The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040593	Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM chromosome, complete genome	5350091	4447640	4458527	5350091		Escherichia_phage(87.5%)	9	NA	NA
WP_004179756.1|4447640_4450748_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|4450802_4452068_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|4452098_4453187_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|4453273_4453534_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|4453831_4454692_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|4454712_4455474_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|4455734_4456637_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|4456648_4457914_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|4457906_4458527_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP040593	Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM chromosome, complete genome	5350091	4858383	4904054	5350091	plate,capsid,tRNA,tail,head,portal,terminase,integrase	Enterobacteria_phage(52.78%)	57	4863607:4863628	4900316:4900337
WP_004179374.1|4858383_4858884_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|4859000_4859447_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|4859430_4860222_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|4860323_4861508_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|4861539_4862232_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|4862377_4862887_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|4862873_4863230_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004179368.1|4863219_4863459_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
4863607:4863628	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|4863723_4863975_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_020324077.1|4864018_4865158_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_020324084.1|4865312_4866485_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_004216461.1|4866484_4867000_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|4867045_4867363_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|4867362_4867521_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_020324072.1|4867507_4870483_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_032408799.1|4870498_4870990_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324073.1|4871234_4872593_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_020324070.1|4872746_4873844_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324108.1|4873843_4874056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806131.1|4874052_4877079_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324110.1|4877068_4877992_-|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020324083.1|4877993_4878344_-	lysozyme	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_009486481.1|4878340_4878928_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324118.1|4878924_4879560_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_020324102.1|4879556_4880024_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_124046751.1|4880024_4880288_-	peptidase	NA	B6SD31	Bacteriophage	34.5	3.7e-05
WP_020324086.1|4880205_4880535_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020324098.1|4880546_4881092_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_020324103.1|4881088_4881373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|4881363_4881564_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324071.1|4881563_4882079_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_020324091.1|4882183_4883050_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324085.1|4883099_4884134_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324109.1|4884144_4884984_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324092.1|4885140_4886868_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_044816202.1|4886861_4887923_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324107.1|4888399_4889152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324074.1|4890073_4891081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324106.1|4891073_4893020_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324090.1|4893277_4895425_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324116.1|4895462_4896398_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_004131528.1|4896394_4896622_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
WP_032408797.1|4896630_4897197_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324115.1|4897193_4897418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|4897495_4897759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324119.1|4897774_4898152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|4898167_4898386_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|4898406_4898685_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|4898805_4899105_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|4899220_4900204_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004176549.1|4900468_4901482_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
4900316:4900337	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|4901539_4901641_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|4901640_4901715_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|4901832_4901958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|4902017_4902281_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_020324076.1|4902411_4903050_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_008807690.1|4903139_4904054_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 3
NZ_CP040593	Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM chromosome, complete genome	5350091	5185601	5195064	5350091	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_020323882.1|5185601_5187323_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
WP_002898014.1|5187367_5188069_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|5188422_5188641_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|5188760_5191040_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|5191070_5191388_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|5191713_5191935_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|5192011_5193952_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|5193948_5195064_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP040595	Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence	277162	150915	208116	277162	integrase,transposase	Escherichia_phage(14.29%)	43	173266:173283	184144:184161
WP_138663954.1|150915_151599_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.8e-131
WP_000429836.1|152869_153304_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|153382_154387_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004152084.1|154914_156315_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|156311_156992_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004213583.1|157046_157976_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|157980_158361_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_011251290.1|158400_159297_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004213580.1|159296_161114_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|161347_161797_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|162085_162823_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|162856_163054_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|163094_165542_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|165668_166109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|166195_169342_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004213578.1|170757_171120_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213577.1|171148_172534_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
173266:173283	attL	CGGCTTTGTTGAATAAAT	NA	NA	NA	NA
WP_138663955.1|173343_174267_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.5e-165
WP_116430747.1|174461_175937_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_023302802.1|176187_176619_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004213569.1|176762_177113_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302803.1|177499_178408_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_116430748.1|179044_180019_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_077250520.1|180951_181764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213560.1|181760_182540_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|182684_183614_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|183926_184085_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_004902355.1|185184_186876_-	hypothetical protein	NA	NA	NA	NA	NA
184144:184161	attR	CGGCTTTGTTGAATAAAT	NA	NA	NA	NA
WP_011251294.1|187064_187310_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_011251296.1|187833_188700_+	ParA family protein	NA	NA	NA	NA	NA
WP_004902347.1|188699_189731_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_004902343.1|189730_190168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004214667.1|192514_193297_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004211835.1|196047_196584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004211839.1|198903_199914_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_073558148.1|199943_200225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071591903.1|200439_200688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004211841.1|200643_201810_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004902307.1|204030_204213_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004215130.1|204409_204850_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004189161.1|204846_205197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|205227_206820_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004213807.1|207147_208116_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
>prophage 1
NZ_CP040598	Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence	106597	70183	97928	106597	transposase,integrase	Escherichia_phage(25.0%)	21	74775:74790	103128:103143
WP_138663972.1|70183_70879_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.6	1.7e-126
WP_016479955.1|70919_73502_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	1.6e-23
74775:74790	attL	CCCGCCGGCGCGCAGC	NA	NA	NA	NA
WP_000493378.1|75128_75479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|75529_76273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099004434.1|76269_77046_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.3e-50
WP_016479957.1|77244_78567_-	GntP family transporter	NA	NA	NA	NA	NA
WP_089046468.1|79503_80624_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.0e-51
WP_022652311.1|82364_83354_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_022652312.1|84209_84479_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_016479963.1|84482_85013_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087728544.1|85144_86161_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_004201176.1|87811_89452_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|89507_89798_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|89991_90321_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|90325_91357_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|91367_92006_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|92010_92376_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|92379_93192_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_071534640.1|94739_94934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003149906.1|94894_96424_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099184378.1|97163_97928_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
103128:103143	attR	GCTGCGCGCCGGCGGG	NA	NA	NA	NA
>prophage 1
NZ_CP040597	Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid unnamed3, complete sequence	111583	937	82306	111583	integrase,tail,portal,terminase	Salmonella_phage(87.67%)	87	9679:9695	46137:46153
WP_032423053.1|937_2035_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
WP_014342074.1|2485_2698_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_039817757.1|2697_3033_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	3.6e-37
WP_039817759.1|3029_3209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032443568.1|3742_4819_-	recombinase	NA	J9Q736	Salmonella_phage	96.1	8.5e-197
WP_019704549.1|4821_5088_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_048331505.1|5087_6032_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.4e-171
WP_105166217.1|6092_7100_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.0	4.6e-144
WP_032440517.1|7219_7651_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
WP_040120270.1|7806_8106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125285859.1|8116_8536_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
WP_138663957.1|8736_9180_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	2.6e-59
WP_077255321.1|9176_10346_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	93.1	6.8e-208
9679:9695	attL	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_077256226.1|10367_11069_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	4.9e-20
WP_074171157.1|11065_13429_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	86.9	0.0e+00
WP_071556245.1|13403_13607_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
WP_087653291.1|13609_14842_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.1	3.7e-212
WP_138663958.1|14938_17218_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.1	1.9e-246
WP_014342091.1|17819_18200_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_040120267.1|18194_19295_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
WP_052951219.1|19644_20004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070611330.1|20068_20479_-	toxin YafO	NA	NA	NA	NA	NA
WP_135696480.1|20488_21106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440523.1|21200_21446_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
WP_135696483.1|21442_21829_-	hypothetical protein	NA	Q716B1	Shigella_phage	72.0	6.4e-46
WP_138663959.1|21838_22612_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.8	1.4e-89
WP_138663960.1|22852_24442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704538.1|25737_26154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342103.1|26301_26517_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	77.1	3.2e-23
WP_019704537.1|26500_26677_-	hypothetical protein	NA	J9Q729	Salmonella_phage	74.5	1.2e-15
WP_064146292.1|26676_27999_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	85.5	7.4e-227
WP_052951221.1|27998_28466_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.3	2.2e-48
WP_064146294.1|28545_29334_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	3.4e-70
WP_138663961.1|29629_30796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064146297.1|30835_31954_-	hypothetical protein	NA	J9Q720	Salmonella_phage	91.6	1.1e-202
WP_032440528.1|32107_33448_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_138663962.1|33512_34238_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.6e-127
WP_021313114.1|34431_35190_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.0	1.6e-146
WP_019704530.1|35235_35598_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_032440479.1|35597_36263_-	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_021313116.1|36419_37208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052115713.1|37208_37550_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	41.8	2.6e-14
WP_048268827.1|37881_38073_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	66.7	2.3e-17
WP_040120258.1|38023_38275_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	71.1	2.9e-23
WP_040120257.1|38277_38970_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	88.7	2.7e-119
WP_004109805.1|38983_39307_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_138663963.1|39397_40843_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	8.0e-41
WP_138663964.1|40895_53066_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.8	2.8e-30
46137:46153	attR	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_021313122.1|53082_53694_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	4.5e-78
WP_004109817.1|53681_54479_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|54471_55170_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109823.1|55256_55592_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_117044599.1|55635_60165_-	tape measure protein	NA	J9Q712	Salmonella_phage	68.9	0.0e+00
WP_004109830.1|60172_60406_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_004109835.1|60522_60840_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|60901_61648_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_047066294.1|61715_62108_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	2.0e-47
WP_021313126.1|62109_62583_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_021313127.1|62573_62918_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	2.2e-53
WP_023279433.1|63847_64282_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_060528003.1|64329_64758_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.0e-28
WP_004109857.1|64836_65715_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279435.1|65741_66641_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_117044600.1|66663_68253_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.5	6.7e-275
WP_004109863.1|68270_69527_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|69529_70171_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|70346_70613_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_026005938.1|70622_71522_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
WP_138663965.1|71518_71773_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	1.0e-39
WP_019704584.1|71765_72404_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_014342142.1|72400_73069_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_021313132.1|73068_73749_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
WP_032423021.1|73832_75392_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.5e-279
WP_064142034.1|75394_75673_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	70.3	4.8e-27
WP_135723320.1|75734_76274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124737163.1|76420_77020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060577894.1|77044_77401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060527995.1|77450_77981_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.6	1.4e-56
WP_060527994.1|78296_78947_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.2	3.2e-106
WP_004109904.1|78997_79201_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_021313140.1|79791_80274_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
WP_138663969.1|80286_80484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313141.1|80479_80761_-	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	2.4e-42
WP_113991609.1|80887_81295_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.8	9.5e-24
WP_029463947.1|81414_81726_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	8.8e-30
WP_032440496.1|81862_82075_-	hypothetical protein	NA	J9Q804	Salmonella_phage	75.7	3.4e-25
WP_019704577.1|82087_82306_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
>prophage 2
NZ_CP040597	Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid unnamed3, complete sequence	111583	85419	111338	111583		Salmonella_phage(88.89%)	30	NA	NA
WP_064142030.1|85419_85737_-	hypothetical protein	NA	J9Q750	Salmonella_phage	72.4	1.3e-41
WP_032439724.1|86097_87177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050484891.1|87215_87425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439722.1|87465_87729_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	4.8e-29
WP_110212679.1|87880_88582_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	70.2	4.7e-79
WP_064142028.1|88670_90356_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	90.9	0.0e+00
WP_021313149.1|90484_91063_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.0e-55
WP_014342167.1|91190_91346_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|91345_91771_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_099752032.1|91873_92062_-	hypothetical protein	NA	J9Q800	Salmonella_phage	54.2	2.0e-08
WP_113991608.1|92058_92337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704565.1|92768_93356_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_032423059.1|93934_94162_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.6e-31
WP_065811697.1|94359_94953_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	3.4e-99
WP_069346264.1|95137_95971_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.7	6.6e-64
WP_014342174.1|96096_96654_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279504.1|96663_97083_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_138663967.1|97146_97791_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	76.6	1.8e-93
WP_019704561.1|97790_98267_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	1.9e-71
WP_019704560.1|98263_98677_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
WP_014342179.1|98678_99782_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_138663968.1|99975_100851_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.4	2.9e-139
WP_014342181.1|100928_102071_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_014342182.1|102201_104505_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_040203999.1|104580_105150_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.4e-94
WP_032734162.1|105159_105906_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	1.6e-77
WP_019704556.1|105895_107812_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
WP_072201193.1|107808_108042_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_014342188.1|108041_109127_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_019704555.1|109778_111338_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
