The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	197290	254192	2805984	transposase,tRNA	Streptococcus_phage(33.33%)	52	NA	NA
WP_002287522.1|197290_197695_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|197711_198860_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002296565.1|199810_200842_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002289743.1|201460_204100_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002296566.1|204267_204966_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002294182.1|206424_206805_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_073120075.1|206901_207081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296567.1|207109_209707_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288261.1|209935_211042_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002288258.1|212088_212568_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|213193_214532_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_126145175.1|214576_214783_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_002300046.1|214764_215070_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_033582433.1|215089_215893_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002300048.1|216141_217206_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002288233.1|217202_218288_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002300050.1|218300_219278_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288231.1|219270_220215_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_002300051.1|220536_221190_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.3	1.5e-58
WP_002300052.1|221274_222180_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002300053.1|222181_222814_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002293357.1|223133_223658_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002289309.1|223729_223930_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002289310.1|223982_224342_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_111230921.1|224753_225119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|225225_226413_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_080388548.1|226509_227406_+	citrate transporter	NA	NA	NA	NA	NA
WP_002341584.1|227453_229583_+	hydantoinase/oxoprolinase	NA	NA	NA	NA	NA
WP_002302159.1|229557_230247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080001506.1|230237_230426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315615.1|231475_231670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301667.1|231719_232160_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002299303.1|232163_233009_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|233157_234576_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002297218.1|234673_235969_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002299302.1|236173_237376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299301.1|237362_239150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299300.1|239162_240116_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002309710.1|240300_240651_-	peptidase	NA	NA	NA	NA	NA
WP_002294156.1|240850_241930_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002292632.1|242072_242393_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002345012.1|242414_242879_+	universal stress protein	NA	NA	NA	NA	NA
WP_002313997.1|243074_243680_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_002290101.1|243718_245008_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
WP_002345011.1|245435_245915_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002326691.1|246046_247126_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	36.2	9.2e-50
WP_001825268.1|247514_247634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420682.1|247656_247971_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|247986_248373_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000398284.1|249964_251170_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|251953_253864_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|253967_254192_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
>prophage 2
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	271282	312452	2805984	transposase	Streptococcus_phage(37.5%)	29	NA	NA
WP_002354485.1|271282_271969_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002345002.1|272714_273449_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(T)	NA	E4ZFQ0	Streptococcus_phage	52.5	2.2e-63
WP_002503927.1|273508_273568_-	23S rRNA methylase leader peptide ErmCL	NA	NA	NA	NA	NA
WP_002354485.1|273669_274356_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002287843.1|274784_275954_+|transposase	IS256-like element ISEfa13 family transposase	transposase	NA	NA	NA	NA
WP_002287844.1|276253_276946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|277358_278537_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002287845.1|278719_279112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287847.1|279693_280269_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	54.5	4.4e-51
WP_002287851.1|281943_283455_+	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_002287852.1|283467_284868_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_002287854.1|285032_286469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312606.1|291777_292239_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298779.1|292763_293513_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002312610.1|297516_298476_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002323668.1|298592_298901_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002312614.1|298927_299227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138222634.1|299400_299943_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_000997695.1|299967_301146_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296258.1|301443_301737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312617.1|301729_302026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312618.1|302096_303101_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002312619.1|303623_304547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323671.1|304729_307405_+	DUF927 domain-containing protein	NA	A0A2H4J8K1	uncultured_Caudovirales_phage	28.0	2.5e-24
WP_002312623.1|307586_307826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312624.1|307841_309215_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	23.4	1.1e-12
WP_002312625.1|309218_310853_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	28.3	1.8e-41
WP_010706118.1|311015_311222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|311290_312452_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 3
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	795499	803971	2805984		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|795499_796144_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|796158_796488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|796501_797440_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|797475_798300_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|798292_798640_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|798708_799581_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_125292723.1|799689_800811_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|800864_801467_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|801781_803971_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 4
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	856982	959393	2805984	portal,transposase,capsid,protease,integrase,head,tail,terminase,tRNA,holin	Enterococcus_phage(25.0%)	108	882765:882781	942349:942365
WP_002286621.1|856982_859781_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|859829_861356_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|861370_862018_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|862201_862531_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|862707_863436_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|863451_864465_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|864464_865742_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|865804_868507_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|868658_868976_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|869005_869326_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|869433_870894_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|870961_871183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|871213_871396_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|871395_871809_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|871931_873113_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|873643_874783_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|875081_875717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|875829_876465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|876498_876960_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|877089_877521_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|877538_877859_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|878157_878934_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|878948_879152_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|879167_879506_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|879492_879672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|879714_880185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|880271_880970_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|881147_881489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|881481_882153_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|882158_882845_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
882765:882781	attL	ATTAATTTCAAAAATAA	NA	NA	NA	NA
WP_002286552.1|882847_883597_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|883608_883878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|884039_884342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|884338_884500_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|884496_884802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|884801_885158_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|885117_885363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|885359_885779_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|885775_886333_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|886329_886626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|886702_887116_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002311723.1|888301_888508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|888703_888871_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|888896_889241_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|889245_889527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|889629_889944_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|889921_891616_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|891635_892814_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|892776_893463_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|893462_894623_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|894632_895508_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|895504_895816_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|895805_896159_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|896148_896550_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|896542_896947_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002347039.1|896958_897540_+	hypothetical protein	NA	R4IBJ8	Listeria_phage	40.6	1.7e-34
WP_002286510.1|897585_897948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|897950_898133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125292715.1|898149_901581_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002299176.1|901631_902369_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_060806750.1|902378_904670_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	29.9	7.3e-89
WP_002286495.1|904693_906820_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|906982_907429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|907430_907568_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|907605_907899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|907895_908120_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|908116_909142_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286474.1|912163_912571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|912584_912986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|912987_913359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|913394_913697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|913945_914146_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286469.1|914450_915683_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|915936_916506_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286465.1|916683_917124_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|917281_918046_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|918077_919001_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|919076_920216_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|920208_921009_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|921008_921836_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|921813_922548_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|922647_923514_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|923527_924100_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002296544.1|924121_925150_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.2	2.2e-69
WP_002294531.1|925247_926099_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.3e-38
WP_002296543.1|926133_928167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060805065.1|928210_929491_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002289081.1|929700_930507_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296541.1|930518_931739_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	3.3e-11
WP_002296539.1|931728_933315_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002326808.1|933353_935492_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289074.1|935859_936843_-	serine hydrolase	NA	NA	NA	NA	NA
WP_002289071.1|938626_939667_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289069.1|939685_940771_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289068.1|940803_941766_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002292877.1|941758_943186_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
942349:942365	attR	ATTAATTTCAAAAATAA	NA	NA	NA	NA
WP_002302730.1|943187_944258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292875.1|944244_945666_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002289359.1|945678_946686_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292874.1|946697_947702_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289362.1|947698_948847_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002289363.1|948819_949497_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002326811.1|949486_950629_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289366.1|950641_951619_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289368.1|951618_952527_+	dehydrogenase	NA	NA	NA	NA	NA
WP_002289370.1|952527_953280_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289372.1|953284_954232_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_000997695.1|958214_959393_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	1228153	1237214	2805984		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1228153_1229449_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1229628_1230006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1230261_1230990_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1230989_1231244_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1231245_1231917_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1231917_1234140_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1234124_1235564_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1235595_1236639_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1236635_1237214_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 6
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	1301430	1366399	2805984	transposase,tRNA	Bacillus_phage(17.65%)	56	NA	NA
WP_002297218.1|1301430_1302726_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296887.1|1302996_1306524_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_138222727.1|1306520_1310243_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.3	2.1e-24
WP_002303789.1|1310311_1310653_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295783.1|1310961_1312005_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.6	1.9e-31
WP_002296881.1|1312009_1314430_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002297185.1|1314526_1315822_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288045.1|1316121_1317132_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002296877.1|1317385_1318123_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.7e-32
WP_002288041.1|1318136_1318952_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002288038.1|1318964_1319612_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002296876.1|1319627_1320284_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002317207.1|1320445_1321267_+	glutamate racemase	NA	NA	NA	NA	NA
WP_002296875.1|1321269_1322625_+	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.8	9.2e-15
WP_002288030.1|1322625_1323144_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002295789.1|1323250_1323751_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002295791.1|1324030_1324951_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002296282.1|1325115_1326129_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002295795.1|1326238_1326994_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_002295797.1|1327213_1327654_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002296283.1|1327768_1328530_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.0	6.7e-23
WP_002295800.1|1328718_1329813_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002303791.1|1329898_1330858_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002289735.1|1331043_1331979_+	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	25.4	2.0e-05
WP_002289734.1|1332062_1333073_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002296575.1|1333360_1334674_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_002295807.1|1334894_1335482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295809.1|1335658_1336600_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_002296573.1|1336596_1337385_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_138222729.1|1337394_1337829_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_002296571.1|1337970_1340268_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.3e-80
WP_002295813.1|1340281_1340794_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	2.4e-32
WP_002297436.1|1341083_1341302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295816.1|1342249_1342501_+	DUF896 family protein	NA	NA	NA	NA	NA
WP_002295818.1|1342602_1344600_+	transketolase	NA	NA	NA	NA	NA
WP_002302440.1|1344680_1345982_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002286097.1|1346278_1347232_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295819.1|1347413_1348301_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_002296093.1|1348440_1349367_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.2	2.7e-98
WP_002289542.1|1349602_1350049_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002289543.1|1350321_1351674_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296094.1|1351844_1352132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289545.1|1352357_1352801_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296096.1|1352806_1353991_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_002289610.1|1354258_1354957_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	42.5	4.9e-12
WP_002296097.1|1354963_1355641_+	endonuclease III	NA	NA	NA	NA	NA
WP_002289611.1|1355766_1356300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314831.1|1356596_1358978_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002289604.1|1358967_1359615_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	37.5	1.7e-22
WP_002299695.1|1359678_1360218_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295835.1|1360307_1360727_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_002289183.1|1361324_1362491_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_002289184.1|1362536_1364033_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_002289185.1|1364113_1364797_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	2.5e-13
WP_002324816.1|1364796_1365018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|1365097_1366399_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 7
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	1528035	1586962	2805984	transposase,integrase,tRNA	Streptococcus_phage(23.53%)	59	1535012:1535071	1578235:1580029
WP_002297218.1|1528035_1529331_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002293303.1|1529476_1529677_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296656.1|1530428_1531142_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1531134_1532220_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1532236_1532680_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1532713_1533067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1533178_1533580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1533616_1534126_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_138222733.1|1534147_1535005_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
1535012:1535071	attL	TTCCTCCTCGTAAAATATCATTTGTCTAATAGTTTTTATTCAAAATGTTTCTAGATTATA	NA	NA	NA	NA
WP_002297404.1|1535414_1536665_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|1536806_1537802_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1537819_1538374_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1538361_1538853_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138222734.1|1538845_1540714_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1540732_1541533_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|1541756_1541972_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1542110_1542596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1543051_1543465_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|1543601_1543862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303865.1|1543789_1544029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|1543979_1544270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288357.1|1546855_1547983_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_002288355.1|1548076_1549912_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288353.1|1550058_1551279_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288352.1|1551298_1551793_+	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288350.1|1551785_1552457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288348.1|1552607_1555217_-	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002288347.1|1555467_1556514_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288344.1|1556524_1556797_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288343.1|1556831_1557740_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002288340.1|1557871_1559104_-	peptidase T	NA	NA	NA	NA	NA
WP_002288338.1|1559118_1560240_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288335.1|1560236_1560938_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288333.1|1561081_1561522_-	lipoprotein	NA	NA	NA	NA	NA
WP_002288331.1|1561650_1562577_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	41.3	5.1e-33
WP_002288329.1|1562576_1563950_-	Replication initiation and membrane attachment	NA	NA	NA	NA	NA
WP_002288327.1|1563972_1564464_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002288325.1|1564775_1565108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288324.1|1565159_1565789_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002288323.1|1565752_1566589_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.2	1.8e-24
WP_002296395.1|1566633_1569279_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.7	3.0e-54
WP_002296397.1|1569404_1570088_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002296398.1|1570080_1570566_-	dehydratase	NA	NA	NA	NA	NA
WP_002296400.1|1570872_1572207_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002296401.1|1572337_1573099_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002296402.1|1573114_1573597_-	SprT family protein	NA	NA	NA	NA	NA
WP_002296403.1|1573616_1575797_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002296404.1|1575940_1576672_-	serine/threonine protein phosphatase	NA	A7KV25	Bacillus_phage	30.8	1.7e-15
WP_002296405.1|1576740_1577682_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_002296407.1|1577861_1578230_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002297404.1|1578637_1579888_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295194.1|1580623_1582015_-	L-cystine transporter	NA	NA	NA	NA	NA
1578235:1580029	attR	TTCCTCCTCGTAAAATATCATTTGTCTAATAGTTTTTATTCAAAATGTTTCTAGATTATAAAATTTATTGAATAACACATTCCTAACGGAATTTGTTTCGATATTGTGTGATTTCTCAGAGTACAATGGATGTATGGAAAGGATCCAACGGGAATTTGCTATTTCCTCCTGTAGCGTTTGTCTACCCTGTTTAGTCTGTTACCCGAACCACTGTTATCACTACCAACTCATTAGCTGTTTCGATAATGGACTAGACTTTCAAATAGTAGTTTGGAAGGCAGCTTCTAGCTCTTTTATCACCGTATTCTATTAGGCGAGGTTGTGGCTATACAGTGAGTTTCTGGGAAATCCCACAGTATCGAAGCATTTTCCAAAATTTATATCGAAAGGAGGTCCTTCTTCCATGAAATTATTTGTCGGTATTGACGTTAGCTCTGAAAAACTAGATGTTTGTTTTTTAACAGACGACAATCAATTGTCTATCTTATCTGAAATCTCTGTTGCCAATGACATCGAAGGTGCTTCATTCATACGAGAAACAATTCTTGAATTCAATGACAGCTACCACTTTGATCAAATTGTGATTGGCATGGAGTCAACGTCCATGTACAGCTTCCATCCTTCCATGTTTTTTCATGAAGATGAGAAACTAAAGAAGCTCAACACACTTGTAACGATTGAAAATCCTTTTCGGGTGAAACAATTTAGTCGCATGTTTGATGAGAATAAAACTGATCGAAACGATGCATTAAGAATCGCTGATTTCTTGCGTATTCAACGATTCACAACTTCCCCTATCAAAGAAGAGAAATACATGGCCTTACAGCGTTTAACACGTACTCGCTATCAACTTATTAAGCAATTGATTCGTACAAAGCAACATTTTCTTGAAAATCTAACGTACAAATGTAATACGCTTGCTCGAGAAATGCGAGACGAATCGACGAGTCTTTTTAGTGCAACCCTCATTTCACTCATGACGGAAGATTTCACATTGGATGAACTTGCTGAGCTTCCTTTAGAAGCTTTCTGTGATTTACTTCAAGAAAAAGGAAAAGGCCGTTTCAAGCAACCAGAAAAAATCGCTAAAGCAATTCAACGTGCAATTACCATGAGTTACCGCCTAGGTGCTCTTGCACAAGAATCAATTAATGTTGTTTTAAGTGTTCTCGTACGAGAAATACGAGCACTTGAAAAAAATATCAAAGAATTAGATAAAGCCATCGAACAAGTAATTGTTGTCATTCCAGAATATCAATGCTTAACCAGTATTCCAGGCGTTGGTAAAGTCTATGCTGCCGGTTTAATCGCTGAAATTGGTCAAATCGAAAGATTTGAAGATCAGACAAAATTGGCAAAATACGCTGGATTAAGTTGGAAAGTGAACCAATCTGGAAACTATCAGTCGCAAAATACACCTCTGACAAAACAAGGAAATCGATATTTTAGATACTACTTAGTTGAAGCTGCCAACTCTGTAAAAAATTATCTTCCTGAATACAAAGCTTTTTATCAAAGTAAATATAAGGAGGTTCCAAAGCATCAACACAAACGTGCACTCGTCCTAACCGCAAGAAAATTTACGCGTCTGGTGGATACGCTACTACGTAAACACCAACTCTATACGCCACCAAGGAGTGTGATAGAGAAATAACAATCCGTTATTGACGCAAATCCTTGAATCAACCCGAAAAAAATTTGATTTTGATCGGGTCTAGTTTCGTGCGCTTCAAAACATATTACTCAATAAAGAAAATCTTAAATTTCATCTTGACTTATCACCATTAGACTAAAC	NA	NA	NA	NA
WP_002291995.1|1582227_1582614_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_002295196.1|1582669_1583293_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002295197.1|1583356_1584025_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002322028.1|1584036_1584477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295199.1|1584535_1585207_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002287525.1|1585392_1586541_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1586557_1586962_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
>prophage 8
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	1630217	1689143	2805984	transposase,tRNA,protease	Streptococcus_phage(28.57%)	51	NA	NA
WP_002288492.1|1630217_1631468_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.8	1.1e-147
WP_002292069.1|1631714_1633004_-	trigger factor	NA	NA	NA	NA	NA
WP_002296313.1|1633157_1634090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296311.1|1634246_1634906_-	RDD family protein	NA	NA	NA	NA	NA
WP_002303897.1|1634908_1635934_-	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	33.1	3.2e-20
WP_002287827.1|1635946_1636237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303899.1|1636645_1638451_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.8	1.7e-96
WP_002287824.1|1638522_1639878_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002287822.1|1639901_1641071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287821.1|1641067_1641955_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_002287819.1|1642143_1645836_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_002287818.1|1646034_1646556_+	DsbA family protein	NA	NA	NA	NA	NA
WP_002297185.1|1647128_1648424_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287817.1|1648775_1649333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321468.1|1649511_1650123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287812.1|1650235_1650493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287830.1|1651089_1651368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340387.1|1651401_1651653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|1652225_1653179_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002326695.1|1653175_1653757_-	DUF443 family protein	NA	NA	NA	NA	NA
WP_002321528.1|1653943_1654594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312920.1|1654584_1654785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289698.1|1655136_1656072_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
WP_002289697.1|1656105_1657104_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	2.6e-115
WP_002289695.1|1657100_1657985_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_002296517.1|1658119_1658851_-	aspartate racemase	NA	NA	NA	NA	NA
WP_138222739.1|1658854_1660120_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_002296519.1|1660382_1663199_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
WP_002294444.1|1663208_1665203_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_002294446.1|1665461_1666964_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002292113.1|1666965_1667703_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
WP_072538615.1|1667747_1667909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138222741.1|1668070_1669237_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.4e-24
WP_002292134.1|1669387_1671217_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
WP_002294448.1|1671267_1671831_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002294449.1|1671924_1672968_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_002300945.1|1673202_1674369_-	oxygen-independent coproporphyrinogen III oxidase	NA	A0A0N7G7K6	Chrysochromulina_ericina_virus	33.6	5.0e-09
WP_002300943.1|1674384_1674612_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_002296623.1|1674911_1676207_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002340381.1|1677499_1678378_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002340391.1|1678411_1679182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300911.1|1679823_1680495_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002300913.1|1681017_1681608_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002300915.1|1681797_1682511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300917.1|1682625_1683636_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002300920.1|1683672_1684155_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002294467.1|1684304_1684673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300528.1|1685137_1685590_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288523.1|1685713_1686565_-	sugar transporter	NA	NA	NA	NA	NA
WP_002294471.1|1686577_1687363_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_080105260.1|1687637_1689143_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.4e-125
>prophage 9
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	1704394	1759067	2805984	transposase,tRNA,protease	Streptococcus_phage(14.29%)	53	NA	NA
WP_002294137.1|1704394_1706104_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1706171_1707440_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1707600_1708401_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1708397_1709210_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002297404.1|1709618_1710869_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1711187_1711745_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1711747_1712470_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1712605_1713487_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1713585_1714368_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1714726_1715206_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326249.1|1715422_1716514_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002293884.1|1716506_1717292_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002293885.1|1717637_1719329_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.8	9.9e-75
WP_002288434.1|1719750_1720698_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1720812_1721832_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1721922_1723152_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1723612_1724314_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293887.1|1724885_1725902_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	5.4e-60
WP_002293888.1|1725898_1726363_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002293890.1|1726369_1726912_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302614.1|1726895_1727720_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002293893.1|1727808_1728789_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002293895.1|1728812_1730297_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002293897.1|1730308_1731298_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	1.6e-48
WP_002288457.1|1731546_1731714_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002293899.1|1731775_1733587_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1733583_1733949_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002293900.1|1734111_1734507_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002293901.1|1734524_1735487_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1735486_1735699_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1735719_1736418_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1736437_1736980_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002319727.1|1737111_1738116_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1738112_1739102_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002325771.1|1739098_1739905_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.3e-13
WP_002293906.1|1740070_1741027_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1741103_1741622_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1741709_1741859_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1742086_1742533_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002293915.1|1742727_1744623_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002296840.1|1745673_1746861_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002296332.1|1747964_1748531_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326251.1|1748785_1750117_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1750082_1750433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317579.1|1750524_1750944_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002326252.1|1750944_1751289_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002287776.1|1751638_1752235_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002297218.1|1752359_1753655_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_010729307.1|1753880_1755680_+	glycerophosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002293930.1|1755957_1756170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325786.1|1757048_1757435_+	YxeA family protein	NA	NA	NA	NA	NA
WP_138222743.1|1757470_1757704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1757771_1759067_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 10
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	1762187	1804755	2805984	transposase,tRNA,protease,integrase	Streptococcus_phage(40.0%)	49	1793393:1793408	1804128:1804143
WP_002288576.1|1762187_1763441_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002347404.1|1763511_1763997_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002326253.1|1764019_1764778_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002322842.1|1764793_1765972_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002326254.1|1766201_1768322_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	6.3e-220
WP_002297185.1|1768484_1769780_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_127817623.1|1769847_1770078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296623.1|1769963_1771259_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002301399.1|1771428_1772388_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326255.1|1772642_1773368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1773357_1773867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1773936_1775385_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002293942.1|1775384_1776101_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1776081_1776432_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1776575_1777349_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1778105_1778408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293947.1|1779155_1779338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1779551_1779866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1779982_1781161_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1781497_1781737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1782097_1782358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1782542_1783040_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1783169_1783880_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1783892_1785557_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1785761_1786424_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_010731016.1|1786433_1787249_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1787503_1787947_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1788080_1788419_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288986.1|1788406_1788784_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288985.1|1789007_1790201_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1790366_1790789_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002321037.1|1791183_1791378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288983.1|1791374_1791869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296796.1|1791836_1792034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1792030_1793203_-	class C sortase	NA	NA	NA	NA	NA
1793393:1793408	attL	TTTGTTTCCAATAGTT	NA	NA	NA	NA
WP_002288981.1|1793407_1794223_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|1794372_1794819_-	cell wall anchor	NA	NA	NA	NA	NA
WP_002288977.1|1794815_1795829_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002288976.1|1795859_1796318_-	cell wall anchor	NA	NA	NA	NA	NA
WP_002305732.1|1796314_1798642_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288972.1|1799283_1799397_+|protease	CAAX amino protease	protease	NA	NA	NA	NA
WP_002288970.1|1799484_1799778_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002311684.1|1799814_1800000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288969.1|1800180_1801359_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|1801462_1801777_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1801883_1802099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1802398_1802641_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288962.1|1802627_1803056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296127.1|1803207_1804755_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
1804128:1804143	attR	TTTGTTTCCAATAGTT	NA	NA	NA	NA
>prophage 11
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	1818665	1883175	2805984	transposase,tRNA,integrase	Streptococcus_phage(46.43%)	55	1880712:1880726	1883678:1883692
WP_087040414.1|1818665_1819828_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|1819920_1820430_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000222572.1|1820768_1821722_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1821674_1821911_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289051.1|1822330_1823452_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|1825184_1825913_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002289055.1|1826040_1826952_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289057.1|1826968_1827976_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289059.1|1827972_1830102_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002298631.1|1831160_1832987_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_002288938.1|1835220_1835610_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002297208.1|1835659_1836556_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|1836558_1838406_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|1838502_1839003_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_033657400.1|1839015_1839240_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002286940.1|1839343_1841254_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002305703.1|1841999_1842137_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286933.1|1843573_1843828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|1843852_1844995_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286930.1|1845054_1846407_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002305701.1|1846477_1846831_-	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_002286926.1|1846831_1847206_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|1847218_1847533_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286921.1|1850951_1851614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286913.1|1851986_1852334_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1852469_1853231_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1853220_1853742_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1853911_1854703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1854827_1855079_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1855090_1855366_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1855618_1856173_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1856251_1856773_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1856776_1857355_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1857466_1858885_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1858905_1859244_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1859203_1859707_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_138222745.1|1859837_1860542_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	4.0e-38
WP_002297195.1|1860538_1862275_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1862377_1864849_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_099745856.1|1864853_1865036_-	RNA helicase	NA	NA	NA	NA	NA
WP_002340443.1|1865121_1866396_+|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	6.6e-55
WP_002289807.1|1866682_1867573_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1867769_1868252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1868459_1868825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1868915_1869233_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002287525.1|1869408_1870557_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1870573_1870978_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002301399.1|1871865_1872825_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1872947_1873922_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1874331_1875582_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1875867_1876125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1876356_1876770_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_087046766.1|1879576_1880739_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
1880712:1880726	attL	AATAGGTTCTTCGTT	NA	NA	NA	NA
WP_002301695.1|1882221_1882914_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002296536.1|1882908_1883175_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	56.5	1.4e-07
1883678:1883692	attR	AATAGGTTCTTCGTT	NA	NA	NA	NA
>prophage 12
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	2006783	2054437	2805984	transposase,holin	Streptococcus_phage(33.33%)	50	NA	NA
WP_002303620.1|2006783_2007134_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002348475.1|2007133_2007439_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002308604.1|2007617_2009186_-	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_002336557.1|2009285_2010053_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_138222753.1|2010049_2011087_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002297218.1|2011215_2012511_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289490.1|2012827_2013505_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002292757.1|2013517_2014276_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	6.9e-20
WP_002308601.1|2014291_2015098_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	5.1e-13
WP_002292759.1|2015112_2015997_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002292761.1|2015996_2016917_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002347800.1|2017031_2017889_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_060806678.1|2018225_2019674_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002296623.1|2019895_2021191_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002316423.1|2021336_2022230_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002292768.1|2022213_2022900_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-29
WP_105459804.1|2023004_2024106_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_060806679.1|2024232_2026767_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002296587.1|2026988_2027540_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002299428.1|2027667_2028387_-	ComF family protein	NA	NA	NA	NA	NA
WP_138222772.1|2028383_2029460_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	38.9	1.6e-54
WP_002292778.1|2029776_2030097_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002294988.1|2030204_2030492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296584.1|2030618_2031263_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	50.8	7.9e-49
WP_002292782.1|2031322_2032030_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296583.1|2032790_2033024_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_002296582.1|2033140_2034025_-	ROK family protein	NA	NA	NA	NA	NA
WP_002296580.1|2034109_2034577_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010725912.1|2034760_2035057_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	3.0e-19
WP_002292789.1|2035191_2035368_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_002289003.1|2035380_2036682_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002289004.1|2036778_2037009_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_002289005.1|2037476_2037899_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_002289006.1|2037912_2039319_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_002292792.1|2039341_2040244_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_002289008.1|2040257_2041814_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_002296436.1|2041836_2042379_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_002289010.1|2042365_2042890_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_002289011.1|2042980_2043196_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_002289012.1|2043248_2043968_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002292799.1|2044269_2044734_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.5	1.0e-45
WP_002312230.1|2044755_2047113_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.8e-98
WP_002289016.1|2047115_2047862_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002289017.1|2047973_2048210_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002296443.1|2048327_2048606_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002326761.1|2049970_2050879_+	purine nucleosidase	NA	NA	NA	NA	NA
WP_002287522.1|2051040_2051445_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|2051461_2052610_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002289479.1|2052839_2053415_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002286097.1|2053483_2054437_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	2118138	2123811	2805984	portal,capsid,tail,head,terminase	uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_002296483.1|2118138_2118474_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|2118460_2118745_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|2118800_2120324_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|2120316_2121492_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|2121495_2121681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296487.1|2121646_2123341_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002296488.1|2123337_2123811_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
>prophage 14
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	2130626	2191695	2805984	transposase,integrase,tRNA	Lactococcus_phage(30.77%)	60	2170224:2170240	2199863:2199879
WP_002296502.1|2130626_2131772_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_002340438.1|2132028_2133078_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_002340437.1|2133341_2133656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340436.1|2133732_2134227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340435.1|2134219_2134534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320995.1|2134555_2135893_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_002320996.1|2135877_2136375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320997.1|2136523_2136862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340434.1|2136865_2137051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340433.1|2137064_2139755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340432.1|2139741_2139960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321404.1|2139952_2140918_-	hypothetical protein	NA	A0A1P8BL54	Lactococcus_phage	34.8	1.2e-13
WP_002321406.1|2141107_2141392_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002340430.1|2141404_2141632_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111230898.1|2141534_2141765_+	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_002321408.1|2141766_2142531_+	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	43.4	4.9e-13
WP_002340429.1|2142581_2143727_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	35.4	1.9e-61
WP_002290887.1|2143799_2144105_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296503.1|2144129_2144561_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290885.1|2144557_2144824_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296505.1|2145078_2145804_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002289867.1|2146351_2147104_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002289868.1|2147119_2147599_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002296509.1|2147849_2149430_-	ABC transporter	NA	NA	NA	NA	NA
WP_002287741.1|2149422_2150166_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_000202380.1|2150643_2151963_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_105468459.1|2152157_2152802_-	response regulator	NA	NA	NA	NA	NA
WP_002287743.1|2153049_2153886_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287744.1|2153896_2154826_-	permease	NA	NA	NA	NA	NA
WP_002287745.1|2155017_2155371_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287746.1|2155444_2156101_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287747.1|2156326_2158261_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002321414.1|2158346_2159570_-	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_002321415.1|2159563_2161462_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002287753.1|2161455_2162574_-	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_002287754.1|2162656_2163490_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287755.1|2163482_2164400_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287756.1|2164422_2164602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287757.1|2164626_2165751_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002287759.1|2166984_2168598_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000222572.1|2169248_2170202_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
2170224:2170240	attL	AAAAATAAAATTTTATT	NA	NA	NA	NA
WP_002289406.1|2170235_2171465_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2171466_2172384_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2172387_2173125_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2173215_2173743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2173922_2174516_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2174619_2175105_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2175257_2175455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2175549_2177310_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2177306_2179037_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2179429_2179642_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2179643_2181323_+	ribonuclease J	NA	NA	NA	NA	NA
WP_073119932.1|2181333_2181618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294067.1|2181576_2181777_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_001092058.1|2182304_2182967_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024378353.1|2184212_2184575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094467217.1|2185504_2187472_-	ABC-F type ribosomal protection protein OptrA	NA	A0A2K9L3Z8	Tupanvirus	28.5	1.8e-51
WP_002360186.1|2187803_2188958_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361059.1|2189418_2189796_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001557544.1|2189802_2191695_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2199863:2199879	attR	AATAAAATTTTATTTTT	NA	NA	NA	NA
>prophage 15
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	2276286	2284465	2805984	transposase,tRNA	Planktothrix_phage(33.33%)	8	NA	NA
WP_002297218.1|2276286_2277582_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289325.1|2277671_2279681_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-96
WP_002289337.1|2279948_2280227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289327.1|2280323_2281145_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.8	2.7e-25
WP_071974456.1|2281137_2281326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289328.1|2281429_2282440_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	40.8	2.8e-56
WP_002289330.1|2282451_2283405_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	3.0e-20
WP_002289332.1|2283394_2284465_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.5e-20
>prophage 16
NZ_CP040368	Enterococcus faecium strain VB3240 chromosome, complete genome	2805984	2372378	2405830	2805984	transposase,bacteriocin,protease	uncultured_virus(15.38%)	32	NA	NA
WP_002296840.1|2372378_2373566_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288864.1|2373978_2375604_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_002288862.1|2375654_2375939_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2376163_2376826_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002288858.1|2376901_2378194_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288856.1|2378363_2378993_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2379095_2379905_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288853.1|2379959_2380829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2380829_2382146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288851.1|2382142_2383978_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288850.1|2383982_2384687_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002288847.1|2384876_2385737_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	2.7e-12
WP_002322652.1|2385723_2386293_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|2386922_2387876_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002321654.1|2387872_2388019_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002287810.1|2388122_2388434_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002304799.1|2388435_2388633_-	enterocin	NA	NA	NA	NA	NA
WP_002287807.1|2389026_2390754_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002287805.1|2390746_2391940_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287801.1|2392126_2392771_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002304795.1|2392718_2392910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290587.1|2392864_2392999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287799.1|2393000_2395133_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002287797.1|2395129_2395603_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287795.1|2396003_2396228_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287793.1|2396386_2398546_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287792.1|2398595_2399561_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287791.1|2399649_2400789_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287788.1|2401097_2401811_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287787.1|2402064_2402766_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002290558.1|2402999_2404532_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002295743.1|2404921_2405830_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	258646	3393	61918	258646	transposase,protease	Streptococcus_phage(33.33%)	52	NA	NA
WP_002297404.1|3393_4644_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295673.1|5053_5293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295672.1|5359_5569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002336710.1|5628_6300_+	class A sortase	NA	NA	NA	NA	NA
WP_010729784.1|6352_8329_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_010729785.1|8341_9097_+	class C sortase	NA	NA	NA	NA	NA
WP_002350398.1|9093_9918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343441.1|9927_10176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025481135.1|10206_12318_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002350400.1|12355_14413_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002296354.1|14526_14739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296355.1|14925_15393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321279.1|15389_15632_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002296358.1|15649_15952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729787.1|16023_18078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086322090.1|18077_20690_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302858.1|20686_23065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|23125_23668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|23745_24078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|24078_24672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065305674.1|24693_26388_+	ATPase	NA	NA	NA	NA	NA
WP_002305175.1|26655_26889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305177.1|27075_28953_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.3	9.1e-29
WP_002296365.1|29460_30666_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	42.4	2.5e-32
WP_002296371.1|30681_31326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729790.1|31336_32143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313120.1|32164_32395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002325546.1|32940_33216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330592.1|33257_33680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|35364_36045_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_086968564.1|36155_37296_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_002304891.1|39759_40155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319817.1|40871_41552_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_025189010.1|43067_43460_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_099137877.1|43460_44828_+	APH(2'')-Ia/If/Ih family aminoglycoside O-phosphotransferase	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	2.5e-270
WP_025189010.1|44808_45201_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_001028141.1|45201_46641_+	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_002354485.1|47101_47788_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002296127.1|48527_50075_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|50176_50530_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|50519_50714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119839.1|50792_52298_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.6e-44
WP_002287659.1|52399_52753_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|52742_52937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|54386_55073_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002305788.1|55614_55884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296377.1|56115_56412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729773.1|56413_56836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296379.1|56854_58447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|58948_60090_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_002322479.1|60337_60532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|60667_61918_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 2
NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	258646	71027	105299	258646	transposase,bacteriocin,integrase,holin	Bacillus_phage(30.0%)	38	78414:78429	90166:90181
WP_002295624.1|71027_71150_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|71339_71564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|72006_72213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|72212_72464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|72644_72917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729363.1|73145_73346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138222779.1|73361_73553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|73598_73955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125276106.1|73999_74278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|74923_75877_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|75997_76261_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|76632_77811_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300833.1|78198_80145_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
78414:78429	attL	TTTGATTTCATCGGTA	NA	NA	NA	NA
WP_002300835.1|80147_80603_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|80616_81945_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|81978_82263_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|82264_82780_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|82795_83458_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|83464_84037_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|84223_85744_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|85986_86172_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|86155_86338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|87291_87891_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|87954_88554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|89566_90439_-	ROK family protein	NA	NA	NA	NA	NA
90166:90181	attR	TACCGATGAAATCAAA	NA	NA	NA	NA
WP_002326691.1|90686_91766_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	36.2	9.2e-50
WP_002352509.1|92092_94039_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|94223_95663_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|95664_96627_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|96796_98223_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|98465_98921_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002325009.1|98941_99175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289255.1|99506_99737_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|99966_100785_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|100945_101635_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|101648_103151_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|103163_103640_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|104136_105299_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 3
NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	258646	129526	183440	258646	transposase,integrase	Streptococcus_phage(40.91%)	51	128166:128183	176288:176305
128166:128183	attL	GTATCAAAAACAATCGAT	NA	NA	NA	NA
WP_002290382.1|129526_130000_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002290383.1|130172_130727_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002300314.1|131199_132369_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002319325.1|133388_134006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319817.1|134067_134748_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002311006.1|135069_135291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008271463.1|135388_135634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002344895.1|136857_137859_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_002344896.1|138017_138284_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344897.1|138273_138630_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044383156.1|138921_139602_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_002292681.1|140231_140780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|140780_141638_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|141922_142210_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|142199_142529_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_060811670.1|142677_143358_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	95.1	6.7e-123
WP_060811653.1|145792_146665_-	ROK family protein	NA	NA	NA	NA	NA
WP_002322556.1|146681_148154_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_002313079.1|148167_149016_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002322555.1|149012_149879_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002322554.1|149921_151280_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010729506.1|151374_152346_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_002313084.1|153380_153986_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_002348862.1|155104_155314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301399.1|155374_156334_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.0e-31
WP_002295743.1|156883_157792_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_010729753.1|157850_159653_-	exonuclease DNA polymerase III epsilon subunit	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_002342384.1|159715_160558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331328.1|160573_160795_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002354485.1|161284_161971_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002339142.1|162028_163249_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002339141.1|163268_163880_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002350224.1|163922_164855_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002350223.1|165275_166136_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002297218.1|166474_167770_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_096157801.1|167795_168476_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.0	2.1e-116
WP_002298077.1|168723_170124_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002296840.1|170658_171846_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288620.1|171903_173145_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010729750.1|173180_173891_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288615.1|173958_174774_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_002336724.1|174784_175753_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729749.1|176515_177808_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
176288:176305	attR	ATCGATTGTTTTTGATAC	NA	NA	NA	NA
WP_002285758.1|177886_178081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|178070_178424_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|178525_180073_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002302440.1|180301_181603_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002389879.1|181781_182051_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_086322080.1|182040_182379_-	antitoxin	NA	NA	NA	NA	NA
WP_077974475.1|182375_182603_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_010729807.1|182807_183440_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
>prophage 4
NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	258646	192453	243185	258646	transposase	Streptococcus_phage(37.5%)	56	NA	NA
WP_002295743.1|192453_193362_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002299197.1|193577_194189_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002299198.1|194261_195191_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	23.3	1.1e-06
WP_074394709.1|195348_196086_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_010729801.1|196133_197312_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	2.7e-23
WP_080114943.1|197538_197940_+	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
WP_002301682.1|199902_200712_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002301683.1|200711_201458_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301684.1|201475_201943_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301685.1|201942_202353_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301686.1|202363_203377_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729798.1|203593_204328_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729797.1|204311_205022_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086322086.1|205069_205756_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_002299575.1|205944_206529_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_002299573.1|206739_206943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288787.1|206952_207375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|208325_208676_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002287514.1|208669_208933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305761.1|209273_209453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330566.1|209468_209669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353391.1|209833_210541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296237.1|210533_210971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|210985_211237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296239.1|211236_211443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002369675.1|211711_211906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296240.1|211883_212144_-	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296241.1|212509_212995_-	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.9	3.4e-44
WP_002322787.1|212997_213897_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002330563.1|213912_214506_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025481136.1|214744_216949_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	51.1	2.1e-117
WP_138222783.1|216959_218420_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_001015311.1|219548_220229_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002300494.1|220301_221621_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|221617_222271_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002349129.1|222332_222473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348630.1|222980_223697_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002302256.1|223746_223956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|225612_226644_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|226650_227481_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302265.1|227477_228284_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|228289_229114_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002302268.1|229103_230204_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|230381_231167_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|231199_231583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|231658_231790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|231758_231995_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_077828693.1|232006_232174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302275.1|232072_233044_-	radical SAM protein	NA	NA	NA	NA	NA
WP_049062967.1|233695_235318_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.9e-125
WP_002301195.1|235603_236980_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|236979_237636_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|237645_238923_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|239172_240334_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_010706480.1|240968_241319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014125696.1|242498_243185_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
