The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	777364	791448	4475055		Mollivirus(20.0%)	12	NA	NA
WP_138224560.1|777364_778657_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	1.2e-43
WP_138227612.1|779204_779690_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.3e-19
WP_138224561.1|779686_780871_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_138224562.1|780867_782163_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	3.1e-20
WP_138224563.1|782212_783112_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.5	2.7e-39
WP_138224564.1|783146_783392_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	37.7	3.7e-07
WP_138224565.1|783397_784087_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_138224566.1|784064_786308_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.9	1.6e-165
WP_138224567.1|786292_787771_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	1.3e-51
WP_138224568.1|788002_789043_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.7	1.7e-69
WP_138224569.1|789042_789660_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.5	8.4e-24
WP_138224570.1|789900_791448_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	1.1e-75
>prophage 2
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	999396	1059524	4475055	transposase	Paenibacillus_phage(28.57%)	48	NA	NA
WP_138224129.1|999396_1000543_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138224704.1|1000891_1001221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224705.1|1001743_1002175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224706.1|1002510_1003248_+	DUF1961 family protein	NA	NA	NA	NA	NA
WP_138224707.1|1003225_1004278_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_138224708.1|1004409_1005924_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	23.9	1.6e-15
WP_138224709.1|1006188_1006698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224710.1|1006654_1007683_+	CehA/McbA family metallohydrolase	NA	NA	NA	NA	NA
WP_138224711.1|1007682_1008408_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_138224712.1|1008451_1009366_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_138224713.1|1009381_1010227_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_138227623.1|1010346_1011756_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_138224714.1|1011782_1012691_+	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_138227624.1|1012893_1013592_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138224715.1|1013570_1014026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224716.1|1014032_1014536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224717.1|1014558_1015590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224718.1|1015693_1020895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224719.1|1020927_1022622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224720.1|1022734_1023406_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_138224721.1|1023499_1024483_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.5	1.3e-05
WP_138224722.1|1024517_1025390_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_138224723.1|1025672_1026698_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_138224724.1|1026819_1028154_-	amino acid permease	NA	NA	NA	NA	NA
WP_138224725.1|1028595_1029318_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_138224726.1|1029319_1030003_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_138224727.1|1029995_1033619_+	urea carboxylase	NA	NA	NA	NA	NA
WP_138224728.1|1033618_1035355_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_138224729.1|1036572_1038285_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	22.9	3.3e-17
WP_138224730.1|1040362_1040557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224731.1|1040789_1041641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224732.1|1041621_1041894_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_138224733.1|1041923_1042214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224734.1|1042176_1046871_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	30.2	1.7e-07
WP_138224735.1|1046884_1047364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224736.1|1047542_1049153_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_138224737.1|1049426_1049627_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138224738.1|1049793_1050570_+	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	29.6	4.6e-19
WP_138224739.1|1050704_1051937_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138227625.1|1052058_1052313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224740.1|1052309_1052786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224600.1|1053235_1054358_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	70.1	8.8e-112
WP_138224741.1|1054410_1054701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224742.1|1055019_1055355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224743.1|1055505_1055754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224744.1|1055789_1056185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224600.1|1056501_1057624_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	70.1	8.8e-112
WP_138224745.1|1059173_1059524_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	1062713	1090767	4475055	transposase	Bacillus_phage(60.0%)	30	NA	NA
WP_138224659.1|1062713_1063934_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	54.0	6.7e-57
WP_138224750.1|1064137_1064335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224751.1|1064389_1064956_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138227626.1|1064975_1065296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138224752.1|1065412_1065634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138227627.1|1065994_1066432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138227628.1|1066829_1067147_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138224753.1|1067571_1067952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224754.1|1068062_1068464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224755.1|1068516_1068657_+	hypothetical protein	NA	O64023	Bacillus_phage	73.3	5.7e-13
WP_138224756.1|1069847_1070390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224757.1|1070541_1070820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224758.1|1070752_1071037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224759.1|1071049_1072057_-	LCP family protein	NA	NA	NA	NA	NA
WP_138224600.1|1072139_1073263_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	70.1	8.8e-112
WP_138224760.1|1073725_1074538_-	DUF3427 domain-containing protein	NA	NA	NA	NA	NA
WP_138224761.1|1074815_1074959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138224762.1|1075295_1075577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224763.1|1075679_1076609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224764.1|1076887_1077301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224736.1|1078223_1079834_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_138224765.1|1079998_1080655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138227629.1|1080738_1081194_+	DNA polymerase III	NA	NA	NA	NA	NA
WP_138224766.1|1081730_1082264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224767.1|1082757_1085643_-	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	28.1	8.2e-29
WP_138224768.1|1085643_1086042_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_138224769.1|1086216_1086468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138224770.1|1086763_1087093_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_138224771.1|1087073_1089515_+	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	27.8	3.8e-35
WP_138227630.1|1090530_1090767_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	1250862	1259348	4475055		Bacillus_phage(50.0%)	8	NA	NA
WP_138227646.1|1250862_1251168_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	44.3	1.2e-18
WP_138224888.1|1251195_1251549_+	DsrE family protein	NA	NA	NA	NA	NA
WP_138224889.1|1251642_1251969_+	thioredoxin family protein	NA	E3PZ79	Roseovarius_sp._217_phage	30.9	7.9e-05
WP_138224890.1|1252435_1253446_+	DMT family transporter	NA	NA	NA	NA	NA
WP_138224891.1|1253616_1254837_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	2.3e-17
WP_138224892.1|1255021_1255507_+	DUF4385 domain-containing protein	NA	E3SIU1	Synechococcus_phage	54.3	3.6e-38
WP_138224893.1|1255741_1257511_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	2.8e-40
WP_138224894.1|1257491_1259348_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.1	3.1e-61
>prophage 5
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	1729185	1735580	4475055	integrase	Paenibacillus_phage(16.67%)	9	1724184:1724197	1735950:1735963
1724184:1724197	attL	GTGGAATCCGGATT	NA	NA	NA	NA
WP_138225327.1|1729185_1729395_+	hypothetical protein	NA	A0A2I7SCF7	Paenibacillus_phage	50.0	7.5e-09
WP_138225328.1|1729526_1730387_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_138225329.1|1730628_1731465_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.5	1.1e-37
WP_138225330.1|1731772_1732717_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	32.4	6.2e-26
WP_138225331.1|1732713_1733463_+	helix-turn-helix domain-containing protein	NA	X5JA05	Clostridium_phage	46.5	2.9e-18
WP_138225332.1|1733542_1734178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225333.1|1734294_1734798_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_138227684.1|1735027_1735249_+	HicB family protein	NA	A0A1L2JY34	Aeribacillus_phage	49.3	5.7e-15
WP_138225334.1|1735232_1735580_-	Bro-N domain-containing protein	NA	K4I1D2	Acidithiobacillus_phage	56.1	2.3e-23
1735950:1735963	attR	AATCCGGATTCCAC	NA	NA	NA	NA
>prophage 6
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	1960834	1966959	4475055		Staphylococcus_phage(57.14%)	7	NA	NA
WP_138225526.1|1960834_1961269_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	40.1	1.2e-16
WP_138225527.1|1961874_1963020_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.0	5.2e-59
WP_138225528.1|1963023_1963692_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	2.5e-37
WP_138225529.1|1963726_1964968_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.4	6.5e-116
WP_138225530.1|1965057_1965525_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.3	8.5e-45
WP_138225531.1|1965593_1966385_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.8	2.2e-08
WP_138227701.1|1966353_1966959_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.0	4.1e-15
>prophage 7
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	2126005	2182786	4475055	coat,integrase,tRNA,head,transposase,terminase,portal,protease,plate,tail,capsid	Bacillus_phage(20.0%)	71	2140494:2140509	2188245:2188260
WP_138225667.1|2126005_2126569_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_138225668.1|2126704_2127955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225669.1|2128012_2130697_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	1.1e-27
WP_138225670.1|2130730_2132719_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.3	1.8e-59
WP_138225671.1|2132736_2133513_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_138225672.1|2133505_2134465_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_138225673.1|2134505_2134745_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_138225674.1|2134895_2137631_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_138225675.1|2137799_2138357_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_138225676.1|2138385_2139045_+	YdcF family protein	NA	NA	NA	NA	NA
WP_138225677.1|2139119_2140091_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	42.0	1.3e-50
WP_138225678.1|2140145_2141432_+	GTPase HflX	NA	NA	NA	NA	NA
2140494:2140509	attL	ATTCTTGATATTTTTG	NA	NA	NA	NA
WP_138225679.1|2141529_2142783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225680.1|2142866_2143277_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138225681.1|2143304_2144633_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_138225682.1|2144699_2145857_-|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	66.9	1.1e-61
WP_138225683.1|2145939_2146362_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	57.2	4.7e-42
WP_138225684.1|2146379_2146790_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	48.2	7.5e-29
WP_138227725.1|2146949_2147213_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138225685.1|2147193_2147457_+	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	59.3	9.1e-28
WP_138225686.1|2147476_2147695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225687.1|2147691_2147889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225688.1|2147885_2148116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225689.1|2148200_2149274_+	DUF4373 domain-containing protein	NA	R9TLQ3	Paenibacillus_phage	67.1	1.6e-62
WP_138225690.1|2149270_2149654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225691.1|2149638_2149980_+	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	40.5	1.4e-15
WP_138225692.1|2149987_2151544_+	hypothetical protein	NA	A0A2H4J308	uncultured_Caudovirales_phage	38.7	3.2e-19
WP_138225693.1|2151540_2152455_+	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	30.5	2.6e-21
WP_138225694.1|2152451_2152730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225695.1|2152733_2152937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225696.1|2152955_2153333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225697.1|2153875_2154424_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	60.8	7.7e-53
WP_138225698.1|2154581_2154941_+	HNH endonuclease	NA	Q38456	Bacillus_phage	56.6	5.2e-34
WP_138227726.1|2155212_2155926_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_138225699.1|2155935_2156292_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_138225700.1|2156291_2156909_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_138225701.1|2157059_2157545_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_138225702.1|2157525_2159319_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	40.1	3.9e-114
WP_138225703.1|2159340_2160615_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	46.0	1.2e-101
WP_138225704.1|2160615_2161218_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	47.4	1.3e-37
WP_138225705.1|2161260_2162427_+|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	49.9	5.2e-99
WP_138225706.1|2162466_2162853_+	collagen-like protein	NA	NA	NA	NA	NA
WP_138225707.1|2162852_2163395_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_138225708.1|2163394_2163880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225709.1|2163876_2164239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225710.1|2164213_2164711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225711.1|2164697_2165702_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	44.4	2.3e-71
WP_138227727.1|2165755_2166112_+	DUF3277 domain-containing protein	NA	NA	NA	NA	NA
WP_138225712.1|2166138_2166441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225713.1|2166406_2166589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225714.1|2166632_2168834_+|tail	phage tail tape measure protein	tail	M4ZR40	Bacillus_phage	38.9	2.1e-32
WP_138225715.1|2168833_2169382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225716.1|2169391_2169712_+	hypothetical protein	NA	A0A1L2JY63	Aeribacillus_phage	48.2	1.0e-20
WP_138225717.1|2169704_2170493_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	43.3	1.4e-55
WP_138225718.1|2170489_2170867_+	hypothetical protein	NA	A8ATI0	Listeria_phage	37.3	8.0e-09
WP_138225719.1|2170863_2171229_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_138225720.1|2171218_2172391_+|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	48.5	4.4e-98
WP_138225721.1|2172383_2173025_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	50.0	1.1e-53
WP_138225722.1|2173012_2174389_+	hypothetical protein	NA	A0A1L2K2Q1	Aeribacillus_phage	51.9	2.0e-09
WP_138225723.1|2174403_2174697_+	hypothetical protein	NA	A0A2R2ZGK0	Clostridioides_phage	48.5	7.8e-20
WP_138227728.1|2174955_2175234_+	hypothetical protein	NA	A0A2H4J1Q4	uncultured_Caudovirales_phage	42.7	9.0e-10
WP_138225724.1|2175235_2175508_+	hypothetical protein	NA	A0A249XXG8	Clostridium_phage	36.4	4.9e-08
WP_138225725.1|2175500_2176235_+	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	50.5	9.6e-43
WP_138225726.1|2176476_2176944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225727.1|2176954_2177563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225728.1|2177608_2178010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138225729.1|2178305_2178638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225730.1|2179003_2179489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225731.1|2179485_2179995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225732.1|2181211_2181496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138225733.1|2181598_2182786_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	27.7	5.0e-33
2188245:2188260	attR	CAAAAATATCAAGAAT	NA	NA	NA	NA
>prophage 8
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	2698350	2738635	4475055	tRNA,head,portal,protease,plate,tail,capsid	Bacillus_phage(17.65%)	51	NA	NA
WP_138226151.1|2698350_2699100_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_138227788.1|2699101_2699626_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_138226152.1|2699835_2700066_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_138226153.1|2700087_2700360_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_138226154.1|2700407_2701790_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_138226155.1|2701829_2702180_-	YlxM family DNA-binding protein	NA	NA	NA	NA	NA
WP_138227789.1|2702309_2702957_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_138226156.1|2703074_2704070_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_138226157.1|2704182_2707752_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_138226158.1|2707928_2708627_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	31.8	1.2e-26
WP_138226159.1|2708639_2709878_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_046677908.1|2710038_2710272_-	acyl carrier protein	NA	K4FB26	Cronobacter_phage	42.9	1.0e-06
WP_138226160.1|2710386_2711136_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.6	4.6e-24
WP_138226161.1|2711205_2712138_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_138226162.1|2712188_2713181_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_138226163.1|2713189_2714176_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_138226164.1|2714201_2714762_-	transcription factor FapR	NA	NA	NA	NA	NA
WP_006211382.1|2714952_2715126_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_138226165.1|2715179_2715689_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_138226166.1|2715876_2717112_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_138226167.1|2717089_2718142_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_138226168.1|2718265_2719465_+	nucleoside recognition protein	NA	NA	NA	NA	NA
WP_138226169.1|2719445_2719958_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.5	8.8e-27
WP_138226170.1|2719960_2720554_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_138226171.1|2721086_2721656_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_138226172.1|2721652_2721865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138226173.1|2721881_2722613_-	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	49.5	1.8e-44
WP_138227790.1|2722609_2722879_-	hypothetical protein	NA	A0A0A7RUX1	Clostridium_phage	41.6	2.5e-09
WP_138226174.1|2722899_2723187_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	37.8	1.8e-08
WP_138226175.1|2723482_2723893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226176.1|2723914_2725102_-|tail	tail fiber protein	tail	S6B1J7	Thermus_phage	31.4	5.4e-27
WP_138226177.1|2725113_2725755_-	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	50.9	6.6e-56
WP_138226178.1|2725747_2726920_-|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	49.0	8.9e-99
WP_138226179.1|2726909_2727275_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_138226180.1|2727271_2727649_-	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	36.6	6.1e-09
WP_138226181.1|2727645_2728434_-	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	43.7	9.6e-57
WP_138226182.1|2728426_2728753_-	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	46.7	2.7e-21
WP_138226183.1|2728762_2729311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226184.1|2729310_2731512_-|tail	phage tail tape measure protein	tail	M4ZR40	Bacillus_phage	38.9	1.6e-32
WP_138226185.1|2731555_2731738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138225712.1|2731703_2732006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227727.1|2732032_2732389_-	DUF3277 domain-containing protein	NA	NA	NA	NA	NA
WP_138226186.1|2732442_2733447_-	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	44.4	3.0e-71
WP_138226187.1|2733433_2733931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226188.1|2733905_2734268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226189.1|2734264_2734750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227791.1|2734761_2735298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226190.1|2735278_2735506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226191.1|2735542_2736775_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_138226192.1|2736786_2737443_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXB1	Streptomyces_phage	37.5	3.0e-19
WP_138226193.1|2737336_2738635_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	46.7	1.4e-97
>prophage 9
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	2747024	2759845	4475055	integrase	Brevibacillus_phage(44.44%)	17	2753569:2753582	2761167:2761180
WP_138226203.1|2747024_2749382_-	virulence protein E	NA	S5M5Y2	Brevibacillus_phage	58.0	2.9e-274
WP_138226204.1|2749844_2750048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227792.1|2750031_2750559_-	DUF3310 domain-containing protein	NA	S4TWT2	Salmonella_phage	55.4	2.2e-17
WP_138226205.1|2751102_2753046_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	63.6	2.5e-239
WP_138226206.1|2753042_2753423_-	hypothetical protein	NA	A0A1C9EI42	Rhodococcus_phage	41.6	1.3e-14
WP_138226207.1|2753498_2754098_-	DUF2815 family protein	NA	A0A2I7QIM8	Bacillus_phage	71.0	4.7e-72
2753569:2753582	attL	TTCAGGCTGCTGCG	NA	NA	NA	NA
WP_138226208.1|2754127_2754373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226209.1|2754369_2755569_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	51.6	5.3e-107
WP_138226210.1|2755565_2755991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226211.1|2756015_2756288_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	65.9	4.1e-23
WP_138226212.1|2756464_2756671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226213.1|2756676_2756883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226214.1|2756909_2757170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227793.1|2757166_2757343_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138226215.1|2757561_2757765_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138226216.1|2757957_2758668_+	helix-turn-helix domain-containing protein	NA	R9VW28	Paenibacillus_phage	39.5	4.3e-40
WP_138226217.1|2758681_2759845_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	54.1	2.2e-113
2761167:2761180	attR	TTCAGGCTGCTGCG	NA	NA	NA	NA
>prophage 10
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	3219259	3315966	4475055	tRNA,head,portal,terminase,protease,plate,tail,capsid	Bacteriophage(31.67%)	112	NA	NA
WP_138227833.1|3219259_3220327_-	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.2	6.6e-08
WP_138226579.1|3221601_3221805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138226580.1|3221821_3222034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226581.1|3222074_3222560_-	transcriptional regulator	NA	A0A0C5AJ96	Bacteriophage	61.5	5.4e-42
WP_138226582.1|3222623_3223100_-	hypothetical protein	NA	A0A2H4J255	uncultured_Caudovirales_phage	71.9	3.3e-20
WP_138226583.1|3224042_3224309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226584.1|3224298_3224754_-	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	29.1	4.8e-08
WP_138226585.1|3224768_3225290_-	hypothetical protein	NA	A0A1B1P7G1	Bacillus_phage	29.4	2.5e-08
WP_138226586.1|3225306_3225924_-	hypothetical protein	NA	A6M991	Geobacillus_virus	38.8	4.5e-09
WP_138226587.1|3225927_3226695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226588.1|3226710_3227148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226589.1|3227164_3227827_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	47.4	1.5e-39
WP_138226590.1|3227823_3228153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226591.1|3228170_3228548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226592.1|3228519_3229863_-	hypothetical protein	NA	A0A0K1LLK3	Bacillus_phage	33.5	1.6e-59
WP_138226593.1|3229852_3230350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226594.1|3230168_3231083_-	replication protein	NA	A0A290FZL4	Caldibacillus_phage	48.1	1.5e-21
WP_138226595.1|3231103_3231724_-	3'-5' exonuclease	NA	G3MAD3	Bacillus_virus	33.5	2.4e-18
WP_138226596.1|3231723_3232479_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	61.4	1.0e-87
WP_138226597.1|3232475_3232982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227834.1|3232978_3233203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226598.1|3233344_3234286_-	recombinase RecT	NA	A0A0C5ACB0	Paenibacillus_phage	37.1	1.1e-38
WP_138226599.1|3234458_3234674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226600.1|3234660_3236232_-	ATPase	NA	A0A2I7SC81	Paenibacillus_phage	51.5	2.1e-135
WP_138226601.1|3236218_3236434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226602.1|3236478_3236691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226603.1|3237128_3237419_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	40.2	1.5e-10
WP_138226604.1|3237415_3237670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226605.1|3237677_3238004_-	helix-turn-helix transcriptional regulator	NA	A0A0C5AMZ9	Paenibacillus_phage	57.6	2.3e-12
WP_138227835.1|3238011_3238254_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	52.7	3.6e-15
WP_138226606.1|3238488_3238839_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	40.5	4.8e-16
WP_138226607.1|3239043_3239286_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138226608.1|3239362_3239971_-	hypothetical protein	NA	A0A1B1P7T2	Bacillus_phage	51.6	2.5e-52
WP_138226609.1|3239973_3241188_-	cell division protein FtsK	NA	A0A0S2GLG9	Bacillus_phage	44.0	1.8e-70
WP_138226610.1|3241326_3241548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226611.1|3241544_3241754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226612.1|3241746_3242544_-	ParM/StbA family protein	NA	E5DV70	Deep-sea_thermophilic_phage	49.6	4.7e-59
WP_138226613.1|3242742_3242967_+	transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	50.7	5.0e-11
WP_138226614.1|3243030_3243693_+	hypothetical protein	NA	D2XR34	Bacillus_phage	42.5	1.3e-09
WP_138226615.1|3243995_3244211_-	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	53.8	7.0e-10
WP_138226616.1|3244372_3244762_+	hypothetical protein	NA	O48383	Streptococcus_phage	50.9	8.5e-06
WP_138226617.1|3244789_3245008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138226618.1|3245185_3245851_+	hypothetical protein	NA	A0A0M7RDN2	Lactobacillus_phage	35.8	1.9e-13
WP_138226619.1|3245868_3246603_-	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	48.5	6.0e-45
WP_138226620.1|3246595_3246868_-	hypothetical protein	NA	A0A249XXG8	Clostridium_phage	35.2	6.3e-08
WP_138227728.1|3246869_3247148_-	hypothetical protein	NA	A0A2H4J1Q4	uncultured_Caudovirales_phage	42.7	9.0e-10
WP_138226621.1|3247438_3247873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226622.1|3247890_3249354_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	58.5	2.2e-46
WP_138226623.1|3249362_3249923_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	56.5	2.9e-55
WP_138226624.1|3249915_3251043_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	52.2	1.1e-106
WP_138226625.1|3251042_3251372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226626.1|3251368_3251776_-|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	48.5	2.3e-30
WP_138226627.1|3251772_3252186_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_138226628.1|3252189_3253221_-	late control protein	NA	A0A0C5AJ59	Bacteriophage	48.8	7.3e-89
WP_138226629.1|3253217_3253430_-|tail	phage tail protein	tail	A0A2K9V482	Faecalibacterium_phage	44.6	2.8e-11
WP_138226630.1|3253426_3256285_-|tail	phage tail tape-measure protein	tail	A0A0S2SXL7	Bacillus_phage	23.3	6.9e-36
WP_138226631.1|3256454_3256805_-|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	41.1	2.1e-08
WP_138226632.1|3256825_3257350_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	35.8	9.0e-27
WP_138226633.1|3257364_3258804_-|tail	phage tail sheath family protein	tail	A0A0C5AEE8	Bacteriophage	46.5	4.9e-115
WP_138226634.1|3258806_3259136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226635.1|3259125_3259641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226636.1|3259637_3260204_-	hypothetical protein	NA	A0A0C5AEN6	Bacteriophage	49.1	4.1e-33
WP_138226637.1|3260200_3260557_-	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	44.7	2.8e-16
WP_138226638.1|3260571_3260904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226639.1|3260924_3261959_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	47.8	5.3e-87
WP_138226640.1|3261974_3262358_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	43.2	6.0e-12
WP_138226641.1|3262357_3263536_-|protease	Clp protease ClpP	protease	A0A290FZN4	Caldibacillus_phage	44.4	9.7e-45
WP_138226642.1|3263504_3265115_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	62.3	9.8e-181
WP_138226643.1|3265111_3265351_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	44.3	7.0e-11
WP_138226644.1|3265376_3267248_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	51.4	1.3e-173
WP_138226645.1|3267225_3267753_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	48.2	4.5e-34
WP_138226646.1|3268147_3268384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226647.1|3268572_3269241_-	hypothetical protein	NA	A0A1B1P7T6	Bacillus_phage	50.0	2.9e-22
WP_138226648.1|3269251_3270451_-	SGNH/GDSL hydrolase family protein	NA	A0A1Y0SY76	Sinorhizobium_phage	27.5	9.3e-11
WP_138226649.1|3270451_3271183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226650.1|3271230_3271467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226651.1|3271486_3271774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226652.1|3272622_3274266_+	recombinase family protein	NA	O64015	Bacillus_phage	42.5	2.2e-119
WP_138226653.1|3275427_3276171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138226654.1|3276183_3277395_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_138226655.1|3277484_3278141_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_138227836.1|3278523_3278928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138226656.1|3278924_3280004_+	phosphodiester glycosidase family protein	NA	A0A2H4JHN3	uncultured_Caudovirales_phage	31.1	4.0e-05
WP_138226657.1|3280308_3280563_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	45.6	2.5e-14
WP_138226658.1|3280760_3281507_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_138226659.1|3282105_3283584_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_138226660.1|3283778_3284552_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_138226661.1|3284556_3285732_-	CoA transferase	NA	NA	NA	NA	NA
WP_138226662.1|3285728_3286907_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_138226663.1|3286926_3288075_-	CoA transferase	NA	NA	NA	NA	NA
WP_138226664.1|3288116_3289214_-	CoA transferase	NA	NA	NA	NA	NA
WP_138226665.1|3289274_3291635_-	glycoside hydrolase family 2	NA	NA	NA	NA	NA
WP_138226666.1|3292180_3292282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226667.1|3292507_3292972_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_138226668.1|3293139_3294228_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	1.5e-87
WP_138226669.1|3294393_3295818_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_138226670.1|3296096_3297152_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	27.0	7.4e-12
WP_138227837.1|3297359_3299132_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.3	4.3e-20
WP_138226671.1|3299164_3300736_-	response regulator	NA	NA	NA	NA	NA
WP_138227838.1|3300851_3302510_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_138226672.1|3302601_3303498_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_138226673.1|3303535_3304495_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_138226674.1|3304731_3305682_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_138226675.1|3305732_3307199_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.3	2.2e-30
WP_138226676.1|3307200_3307887_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.9	3.5e-39
WP_138226677.1|3307999_3309661_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	1.3e-18
WP_138226678.1|3309792_3310446_-	response regulator transcription factor	NA	Q6XLV6	Feldmannia_irregularis_virus	30.8	1.9e-05
WP_138226679.1|3310467_3311520_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_138226680.1|3311524_3312613_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_138227839.1|3312856_3313060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138226681.1|3313194_3313938_-	3D domain-containing protein	NA	NA	NA	NA	NA
WP_138226682.1|3314028_3315966_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.7	1.1e-122
>prophage 11
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	3833145	3880176	4475055	integrase,transposase	uncultured_virus(25.0%)	28	3837944:3837964	3864029:3864049
WP_138227071.1|3833145_3834366_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	54.5	5.1e-57
WP_138227072.1|3834415_3834901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227073.1|3835141_3836029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138227074.1|3836859_3837201_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3837944:3837964	attL	GAAAAATAAAGTATTAGACTG	NA	NA	NA	NA
WP_138227075.1|3838107_3838626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227076.1|3838626_3839892_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_138227077.1|3840181_3840655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227078.1|3840668_3841163_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_138227079.1|3841174_3842404_-	DUF4071 domain-containing protein	NA	A0A2I6PCS6	Staphylococcus_phage	33.5	1.1e-11
WP_138227080.1|3845626_3846997_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_138227081.1|3848449_3850078_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_138227082.1|3850123_3853417_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	27.4	1.5e-26
WP_138227083.1|3853382_3854513_-	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7RW72	Vibrio_phage	33.2	1.0e-14
WP_138227084.1|3855065_3856679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227085.1|3857004_3858432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138227887.1|3860109_3862311_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_138227086.1|3862310_3863138_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_138227087.1|3863147_3863507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227088.1|3863561_3863942_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138227089.1|3864445_3866002_-	ATP-binding protein	NA	NA	NA	NA	NA
3864029:3864049	attR	CAGTCTAATACTTTATTTTTC	NA	NA	NA	NA
WP_138227090.1|3866493_3868290_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_138227888.1|3868274_3870326_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_138227091.1|3870389_3870920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227092.1|3871927_3873562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227093.1|3873585_3875493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138227094.1|3875520_3877236_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_138227095.1|3877225_3879361_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138227096.1|3879360_3880176_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP040396	Paenibacillus sp. HB172198 chromosome, complete genome	4475055	4407518	4416200	4475055		Streptococcus_phage(33.33%)	9	NA	NA
WP_138227487.1|4407518_4408328_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.1	2.1e-06
WP_138227488.1|4408324_4409086_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.9	2.7e-08
WP_138227489.1|4409125_4409860_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	53.5	3.1e-73
WP_138227490.1|4409990_4410464_+	DinB family protein	NA	NA	NA	NA	NA
WP_138227491.1|4410569_4412318_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.7	6.1e-27
WP_138227492.1|4412582_4412942_+	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_138227493.1|4413133_4414030_-	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	42.4	5.1e-22
WP_138227494.1|4414561_4414762_+	YjzC family protein	NA	NA	NA	NA	NA
WP_138227495.1|4414928_4416200_+	ATP-binding protein	NA	V9QJ85	Oenococcus_phage	33.1	6.6e-07
