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3438088_3438301_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3438586_3438799_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3439240_3439546_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3439652_3440297_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3440293_3441040_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3441039_3443136_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3443181_3444321_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3444308_3444755_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3444774_3446955_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3447074_3448379_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3448458_3448551_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_032253024.1|3448563_3449700_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3449711_3451256_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3451389_3452247_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3452243_3452642_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3452638_3453226_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3453222_3453930_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3453948_3455742_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3454573:3454588	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3455738_3456857_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3457474_3457657_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|3459130_3459400_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3459401_3460715_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3460779_3461379_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3461446_3464920_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3465053_3465581_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_001303882.1|3465611_3465818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546863.1|3465771_3466404_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3466349_3467093_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3467103_3467802_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3467801_3468131_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082449.1|3468127_3470707_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000533402.1|3470687_3471101_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3471127_3471559_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3471572_3472313_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3472294_3472561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3472618_3472966_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3473002_3474508_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3474497_3476090_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3476086_3476293_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3476276_3478205_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|3478176_3478419_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3478468_3480007_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3480056_3480404_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3480400_3480781_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3480856_3481132_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3481882_3482089_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3482051_3482396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3482344_3482617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3482549_3482744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3482776_3483310_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3483530_3483644_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3483865_3484051_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3484578_3484893_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3486249_3488100_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3488217_3488421_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3488867_3489581_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3489675_3489915_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3490201_3491020_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3491171_3491543_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3491532_3491904_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3491916_3492966_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3492967_3493246_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3493413_3493626_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3493670_3493808_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|3493970_3494162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|3494173_3494947_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3495298_3495712_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3495727_3496498_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3496519_3497266_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3497272_3498364_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3498442_3498898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3499104_3499530_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3499513_3499786_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3499894_3500296_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3500323_3500515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3500514_3500802_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3500803_3501022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3501079_3501235_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3501376_3501766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3501952_3502138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3502139_3502445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3502711_3502900_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3502896_3503088_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3503181_3505653_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3505720_3505963_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3505940_3506960_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3507367_3508027_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3509792:3509807	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	3738971	3777068	5457696	holin,protease,terminase,integrase,tail,portal,lysis	Enterobacteria_phage(51.16%)	53	3738556:3738570	3777142:3777156
3738556:3738570	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3738971_3739670_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|3739722_3739926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951026.1|3739900_3740782_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3740951_3741113_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3741609_3742629_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3742662_3743643_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3743819_3744089_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3744090_3745407_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3745466_3746066_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3746136_3749550_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3749610_3750219_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3750155_3750899_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3750904_3751603_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3751612_3751942_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3751941_3755007_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3754978_3755308_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3755316_3755703_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3755763_3756507_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3756517_3756919_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3756915_3757494_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3757505_3757781_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3757773_3758097_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3758183_3760211_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3760155_3760491_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3760612_3761737_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3761664_3761877_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3761873_3763976_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3763975_3764467_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3764456_3764735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3765141_3765294_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3765281_3765749_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3765745_3766243_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3766242_3766458_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3766600_3766999_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3767079_3767238_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3767323_3768067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3768250_3768940_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3768954_3769077_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3769414_3770374_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3770585_3771251_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3771247_3771868_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3771860_3772031_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3772027_3772210_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3772907_3773588_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3773584_3773767_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3773739_3773931_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3773941_3774223_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3774321_3774543_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3774753_3775356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3775480_3775666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3775598_3775766_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3775805_3776024_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3776186_3777068_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3777142:3777156	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	4320192	4371798	5457696	integrase,tail,transposase	Enterobacteria_phage(34.78%)	58	4313349:4313365	4369244:4369260
4313349:4313365	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000998048.1|4320192_4321731_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4321780_4322128_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4322124_4322505_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4322768_4323032_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4323031_4323172_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4323241_4323433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303810.1|4323494_4323785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4324257_4324800_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4324874_4325462_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_138553726.1|4325519_4326188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131063.1|4326213_4328739_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265657.1|4328728_4330372_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4330340_4331051_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|4331363_4331693_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4331940_4332555_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4332972_4333662_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4333658_4334615_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667043.1|4334611_4336810_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4336819_4337776_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|4337954_4339082_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4339223_4340282_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4340527_4341430_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4342132_4342411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4342577_4343300_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4343398_4344298_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4344973_4345930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4346062_4348396_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4348409_4348733_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4348732_4348954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4348950_4349508_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4349504_4349765_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4350698_4351451_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4351447_4351999_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4352004_4352277_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|4352424_4352628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|4352686_4353253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4353252_4353843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4353873_4354506_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4354498_4354957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4354956_4355574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4355546_4355963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4355966_4357148_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4358110_4358854_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4359677_4360451_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4360508_4361063_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4361092_4361503_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4361523_4361967_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4361938_4362532_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4362531_4363326_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4363325_4363637_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4364588_4364882_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4365000_4365201_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4365301_4366015_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4366142_4366532_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4366771_4367017_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4368086_4369340_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4369244:4369260	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|4369351_4370455_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4370742_4371798_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 14
NZ_CP040570	Escherichia coli O157:H7 strain ECP17-1298 chromosome, complete genome	5457696	4390584	4413301	5457696	plate,transposase	uncultured_Caudovirales_phage(66.67%)	19	NA	NA
WP_000027427.1|4390584_4391757_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4391837_4392023_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4391937_4392201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4392402_4394163_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4394165_4395302_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|4395409_4395700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001451053.1|4396047_4396611_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4396679_4400894_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103107.1|4400969_4403111_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_001142958.1|4403320_4403839_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4404535_4405036_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4405070_4405295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4405345_4406737_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4406827_4407241_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4407244_4409095_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4409058_4410141_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4410165_4411446_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4411442_4411967_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4411969_4413301_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP040571	Escherichia coli O157:H7 strain ECP17-1298 plasmid pCFSAN059541, complete sequence	92763	24025	74003	92763	transposase,integrase,protease	Macacine_betaherpesvirus(45.45%)	46	52529:52543	75776:75790
WP_001034100.1|24025_27928_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|29325_29505_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|30106_30928_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|30927_32034_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|32123_33845_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|33918_34917_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001302198.1|35531_35747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|35809_38506_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|38592_39468_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|39525_41436_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|41435_42941_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|42942_44166_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|44196_44631_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|44627_45182_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|45196_45544_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|45540_46140_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|46136_47114_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|47152_48325_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|48311_48824_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|48881_49715_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|49806_50208_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000520917.1|52122_52614_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
52529:52543	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|52615_55612_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|55661_57782_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|57785_59225_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|59291_59486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|59515_59800_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|59800_59998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|59968_60199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|60319_61060_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|61344_62322_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|62634_62823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|62729_62930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|62926_63547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|63543_64227_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|64685_64904_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|64905_65211_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|65211_66018_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|66694_66775_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|66740_67954_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071525396.1|67915_68254_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|68841_70008_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|70007_70979_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|71363_71636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336590.1|71719_72016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138832.1|72278_74003_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
75776:75790	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
