The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	14593	23549	4315604		Geobacillus_phage(100.0%)	7	NA	NA
WP_053432349.1|14593_16123_+	hypothetical protein	NA	W8EBC4	Geobacillus_phage	43.8	9.7e-21
WP_053432348.1|16123_16876_+	hypothetical protein	NA	W8EK66	Geobacillus_phage	45.2	1.5e-62
WP_010896198.1|17012_18506_+	hypothetical protein	NA	W8EEW0	Geobacillus_phage	52.1	1.7e-142
WP_010896199.1|18518_18704_+	hypothetical protein	NA	W8ECV6	Geobacillus_phage	51.9	3.9e-09
WP_053432394.1|18708_19557_+	hypothetical protein	NA	W8EBC9	Geobacillus_phage	40.7	5.7e-55
WP_053432347.1|19553_22418_+	glycoside hydrolase	NA	W8EK73	Geobacillus_phage	40.8	2.8e-207
WP_053432346.1|22475_23549_+	hypothetical protein	NA	W8EIX3	Geobacillus_phage	31.3	7.0e-34
>prophage 2
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	313330	368998	4315604	bacteriocin,transposase	Planktothrix_phage(28.57%)	44	NA	NA
WP_053432107.1|313330_315556_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_053432108.1|315559_316201_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	7.4e-31
WP_053432109.1|316344_316725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083445640.1|316823_317621_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_053432110.1|318106_319180_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010896467.1|319538_320318_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	5.6e-33
WP_053432111.1|320307_322476_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_083445641.1|322510_323188_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053432112.1|323184_324225_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_053432236.1|324384_324624_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
WP_053432113.1|324620_325526_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	7.0e-27
WP_053432114.1|325522_326305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053432115.1|326740_327229_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053432116.1|327319_328564_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.0	3.4e-32
WP_053432117.1|328961_330218_+	MFS transporter	NA	NA	NA	NA	NA
WP_010896475.1|330441_330945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010896476.1|330963_331551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053432237.1|331957_333850_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_010896478.1|333977_334811_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_083445642.1|335245_336166_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041820120.1|336669_337779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010896484.1|338017_338572_+	nitroreductase	NA	NA	NA	NA	NA
WP_010896485.1|338624_338990_-	VOC family protein	NA	NA	NA	NA	NA
WP_053432119.1|339243_340098_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010896487.1|340179_340611_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_138091069.1|340749_340953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053432120.1|340983_341529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138090138.1|341591_342608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090140.1|342672_343692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053432123.1|343757_344777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053432124.1|344846_345683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090142.1|345924_346062_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_053432125.1|346939_347878_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_053432126.1|347904_348477_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053432127.1|348804_349323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134228893.1|352722_353833_+|transposase	IS3-like element IS655 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	62.6	2.2e-91
WP_138090144.1|355812_357030_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_010896504.1|357216_357774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090146.1|358591_359164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138091072.1|359659_361297_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.8	9.5e-91
WP_138090148.1|361698_362448_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_138090150.1|365019_365865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138090152.1|365864_367889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138090154.1|367954_368998_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	29.2	7.1e-31
>prophage 3
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	711001	720813	4315604		Synechococcus_phage(50.0%)	9	NA	NA
WP_053432406.1|711001_712303_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.9	6.5e-18
WP_010896802.1|712360_713074_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	39.7	8.5e-44
WP_010896803.1|713103_713358_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	2.1e-05
WP_010896804.1|713354_714038_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_053432407.1|714021_716253_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.3	8.8e-172
WP_010896806.1|716228_717650_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	1.9e-50
WP_010896807.1|717662_718700_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.8	7.9e-67
WP_053432408.1|718696_719263_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	9.7e-27
WP_053432409.1|719277_720813_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.0	7.3e-77
>prophage 4
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	1044238	1057897	4315604	integrase,holin	Bacillus_phage(72.73%)	13	1053587:1053631	1065921:1065965
WP_053431888.1|1044238_1045993_+	hypothetical protein	NA	D2XR26	Bacillus_phage	36.9	1.3e-13
WP_053431887.1|1046008_1046713_+	hypothetical protein	NA	Q5YA60	Bacillus_phage	45.7	6.0e-50
WP_053431886.1|1046734_1050715_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	40.8	1.7e-229
WP_053431885.1|1050711_1051122_+	hypothetical protein	NA	Q5YA56	Bacillus_phage	60.1	1.1e-32
WP_053431884.1|1051308_1051686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010897137.1|1051731_1052139_+	hypothetical protein	NA	A0A0N7GFE6	Paenibacillus_phage	48.1	2.9e-25
WP_083445602.1|1052135_1053152_+	hypothetical protein	NA	A0A0N6W8I1	Bacillus_phage	49.8	2.4e-52
WP_053431883.1|1053171_1053399_+|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	50.0	4.2e-13
1053587:1053631	attL	TAACGTGCCGGTGTGGCGGAATTGGCAGACGCGCACGACTCAAAA	NA	NA	NA	NA
WP_083445601.1|1053776_1054748_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	47.2	4.2e-78
WP_053431881.1|1054772_1055072_+	hypothetical protein	NA	A0A142F1Q2	Bacillus_phage	92.9	6.4e-46
WP_053431880.1|1055126_1055537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083445600.1|1055650_1056070_+	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	98.3	1.2e-66
WP_053431878.1|1056937_1057897_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	27.8	4.1e-09
1065921:1065965	attR	TAACGTGCCGGTGTGGCGGAATTGGCAGACGCGCACGACTCAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	1663863	1673165	4315604		Streptococcus_phage(33.33%)	8	NA	NA
WP_053431441.1|1663863_1665114_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.0	1.1e-107
WP_053431440.1|1665110_1666235_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.6	3.7e-70
WP_053431439.1|1666712_1667492_+	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	28.1	2.5e-09
WP_010897672.1|1667424_1667685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053431438.1|1667870_1669718_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	25.8	1.4e-26
WP_083445558.1|1669872_1671408_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.0e-15
WP_053431436.1|1671504_1672242_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_053431435.1|1672301_1673165_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.4	2.1e-60
>prophage 6
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	1710682	1718240	4315604		Staphylococcus_phage(57.14%)	9	NA	NA
WP_010897716.1|1710682_1711438_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.2	1.4e-25
WP_134228992.1|1712084_1713194_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.8	4.4e-63
WP_010897718.1|1713174_1713822_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.7	4.2e-42
WP_010897719.1|1713845_1715060_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.3	7.0e-115
WP_010897720.1|1715097_1715568_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	2.1e-43
WP_053431418.1|1715759_1716107_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053431417.1|1716210_1716747_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_053431416.1|1716895_1717678_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.1	3.3e-09
WP_010897724.1|1717646_1718240_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.1	4.5e-14
>prophage 7
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	3136124	3186373	4315604	protease,coat,tRNA,transposase	Bacillus_phage(28.57%)	49	NA	NA
WP_138090661.1|3136124_3137369_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.0	4.5e-32
WP_010899148.1|3137933_3138251_+	DUF3870 domain-containing protein	NA	NA	NA	NA	NA
WP_010899149.1|3138391_3139558_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_010899150.1|3139572_3140652_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_053430600.1|3140668_3141679_+	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	40.0	2.0e-14
WP_053430599.1|3141729_3142878_-	amidohydrolase	NA	NA	NA	NA	NA
WP_010899153.1|3143005_3143290_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_010899154.1|3143295_3143637_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_010899155.1|3143645_3143954_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_053430598.1|3144296_3144635_-	bacillithiol system redox-active protein YtxJ	NA	NA	NA	NA	NA
WP_041821734.1|3144647_3146129_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_053430597.1|3146334_3147204_-|protease	protease	protease	NA	NA	NA	NA
WP_010899160.1|3147196_3147979_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_053430596.1|3148081_3148678_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_010899162.1|3148881_3149118_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_053430595.1|3149114_3149585_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_053430594.1|3149587_3150097_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_053430593.1|3150093_3151365_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010899166.1|3151398_3151911_-	molybdenum cofactor biosynthesis protein MoaB	NA	NA	NA	NA	NA
WP_053431939.1|3152091_3152589_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_010899168.1|3152677_3153058_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053430592.1|3153130_3153646_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_053430591.1|3153783_3155361_-	glutathione ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138090663.1|3155600_3156747_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.2	2.1e-36
WP_010899171.1|3157081_3157876_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_010899172.1|3157898_3158597_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_053430590.1|3158718_3159243_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_010899174.1|3159239_3160121_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_010899175.1|3160134_3161175_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_053431938.1|3161311_3161995_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_010899177.1|3162117_3162690_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_053430589.1|3162880_3163939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053431937.1|3164058_3164805_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_053430588.1|3164944_3166648_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.5	2.6e-14
WP_053430587.1|3166679_3167972_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_053430586.1|3168306_3170949_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	4.5e-159
WP_010899183.1|3171403_3171589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053430585.1|3171688_3172714_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_010899185.1|3172688_3173558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083445474.1|3173570_3174827_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_010899187.1|3175090_3176380_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_053430583.1|3176393_3177380_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_053430582.1|3177382_3178144_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_053430581.1|3178140_3179076_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_010899191.1|3179111_3179927_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_053430580.1|3179956_3181336_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_053430579.1|3181664_3182249_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_053430578.1|3182245_3184570_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.4	7.5e-182
WP_010899195.1|3184702_3186373_-|protease	ATP-dependent protease LonB	protease	E3T5P9	Cafeteria_roenbergensis_virus	24.9	1.2e-16
>prophage 8
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	3524295	3531713	4315604		Catovirus(33.33%)	9	NA	NA
WP_053430393.1|3524295_3525006_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.3	1.5e-08
WP_138090760.1|3525254_3525512_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_138090763.1|3525493_3525961_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_053430391.1|3526154_3527066_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	35.8	1.2e-45
WP_053430390.1|3527224_3527911_-	glycosyltransferase	NA	A0A2P1ELT8	Moumouvirus	30.3	1.2e-10
WP_053430389.1|3527920_3528820_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_053430388.1|3528803_3529643_-	SDR family oxidoreductase	NA	A0A1V0SIV4	Klosneuvirus	32.4	5.7e-31
WP_053430387.1|3529642_3530629_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	32.4	1.1e-38
WP_053430386.1|3530621_3531713_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	47.5	1.3e-96
>prophage 9
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	3608168	3709160	4315604	portal,coat,integrase,terminase,capsid,transposase,tail	Bacillus_phage(38.18%)	105	3646830:3646848	3687593:3687611
WP_083445450.1|3608168_3608432_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	60.6	2.3e-15
WP_010899600.1|3608477_3609875_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_010899601.1|3609912_3610353_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A1B1PCH2	Mycobacterium_phage	36.1	9.6e-14
WP_053430333.1|3610342_3611563_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.8	1.4e-118
WP_010899603.1|3611562_3612870_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_010899604.1|3612917_3613709_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.7	1.9e-12
WP_010899605.1|3614182_3614371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053430331.1|3614520_3614964_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_134229885.1|3615153_3615276_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_138090782.1|3615259_3615850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090784.1|3615860_3617135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053430330.1|3617165_3617963_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.9	1.6e-14
WP_053430329.1|3618315_3619173_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083445608.1|3619188_3619788_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_053430328.1|3619837_3620854_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	2.1e-27
WP_053430327.1|3621295_3622537_-	MFS transporter	NA	NA	NA	NA	NA
WP_053430326.1|3622679_3622916_-	YusG family protein	NA	NA	NA	NA	NA
WP_138091084.1|3623021_3624659_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.0	8.6e-92
WP_050768992.1|3624835_3625252_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_053430325.1|3625292_3625652_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.3	8.3e-24
WP_010899618.1|3625856_3627641_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_053430324.1|3627657_3628836_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_053430323.1|3628856_3631238_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010899621.1|3631490_3631760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010899622.1|3631774_3632098_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_010899623.1|3632140_3632389_-	YusU family protein	NA	NA	NA	NA	NA
WP_053430322.1|3632505_3632895_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053430321.1|3632872_3633724_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	3.9e-19
WP_134229895.1|3633924_3634080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053430319.1|3634535_3636422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053430318.1|3636561_3636966_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_053430317.1|3637401_3638958_-	flotillin family protein	NA	NA	NA	NA	NA
WP_138090788.1|3639423_3639624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134229558.1|3639600_3640326_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.3	1.4e-30
WP_134230280.1|3640325_3641834_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_053430315.1|3642339_3643377_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_053430314.1|3643373_3644573_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010899635.1|3644569_3645256_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	2.5e-32
WP_053430313.1|3645706_3646594_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3646830:3646848	attL	GATGGAGACGGTGGGAATC	NA	NA	NA	NA
WP_138090791.1|3647053_3647272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138090794.1|3647281_3647527_-	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	55.0	6.3e-15
WP_138090797.1|3648128_3648665_+	DUF4065 domain-containing protein	NA	A7J2B6	Streptococcus_phage	41.4	6.8e-30
WP_138090800.1|3648665_3649742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138090803.1|3649767_3650934_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2SXM5	Bacillus_phage	41.3	8.1e-68
WP_138090806.1|3650933_3651161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090809.1|3651157_3651442_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	51.6	1.1e-18
WP_138090812.1|3651518_3651782_-	hypothetical protein	NA	Q5YA55	Bacillus_phage	40.0	2.1e-08
WP_138090815.1|3651781_3652192_-	hypothetical protein	NA	Q5YA56	Bacillus_phage	53.3	1.1e-27
WP_138090818.1|3652188_3656550_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	43.4	2.2e-291
WP_138090821.1|3656771_3657467_-	hypothetical protein	NA	Q5YA60	Bacillus_phage	56.7	1.7e-68
WP_138090824.1|3657463_3661618_-	tape measure protein	NA	Q5YA61	Bacillus_phage	37.3	4.9e-107
WP_138090827.1|3661618_3662182_-	hypothetical protein	NA	Q5YA62	Bacillus_phage	61.8	4.3e-59
WP_138090830.1|3662191_3662641_-	hypothetical protein	NA	Q5YA63	Bacillus_phage	77.4	1.1e-54
WP_138090833.1|3662752_3663205_-|tail	phage tail protein	tail	Q5YA64	Bacillus_phage	85.1	9.1e-68
WP_138090837.1|3663207_3663606_-|capsid	capsid protein	capsid	Q5YA65	Bacillus_phage	69.5	1.1e-48
WP_138090840.1|3663605_3663932_-|capsid	capsid protein	capsid	Q5YA66	Bacillus_phage	63.0	7.3e-35
WP_138090843.1|3663931_3664273_-|capsid	minor capsid protein	capsid	Q5YA67	Bacillus_phage	76.1	1.8e-47
WP_138090846.1|3664266_3664671_-	hypothetical protein	NA	Q5YA68	Bacillus_phage	71.6	1.2e-50
WP_138090849.1|3664676_3665144_-|tail	phage tail protein	tail	C9E2K1	Enterococcus_phage	68.8	3.2e-44
WP_138090852.1|3665223_3666156_-|capsid	phage capsid protein	capsid	Q5YA70	Bacillus_phage	82.7	8.8e-142
WP_138090854.1|3666174_3666744_-	hypothetical protein	NA	Q5YA71	Bacillus_phage	72.2	6.3e-42
WP_138090857.1|3666858_3668028_-|capsid	capsid protein	capsid	Q5YA73	Bacillus_phage	69.6	1.6e-161
WP_138090859.1|3668032_3669532_-|portal	phage portal protein	portal	Q5YA75	Bacillus_phage	42.3	8.7e-115
WP_138090862.1|3669545_3670844_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	58.8	2.8e-146
WP_138090865.1|3670794_3671610_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	52.5	8.2e-51
WP_138090867.1|3671690_3671912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090870.1|3672016_3672922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090873.1|3673104_3673542_-	transcriptional regulator	NA	A0A0K2CZI2	Paenibacillus_phage	43.6	5.0e-23
WP_138090876.1|3673525_3674935_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	55.2	3.8e-144
WP_138091151.1|3674931_3675249_-	VRR-NUC domain-containing protein	NA	Q6J1P7	Burkholderia_virus	58.3	8.4e-20
WP_138090879.1|3675548_3677954_-	virulence-associated protein E	NA	D2J048	Enterococcus_phage	44.4	2.4e-199
WP_138090882.1|3678293_3679004_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_138090885.1|3679005_3680982_-	DNA polymerase	NA	H7BVQ1	unidentified_phage	57.5	7.4e-215
WP_138090888.1|3680978_3681731_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	50.0	3.1e-36
WP_138090891.1|3681819_3683007_-	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	48.2	9.3e-96
WP_138090895.1|3683003_3683432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090897.1|3683459_3683723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090900.1|3683790_3684168_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	37.7	5.1e-16
WP_138090903.1|3684233_3684488_-	hypothetical protein	NA	A0A0K2CZL9	Paenibacillus_phage	43.0	9.7e-11
WP_138090906.1|3684396_3684699_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_138090910.1|3684747_3684948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138090913.1|3684961_3685144_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	76.7	3.8e-17
WP_138090916.1|3685513_3685942_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	56.0	6.0e-37
WP_138090920.1|3685950_3686352_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	49.3	1.2e-31
WP_138090923.1|3686445_3687531_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	54.7	1.1e-100
WP_041820891.1|3688021_3688486_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	60.4	3.8e-45
3687593:3687611	attR	GATGGAGACGGTGGGAATC	NA	NA	NA	NA
WP_053430312.1|3688605_3690921_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.7	7.4e-89
WP_053430311.1|3690984_3691731_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_010899684.1|3691876_3692107_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_053430310.1|3692296_3693586_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.0	3.8e-167
WP_053430309.1|3693680_3695213_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_053430308.1|3695209_3695965_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_053430307.1|3695986_3697171_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_053430306.1|3697278_3698286_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_053430305.1|3698361_3699381_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_083445449.1|3699535_3699781_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_010899692.1|3699795_3701133_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_010899693.1|3701498_3702083_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.8	1.5e-54
WP_138090473.1|3702391_3703960_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	51.3	6.0e-135
WP_053430304.1|3704081_3704336_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_053430303.1|3704376_3705339_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.0	7.7e-48
WP_053430302.1|3705402_3706371_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	43.9	3.4e-56
WP_053430301.1|3706372_3707260_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	27.1	3.3e-05
WP_053430300.1|3707263_3707743_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_138090576.1|3707942_3709160_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	3820010	3878300	4315604	capsid,transposase	uncultured_Caudovirales_phage(18.18%)	47	NA	NA
WP_053430238.1|3820010_3820910_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	46.0	4.2e-72
WP_053430237.1|3821184_3823488_-	nucleoside triphosphatase	NA	A0A2H4J4H0	uncultured_Caudovirales_phage	33.3	4.3e-113
WP_053430236.1|3824309_3824510_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_053430235.1|3824586_3826146_+	SAM-dependent DNA methyltransferase	NA	A0A2I6PG28	Plesiomonas_phage	25.8	1.9e-16
WP_053430234.1|3826149_3827379_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_053430233.1|3827375_3828266_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_138090948.1|3828267_3831363_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.8	1.2e-70
WP_053430231.1|3831513_3832281_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_053430230.1|3832308_3833016_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_053430229.1|3833038_3833737_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_053430228.1|3833919_3834834_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_138090144.1|3834899_3836117_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_083445447.1|3836322_3837573_-	peptidase	NA	A0A219VHE4	Ochrobactrum_phage	52.2	1.5e-11
WP_010899798.1|3837865_3839065_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_083445607.1|3839048_3839732_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.5e-39
WP_053430226.1|3839724_3840966_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053430225.1|3840999_3841758_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053430224.1|3841894_3842509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083445446.1|3842509_3842788_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_053430222.1|3843429_3844713_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053430221.1|3845186_3846239_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.9	8.2e-19
WP_053430220.1|3846749_3848567_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_053430219.1|3848535_3849309_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_050769048.1|3849387_3850731_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010899807.1|3850805_3851687_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_053430218.1|3851701_3852583_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_053430217.1|3852608_3854195_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_053430216.1|3854223_3854847_+	YesL family protein	NA	NA	NA	NA	NA
WP_053430215.1|3855122_3855629_+	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_053430214.1|3855692_3856181_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053430213.1|3856215_3856782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053430211.1|3857435_3857804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083445445.1|3857904_3858168_-	DMT family transporter	NA	NA	NA	NA	NA
WP_053431912.1|3859922_3860936_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053430209.1|3861442_3862660_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_010899820.1|3862904_3863084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083445606.1|3863578_3864691_-	hypothetical protein	NA	A0A1P8CWN8	Bacillus_phage	29.8	2.7e-44
WP_138090951.1|3865318_3868537_+	pullulanase	NA	NA	NA	NA	NA
WP_138090594.1|3868808_3869853_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	29.5	2.4e-31
WP_053430206.1|3869958_3871194_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.0	9.9e-32
WP_053430205.1|3871190_3871409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053430204.1|3871445_3871886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053430203.1|3871980_3872253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138090954.1|3872333_3873188_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.8	8.1e-17
WP_053430202.1|3873460_3875479_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_083445443.1|3875520_3876453_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_138090957.1|3877082_3878300_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP040441	Bacillus halodurans isolate LB-1 chromosome, complete genome	4315604	4183395	4295077	4315604	integrase,transposase	Paenibacillus_phage(13.33%)	96	4279141:4279155	4299074:4299088
WP_053432296.1|4183395_4184757_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083445671.1|4185175_4185334_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_053432383.1|4185401_4185881_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_138090997.1|4187604_4189077_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	27.1	3.8e-30
WP_138091000.1|4189726_4190152_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_134228893.1|4190395_4191507_-|transposase	IS3-like element IS655 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	62.6	2.2e-91
WP_138091167.1|4191601_4192933_+|transposase	IS1182-like element IS662 family transposase	transposase	NA	NA	NA	NA
WP_138091003.1|4193116_4193713_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_138091006.1|4193709_4195239_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.5	9.8e-98
WP_138091009.1|4195436_4196276_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	68.2	2.8e-78
WP_138091012.1|4196362_4197457_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.0	1.1e-37
WP_010896456.1|4197580_4198936_+|transposase	IS1182-like element IS656 family transposase	transposase	NA	NA	NA	NA
WP_138091015.1|4199163_4202265_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	25.5	1.0e-69
WP_138091017.1|4202285_4203011_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_138091020.1|4203114_4203702_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_138091023.1|4203712_4205062_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_138091026.1|4205227_4205956_+	hypothetical protein	NA	Q9T0Y1	Lactobacillus_phage	36.9	1.1e-33
WP_138090185.1|4206083_4207628_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_010900090.1|4207627_4208392_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.3	2.5e-41
WP_138091029.1|4208473_4209952_+	hypothetical protein	NA	H9YQQ0	environmental_Halophage	31.2	2.4e-40
WP_138091032.1|4210116_4210476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138091036.1|4210537_4211038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138091039.1|4211248_4211539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138091042.1|4211556_4211736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138091045.1|4212164_4212974_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_138091048.1|4213043_4213952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053432384.1|4214223_4214931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138091051.1|4214923_4216594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053432387.1|4216865_4217645_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_083445672.1|4217712_4219020_-	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	44.4	1.4e-76
WP_053432389.1|4219212_4219440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053432390.1|4220078_4221881_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_138091054.1|4222172_4222496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053432392.1|4222807_4223419_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010900121.1|4223718_4224024_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_053432393.1|4224020_4225664_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_083445668.1|4225932_4226100_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053432397.1|4226122_4226566_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_138091072.1|4227544_4229182_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.8	9.5e-91
WP_138091057.1|4229555_4230374_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010896492.1|4230631_4231804_-|transposase	IS256-like element IS654 family transposase	transposase	NA	NA	NA	NA
WP_134228893.1|4231930_4233042_-|transposase	IS3-like element IS655 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	62.6	2.2e-91
WP_138091060.1|4233116_4233734_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_134230280.1|4233998_4235507_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_053430107.1|4236280_4236937_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	8.4e-30
WP_053430106.1|4236981_4237917_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_053430105.1|4238069_4238447_-	VOC family protein	NA	NA	NA	NA	NA
WP_053430104.1|4238499_4239363_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053431904.1|4239452_4239842_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_083445434.1|4240048_4240507_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053430102.1|4240602_4241034_+	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_053430101.1|4241474_4241984_+	DinB family protein	NA	NA	NA	NA	NA
WP_010900108.1|4242443_4243070_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_010900106.1|4243535_4243826_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	60.7	6.5e-11
WP_053430099.1|4245069_4246383_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_138090594.1|4247110_4248155_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	29.5	2.4e-31
WP_053430206.1|4248260_4249496_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.0	9.9e-32
WP_053431903.1|4250181_4250367_-	DUF4083 family protein	NA	NA	NA	NA	NA
WP_041821025.1|4250754_4251093_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053430097.1|4251094_4251433_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_053430096.1|4251706_4252480_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.9	1.7e-26
WP_010900102.1|4252469_4253219_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010900101.1|4253340_4253694_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_053430095.1|4253690_4254032_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_053430094.1|4254656_4254917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053430093.1|4255957_4256221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053432296.1|4256829_4258191_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138091063.1|4258853_4259965_-|transposase	IS3-like element IS655 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	62.3	1.1e-90
WP_134230280.1|4260438_4261947_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_010900134.1|4263264_4263888_-	sortase	NA	NA	NA	NA	NA
WP_083445666.1|4263887_4264880_-	processed acidic surface protein	NA	NA	NA	NA	NA
WP_041821037.1|4265866_4266982_-	aspartate phosphatase	NA	D6R410	Bacillus_phage	22.1	4.6e-20
WP_053432380.1|4267295_4267706_+	DUF5082 family protein	NA	NA	NA	NA	NA
WP_053432379.1|4267705_4267969_+	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_053432378.1|4267983_4269843_+	ribonuclease YeeF family protein	NA	NA	NA	NA	NA
WP_053432377.1|4269861_4270356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083445670.1|4270376_4270943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053432375.1|4271023_4272244_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	29.3	2.0e-13
WP_053432374.1|4272493_4273288_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.7	2.3e-42
WP_053432373.1|4273302_4274091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053432372.1|4274077_4275397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010900150.1|4275393_4277217_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	26.2	2.9e-24
WP_010900151.1|4277216_4277927_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	7.6e-45
WP_138091066.1|4278269_4279037_-|transposase	transposase	transposase	NA	NA	NA	NA
4279141:4279155	attL	AACATTTATTGTAGA	NA	NA	NA	NA
WP_010900152.1|4280062_4281349_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	35.9	2.8e-69
WP_010900153.1|4281548_4282913_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.4	4.9e-125
WP_053432371.1|4283028_4283472_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_053432370.1|4283473_4285438_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_053432369.1|4285449_4286388_-	YybS family protein	NA	NA	NA	NA	NA
WP_010900157.1|4286897_4288280_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_010900158.1|4288397_4288688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053432116.1|4289029_4290274_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.0	3.4e-32
WP_053432368.1|4290375_4292499_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.7	1.1e-243
WP_010900161.1|4292491_4292860_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	52.9	8.0e-30
WP_053432366.1|4293037_4294510_-	potassium/proton antiporter	NA	A0A2H4J428	uncultured_Caudovirales_phage	36.4	3.8e-06
WP_053432365.1|4294528_4295077_-|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	42.3	5.3e-30
4299074:4299088	attR	AACATTTATTGTAGA	NA	NA	NA	NA
