The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	1220106	1295648	4857789	holin,tRNA,head,lysis,terminase,integrase,protease,capsid,transposase,tail	Salmonella_phage(44.07%)	91	1212187:1212203	1301495:1301511
1212187:1212203	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1220106_1221144_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1221259_1221949_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1222267_1222651_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023139269.1|1222712_1223300_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1223402_1224302_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1224319_1225654_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1225784_1226522_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1226506_1228129_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1228213_1228393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1228392_1228557_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1228553_1229129_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1229160_1229811_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1229810_1230767_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1230763_1231243_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1231740_1232970_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1232947_1233232_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1233272_1233512_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1233554_1234712_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1234674_1237602_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1237728_1238079_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1238100_1238259_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1238657_1239062_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1239191_1239428_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1239393_1239768_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1239852_1240836_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1240838_1241588_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1241598_1241946_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1241942_1242467_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1242466_1242940_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_071530012.1|1243331_1243613_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	92.5	1.4e-47
WP_001217666.1|1243804_1244044_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001574100.1|1244033_1244339_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929803.1|1244378_1244981_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001241017.1|1244980_1245187_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_001096550.1|1245189_1245801_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1245797_1245938_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1245934_1246612_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1246608_1246794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1246884_1247448_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1247954_1248143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1248357_1249044_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1249319_1249649_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1249632_1250085_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1250102_1250555_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1250790_1251192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1251478_1252024_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1251995_1253927_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1253910_1254114_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_001189503.1|1255866_1257363_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1257375_1257723_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1257777_1258806_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1258863_1259223_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1259233_1259617_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1259644_1260223_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1260271_1261402_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_080075580.1|1261510_1261912_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	3.1e-51
WP_077248250.1|1261919_1262666_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1262716_1263112_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1263108_1263447_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1263418_1266514_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1266516_1266846_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1266855_1267554_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1267560_1268298_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1268195_1268843_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_080109167.1|1268904_1272267_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1272305_1272548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075146502.1|1272601_1274974_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.4	1.1e-90
WP_000593433.1|1274970_1275795_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1275784_1276363_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1276459_1276687_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1276793_1277006_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1277068_1277134_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1277713_1277878_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1278590_1278728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1279170_1280664_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1281068_1282868_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1282884_1283859_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1284132_1284813_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1284809_1285715_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1285726_1286455_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1286466_1287198_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1287197_1287578_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1287689_1287950_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1287987_1288914_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1289029_1290226_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1290247_1291165_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1291203_1292052_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1292167_1293061_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1293071_1294433_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1294436_1295072_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1295096_1295648_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1301495:1301511	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	1648679	1678260	4857789	holin,tail,protease	Salmonella_phage(41.67%)	31	NA	NA
WP_000781589.1|1648679_1649174_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1649587_1650079_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1650068_1650332_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1650328_1652815_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1652821_1653517_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1653503_1654373_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1654488_1654938_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1654947_1655550_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1655570_1656188_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1656184_1656844_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1656895_1657633_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1657629_1657842_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1657838_1658318_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1658314_1660246_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1660242_1660800_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_023198513.1|1660796_1661840_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1661883_1662531_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1663260_1663824_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1664015_1664219_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1664521_1665313_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1665609_1665813_+|tail	tail protein	tail	NA	NA	NA	NA
WP_031602376.1|1668675_1669665_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.7e-188
WP_010989045.1|1669679_1670048_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1670076_1671408_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1671704_1672034_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1672626_1673868_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1673870_1674398_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1674775_1675219_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1675272_1677102_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1677438_1677729_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1677756_1678260_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	1750311	1759482	4857789	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1750311_1751259_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1751242_1751974_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1751954_1752062_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1752121_1752853_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1753075_1754761_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1754757_1755477_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1755523_1755991_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1756047_1756578_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1756749_1757208_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_075146485.1|1757448_1759482_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	1827790	1838296	4857789		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1827790_1829194_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1829371_1830265_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1830641_1831727_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1831726_1832626_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1832673_1833552_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1833552_1834104_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1834109_1835102_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1835098_1835872_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1835876_1836956_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1836982_1838296_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	1924287	1975050	4857789	portal,holin,head,plate,lysis,terminase,integrase,protease,tail	Salmonella_phage(88.52%)	68	1918865:1918879	1935341:1935355
1918865:1918879	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1924287_1924761_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1925408_1925699_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1926070_1926868_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1927159_1928149_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1928150_1928393_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1928417_1928987_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1928990_1929824_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1929820_1930438_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1930434_1930950_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1930946_1931177_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1931247_1931787_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|1931923_1932751_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|1932808_1933180_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|1933994_1934690_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_071529734.1|1934663_1934849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1934787_1935012_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1935040_1935595_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1935341:1935355	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1935591_1936749_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1936745_1936970_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1936966_1937785_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1937786_1938269_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1938268_1939162_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_023139095.1|1939158_1939548_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	99.2	2.4e-69
WP_075146479.1|1939564_1940425_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	1.4e-162
WP_001202277.1|1940432_1941422_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_000188927.1|1941432_1942056_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|1942188_1942446_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1942375_1942810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1942971_1943316_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1943318_1943933_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1943929_1944415_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1944627_1945047_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1945266_1945569_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1945629_1945980_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1946105_1946600_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_075146477.1|1946596_1948330_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000605609.1|1948341_1948524_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1948523_1949765_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1949742_1950393_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000601353.1|1951673_1951874_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1951876_1952200_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1952196_1952601_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1952572_1953085_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1953081_1953642_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1953645_1953810_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1953799_1955296_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|1955295_1955652_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1955648_1955975_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_075146476.1|1956059_1957991_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863818.1|1958024_1959365_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|1959361_1960420_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|1960419_1960953_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1960957_1961371_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343855.1|1961923_1962445_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|1962447_1963035_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000760554.1|1964583_1965153_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1965437_1966445_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1966656_1966878_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_099112411.1|1966991_1967207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000500831.1|1967508_1967670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1967796_1968216_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1968218_1969487_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1969941_1970154_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1970164_1970353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1970613_1971810_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1972459_1972759_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1972850_1973546_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1973619_1975050_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	2079079	2085888	4857789	integrase,tail	Salmonella_phage(33.33%)	11	2081289:2081311	2091004:2091026
WP_000856224.1|2079079_2079310_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2079447_2079822_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2079822_2080698_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2080714_2081068_+	YebY family protein	NA	NA	NA	NA	NA
2081289:2081311	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2081441_2082296_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2082355_2082850_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2083039_2083270_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2083323_2083857_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2084113_2084281_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2084345_2084534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2085006_2085888_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2091004:2091026	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	2874872	2959608	4857789	portal,holin,tRNA,terminase,lysis,integrase,protease,tail	Salmonella_phage(45.45%)	93	2898966:2898985	2970754:2970773
WP_000938191.1|2874872_2875553_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2876173_2876833_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2876919_2877249_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2877245_2877527_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2877575_2878355_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2878380_2878929_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2879143_2880355_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2880412_2880730_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2880774_2881191_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2881361_2882024_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2882118_2882577_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2882612_2884667_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2884790_2885237_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2885255_2887409_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2887395_2888001_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2888217_2888727_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2889083_2890136_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2890207_2890660_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2890845_2892606_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2892674_2893193_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2893292_2893460_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2893715_2894279_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2894275_2895916_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2895920_2897174_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2897188_2899096_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2898966:2898985	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2899108_2901217_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2901315_2902425_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2902421_2902964_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2903129_2904140_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2904347_2906960_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2907386_2907578_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2907848_2908535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2908886_2909513_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_050951585.1|2910160_2911129_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.4	3.3e-192
WP_000143167.1|2911605_2912187_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_075146435.1|2912186_2914625_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.3	8.3e-91
WP_000178853.1|2914678_2914921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022562288.1|2914959_2918310_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2918381_2919086_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2918983_2919721_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2919730_2920426_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2920515_2921049_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2921165_2921663_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2921761_2922094_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_078049165.1|2922090_2925078_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	3.1e-265
WP_010989009.1|2925157_2925487_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2925483_2925882_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2925927_2926677_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196701.1|2926688_2927090_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	2.6e-42
WP_000453194.1|2927086_2927653_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2927633_2927933_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2927925_2928249_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2928339_2930421_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2930344_2931862_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2931888_2932095_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2932091_2934230_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2934186_2934720_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2934927_2935407_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_077248249.1|2935424_2935877_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	2.7e-80
WP_001574216.1|2935860_2936190_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2936465_2937152_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2937512_2937962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2938097_2938223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2938396_2938714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2938780_2939578_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2939567_2939714_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2939710_2940322_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|2940324_2940531_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2940530_2941133_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2941215_2941437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2941548_2941782_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2942073_2942364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2942441_2942753_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2942749_2943097_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2943107_2943857_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2943859_2944843_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2944927_2945302_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2945267_2945507_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2945626_2946037_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2946086_2946347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2946339_2946498_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344461.1|2946519_2946819_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_076149000.1|2946945_2949831_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.7	0.0e+00
WP_001539618.1|2949793_2950951_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2950993_2951233_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2951273_2951522_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2951566_2952859_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2953053_2954256_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2954333_2955770_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2956014_2957229_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2957315_2957549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|2957545_2958007_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2958207_2959608_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2970754:2970773	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	3023774	3032506	4857789	transposase,protease	Enterobacteria_phage(14.29%)	8	NA	NA
WP_109182773.1|3023774_3025029_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.2e-16
WP_119920232.1|3025044_3025320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|3025492_3025951_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3026142_3028419_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3028449_3028770_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3029093_3029315_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3029444_3031391_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3031387_3032506_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	3640566	3684317	4857789	portal,holin,head,coat,lysis,integrase,protease,tail	Salmonella_phage(41.54%)	66	3631637:3631653	3693532:3693548
3631637:3631653	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_126790267.1|3640566_3640842_+	GtrA family protein	NA	A0A1R3Y5Q2	Salmonella_virus	96.7	1.6e-43
WP_024143049.1|3640913_3642836_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	97.2	0.0e+00
WP_075146406.1|3642871_3644839_-	hypothetical protein	NA	T1SBJ2	Salmonella_phage	96.6	2.9e-304
WP_015975192.1|3645049_3645952_-	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	100.0	8.5e-174
WP_015975191.1|3646020_3646182_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	100.0	1.2e-22
WP_015975190.1|3646272_3646524_+	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	100.0	9.9e-40
WP_015975201.1|3646623_3646803_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	100.0	6.2e-28
WP_000757527.1|3646816_3647182_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_000889769.1|3647212_3647542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058657166.1|3647559_3649389_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	99.5	0.0e+00
WP_015975198.1|3649388_3650804_-	injection protein	NA	A0A192Y834	Salmonella_phage	100.0	6.2e-248
WP_022630934.1|3650814_3651504_-	hypothetical protein	NA	A0A192Y6A3	Salmonella_phage	98.7	6.8e-115
WP_022630933.1|3651506_3651962_-	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	99.3	3.9e-87
WP_022630932.1|3651961_3652600_-|tail	tail protein	tail	A8CGD2	Salmonella_phage	99.5	2.4e-90
WP_001122424.1|3652603_3654022_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_015975196.1|3653981_3654482_-|head	head completion protein	head	A0A192Y830	Salmonella_phage	100.0	3.2e-90
WP_000684729.1|3654465_3654675_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001196937.1|3654713_3656006_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000433852.1|3656005_3656917_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000774649.1|3656930_3659108_-|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	100.0	0.0e+00
WP_022630929.1|3659107_3660607_-	DNA packaging protein	NA	Q76H24	Enterobacteria_phage	99.8	8.2e-307
WP_000729923.1|3660584_3661073_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3661076_3661481_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3661480_3661870_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3661873_3662116_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001028469.1|3662439_3662961_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|3663173_3663623_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|3663640_3664078_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|3664061_3664388_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_022630928.1|3664612_3665131_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_001235452.1|3665456_3666080_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000219138.1|3666076_3666256_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
WP_000149926.1|3666236_3666440_-	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000036317.1|3666436_3666661_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_001129733.1|3666657_3667269_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000950959.1|3667261_3667438_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001531428.1|3667430_3667763_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|3667765_3667942_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|3667908_3668082_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000736921.1|3668078_3668516_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_001248406.1|3668589_3669966_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|3669962_3670778_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|3670770_3670917_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|3670951_3671230_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|3671336_3671522_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3671602_3672253_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_015975212.1|3672606_3672909_+	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	100.0	3.7e-49
WP_001682202.1|3672929_3673508_-	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_022630927.1|3673722_3673923_+	Restriction inhibitor protein ral	NA	A0A1R3Y5S4	Salmonella_virus	97.0	1.1e-30
WP_022630926.1|3673950_3674193_+	hypothetical protein	NA	U5PUY0	Salmonella_phage	58.4	7.8e-18
WP_024144163.1|3674224_3674515_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	73.3	1.1e-31
WP_015995137.1|3674838_3674991_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	100.0	3.2e-25
WP_001749553.1|3674971_3675160_+	DUF5444 family protein	NA	B8K1E1	Salmonella_phage	100.0	1.6e-31
WP_022630923.1|3675289_3675997_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	99.6	2.6e-138
WP_001253478.1|3675996_3676281_+	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_022630922.1|3676327_3676621_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_023167639.1|3676631_3676796_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630920.1|3676792_3677191_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	72.0	3.5e-31
WP_022630919.1|3677187_3677487_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_022630918.1|3677488_3677938_+	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	85.3	2.7e-48
WP_022630917.1|3677937_3678411_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	3.3e-68
WP_022630916.1|3678414_3678810_+	hypothetical protein	NA	C6ZR27	Salmonella_phage	55.3	3.2e-24
WP_022630914.1|3679247_3680411_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	98.2	2.1e-225
WP_000893231.1|3680616_3681867_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3681878_3682982_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3683264_3684317_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3693532:3693548	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 10
NZ_CP040566	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome	4857789	4438025	4485070	4857789	tRNA,plate,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4438025_4439024_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4439111_4440422_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_075146559.1|4440668_4441190_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4441283_4441493_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4441514_4441628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4441624_4442950_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4443128_4443737_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4443845_4444214_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017359.1|4444384_4446805_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4446903_4447776_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4447789_4448287_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4448467_4449385_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4449548_4450907_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4450995_4452105_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4452466_4453657_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4453788_4455333_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4455347_4456238_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4456403_4456814_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4456956_4459053_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_075146558.1|4459052_4459790_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_014343934.1|4459786_4460455_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4460488_4460731_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4461174_4462824_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4463168_4464518_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4464650_4464998_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4465573_4465861_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4465863_4466469_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4466481_4466796_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4466955_4467411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4467407_4467605_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_001741803.1|4467594_4469022_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	1.5e-193
WP_000907494.1|4469021_4469546_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4469597_4469915_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4469874_4470003_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4470099_4472454_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4472453_4473407_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4473406_4473616_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4473603_4474647_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_023139147.1|4474656_4475379_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4475706_4476069_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_023139146.1|4476065_4476995_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.4	2.0e-149
WP_001095011.1|4476994_4478542_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4478705_4479065_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4479055_4480171_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4480163_4480796_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_023139145.1|4480798_4482544_+|tail	phage tail fiber protein H	tail	A0A0M3ULF6	Salmonella_phage	51.7	5.5e-52
WP_001526208.1|4482548_4483154_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4483150_4483606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4483854_4484145_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4484341_4485070_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP040567	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 plasmid pCFSAN059543, complete sequence	105670	0	62214	105670	tail,terminase	Salmonella_phage(94.59%)	80	NA	NA
WP_000262979.1|518_749_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_138656969.1|1342_1951_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	98.5	2.4e-116
WP_138656970.1|2093_2588_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	97.6	6.0e-81
WP_000872126.1|2597_2786_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_000462606.1|2893_3736_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_138656971.1|3844_4417_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	99.5	2.4e-97
WP_138656972.1|4540_6244_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	99.3	0.0e+00
WP_061588897.1|6302_6992_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	97.4	1.2e-122
WP_138656973.1|6988_7309_+	hypothetical protein	NA	J9Q801	Salmonella_phage	78.3	5.3e-38
WP_000766011.1|7311_7683_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
WP_000086990.1|7774_8416_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
WP_061588899.1|8412_8955_+	hypothetical protein	NA	J9Q748	Salmonella_phage	92.6	9.8e-93
WP_011011105.1|8963_9275_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
WP_050194521.1|9271_9559_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	1.3e-27
WP_061588900.1|9619_9823_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	94.0	6.3e-29
WP_047722265.1|10012_10279_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	4.0e-31
WP_061588905.1|10364_10601_+	hypothetical protein	NA	J9Q7H8	Salmonella_phage	96.2	2.3e-38
WP_072210642.1|10600_10918_+	hypothetical protein	NA	J9Q750	Salmonella_phage	99.0	3.7e-60
WP_138656974.1|10955_11261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100151358.1|12718_12964_-	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	2.0e-37
WP_023180886.1|13106_13322_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	98.6	3.1e-34
WP_000594283.1|13332_13551_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
WP_000559556.1|13647_13962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722183.1|14038_14350_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	90.3	5.7e-45
WP_000218787.1|14478_14871_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
WP_138657014.1|14991_15279_+	ABC transporter	NA	J9Q753	Salmonella_phage	94.6	4.3e-47
WP_138657015.1|15238_15472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009195.1|15484_15967_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
WP_138656975.1|16613_16841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072873.1|16925_17576_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
WP_138656976.1|17898_18207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182009.1|18210_18738_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
WP_000683475.1|18742_19165_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_001291547.1|19224_19503_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_138656977.1|19505_21065_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.2	3.1e-293
WP_011011100.1|21129_21828_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	99.6	1.9e-125
WP_000164561.1|21827_22496_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_006812519.1|22492_23131_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_001113021.1|23123_23378_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_002228789.1|23374_24274_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
WP_000176291.1|24283_24550_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_138656978.1|24745_25387_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
WP_002211787.1|25389_26646_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_138656979.1|26679_28254_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.6	3.7e-302
WP_138656980.1|28276_29173_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	97.0	3.7e-145
WP_040110313.1|29199_30075_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	1.9e-162
WP_001115046.1|30149_31073_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
WP_138656981.1|31116_31551_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	98.6	1.8e-73
WP_047722196.1|31550_32384_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	1.3e-152
WP_001027662.1|32481_32826_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000523626.1|32816_33290_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_000469441.1|33291_33675_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_006812510.1|33749_34496_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
WP_000163862.1|34555_34873_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002228782.1|34953_35223_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
WP_060570072.1|35230_39814_+	tape measure protein	NA	J9Q712	Salmonella_phage	92.1	0.0e+00
WP_000440566.1|39855_40191_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_072075016.1|40247_40979_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
WP_052930815.1|40971_41769_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	96.2	5.4e-156
WP_001293197.1|41756_42344_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
WP_138656982.1|42358_46747_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	86.7	0.0e+00
WP_138657016.1|47137_49738_+|tail	tail fiber domain-containing protein	tail	A0A2H4P6K4	Salmonella_phage	50.8	1.3e-171
WP_000064174.1|49851_50175_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
WP_006812500.1|50188_50881_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
WP_138656983.1|50949_51294_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	82.1	1.0e-26
WP_138656984.1|51344_51896_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	1.0e-28
WP_023180946.1|52226_52892_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	1.0e-112
WP_050194559.1|52891_53251_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
WP_138656985.1|53304_55014_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	25.1	1.3e-13
WP_138656986.1|55198_55924_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	97.9	9.3e-139
WP_011011095.1|55984_57325_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
WP_138656987.1|57386_58598_+	DNA primase	NA	J9Q720	Salmonella_phage	97.0	1.7e-214
WP_138656988.1|58678_59473_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	97.0	1.3e-141
WP_138656989.1|59521_59863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138656990.1|59773_60031_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	2.6e-35
WP_138656991.1|60065_61388_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	2.1e-258
WP_023180936.1|61387_61564_+	hypothetical protein	NA	J9Q729	Salmonella_phage	98.3	3.1e-24
WP_011011092.1|61553_61760_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
WP_138656992.1|61759_61912_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
WP_000067984.1|61908_62214_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
NZ_CP040567	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 plasmid pCFSAN059543, complete sequence	105670	66873	105206	105670	integrase	Salmonella_phage(90.24%)	46	62784:62799	74886:74901
62784:62799	attL	ATGATTCCATACATCC	NA	NA	NA	NA
WP_138656994.1|66873_67077_+	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	2.0e-06
WP_058672023.1|67092_67473_+	hypothetical protein	NA	Q716B1	Shigella_phage	64.8	1.4e-37
WP_138656995.1|67472_67718_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	45.5	3.2e-11
WP_061588876.1|67873_68419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138656996.1|68686_69793_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	1.6e-25
WP_000224608.1|69784_70171_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004110118.1|70435_70648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138656997.1|70757_73124_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.2	0.0e+00
WP_060453979.1|73220_74456_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.5	1.3e-238
WP_002233108.1|74458_74662_+	hypothetical protein	NA	J9Q6I7	Salmonella_phage	98.5	8.0e-32
WP_138656998.1|74636_78155_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
74886:74901	attR	GGATGTATGGAATCAT	NA	NA	NA	NA
WP_138656999.1|78151_78595_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	5.0e-71
WP_138657000.1|78632_79607_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_004110100.1|79741_80173_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	1.2e-72
WP_138657001.1|80292_81321_+	regulator	NA	J9Q7Z3	Salmonella_phage	99.7	4.8e-165
WP_022649902.1|81381_82326_+	hypothetical protein	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
WP_000920226.1|82325_82592_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_001051805.1|82594_83671_+	recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
WP_138657002.1|83762_83963_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	92.4	2.1e-24
WP_004110049.1|83966_84797_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_000801005.1|84959_85331_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
WP_004110040.1|85314_85725_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
WP_032666376.1|85793_86069_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	1.2e-46
WP_004110036.1|86109_86289_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
WP_138657003.1|86285_86621_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	98.2	3.5e-56
WP_006812558.1|86620_86833_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_138657004.1|86863_87094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138657005.1|87441_88497_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	8.6e-186
WP_138657006.1|89241_89886_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	3.1e-122
WP_138657007.1|89961_90456_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	2.3e-88
WP_138657008.1|90487_90988_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	83.8	3.2e-74
WP_138657009.1|91216_92302_+	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.9	3.5e-206
WP_000107766.1|92298_92535_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
WP_138657010.1|92531_94448_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.4	0.0e+00
WP_006812552.1|94437_95184_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
WP_138657011.1|95196_95766_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
WP_138657012.1|95843_98159_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.5	0.0e+00
WP_011011111.1|98266_99409_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
WP_057102246.1|99491_100361_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	99.0	2.1e-161
WP_138657013.1|100537_101653_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.4	3.4e-217
WP_006812548.1|101654_102068_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
WP_000781812.1|102064_102541_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
WP_000386471.1|102540_103185_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_004109992.1|103248_103668_+	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000208226.1|103677_104235_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_072078833.1|104279_105206_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	93.6	4.9e-108
