The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	63156	141365	4615193	tail,head,tRNA,protease,transposase,capsid,plate	Escherichia_phage(51.79%)	86	NA	NA
WP_079849187.1|63156_63681_-	DNA-binding protein	NA	A0A0C4UQZ2	Shigella_phage	89.7	3.1e-83
WP_062880730.1|63872_64088_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	98.6	4.5e-33
WP_079849188.1|64095_66084_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	99.8	0.0e+00
WP_001026707.1|66122_67061_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	97.8	3.8e-169
WP_000968312.1|67076_67304_+	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_021537265.1|67306_67537_+	hypothetical protein	NA	A0A0C4UQZ4	Shigella_phage	98.7	5.3e-40
WP_021526002.1|67548_67818_+	hypothetical protein	NA	C9DGL5	Escherichia_phage	32.6	5.0e-05
WP_001101153.1|67838_68258_+	hypothetical protein	NA	C9DGL6	Escherichia_phage	100.0	1.5e-77
WP_000225079.1|68258_68558_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	100.0	9.6e-50
WP_001107930.1|68577_69102_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_001621839.1|69200_69731_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	94.9	1.4e-96
WP_079849189.1|69730_70255_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	92.2	1.6e-87
WP_001621843.1|70251_70920_+	hypothetical protein	NA	Q71T76	Escherichia_phage	64.6	2.6e-79
WP_079849190.1|70922_71264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024193941.1|71337_71889_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	98.9	2.6e-101
WP_000133852.1|71885_72275_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	100.0	3.5e-68
WP_000515809.1|72352_72583_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	98.7	6.3e-41
WP_001163385.1|72695_73118_+	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	100.0	1.3e-76
WP_000907404.1|73212_73728_+	lysozyme	NA	C9DGM9	Escherichia_phage	100.0	6.4e-94
WP_001438579.1|73711_74098_+	hypothetical protein	NA	C9DGN0	Escherichia_phage	98.4	4.4e-63
WP_079849191.1|74256_74451_+	hypothetical protein	NA	C9DGN1	Escherichia_phage	98.4	5.3e-33
WP_000364295.1|74450_74750_+	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_000606409.1|74746_75037_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000375394.1|75048_75624_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_021526013.1|75631_77287_+	hypothetical protein	NA	C9DGN5	Escherichia_phage	99.8	0.0e+00
WP_079849192.1|77286_78825_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.6	4.2e-298
WP_079849193.1|78805_80125_+|capsid	minor capsid protein	capsid	C9DGN7	Escherichia_phage	98.4	4.0e-249
WP_079849194.1|80121_80592_+	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	98.7	3.2e-84
WP_079849195.1|80788_81874_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	98.3	1.5e-193
WP_047660771.1|81870_82788_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	97.7	2.4e-176
WP_021537253.1|82854_83265_+	hypothetical protein	NA	A0A0C4UQZ0	Shigella_phage	97.1	5.2e-62
WP_001104972.1|83261_83687_+	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	100.0	4.2e-75
WP_000888927.1|83686_84235_+	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	100.0	1.1e-104
WP_001409561.1|84221_84425_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	98.5	6.3e-29
WP_079849196.1|84421_85909_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	99.4	5.0e-280
WP_000918404.1|85918_86275_+|tail	tail protein	tail	C9DGP8	Escherichia_phage	100.0	2.4e-63
WP_000344073.1|86284_86719_+	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_079849197.1|86863_88936_+	tape measure protein	NA	C9DGQ1	Escherichia_phage	97.4	0.0e+00
WP_079849198.1|88940_90428_+	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	99.4	1.4e-242
WP_042023636.1|90420_91560_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	99.5	1.5e-212
WP_000442748.1|91547_92141_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000130548.1|92137_92575_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_021555077.1|92575_93658_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	99.7	4.1e-207
WP_079849199.1|93648_94191_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	8.3e-100
WP_079849200.1|94190_95726_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	49.9	5.8e-114
WP_001164136.1|95741_96269_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.1	4.2e-72
WP_001721526.1|96299_96833_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.6	1.1e-67
WP_064750559.1|96836_97541_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	92.7	1.1e-123
WP_000905066.1|97777_98371_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	100.0	2.6e-107
WP_001300256.1|98453_98642_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_116733528.1|98592_99300_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	98.3	4.8e-132
WP_016024192.1|99344_99791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113551.1|99988_101473_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_001131798.1|101535_102396_+	class II aldolase	NA	NA	NA	NA	NA
WP_000621026.1|102405_102675_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001274837.1|102765_103089_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217952.1|103072_103432_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001004800.1|103647_104841_+	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
WP_001270481.1|104900_106283_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.7	2.0e-41
WP_000824213.1|106388_106682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001252669.1|106878_109677_+	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000214106.1|109895_110321_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001284295.1|110331_110817_+	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000380259.1|110962_111712_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001526325.1|111708_112569_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000188472.1|112572_113682_+	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_001186150.1|113668_114412_+	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000749540.1|114647_115589_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
WP_000535970.1|115631_116534_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000392700.1|117039_117735_+	MgtC family protein	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
WP_000131296.1|117953_120680_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.2e-34
WP_001082118.1|120701_120794_+	protein MgtR	NA	NA	NA	NA	NA
WP_001065322.1|120994_121474_+	membrane protein	NA	NA	NA	NA	NA
WP_000106461.1|121641_122322_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_001541135.1|122941_123055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278063.1|123107_123965_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_023213975.1|123975_124440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001143050.1|124534_127387_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	43.9	5.5e-94
WP_000984806.1|127461_128079_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000834258.1|130089_131472_+	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_000703007.1|131483_133802_+	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000766639.1|133904_135614_-	AsmA family protein	NA	NA	NA	NA	NA
WP_000115428.1|135734_137126_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
WP_000462249.1|137353_138559_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000016744.1|138594_140676_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_023892454.1|140681_141365_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	1150233	1214864	4615193	plate,head,tail,lysis,tRNA,portal,terminase,capsid,integrase	Salmonella_phage(88.89%)	65	1151678:1151724	1185877:1185923
WP_000113811.1|1150233_1151475_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.1	8.5e-100
1151678:1151724	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_006493480.1|1151839_1153066_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
WP_006493482.1|1153072_1154089_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
WP_023136550.1|1154090_1154723_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_000102106.1|1154842_1155085_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_006493486.1|1155117_1155627_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000794278.1|1155713_1155989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528723.1|1156073_1156268_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000963476.1|1156231_1156573_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001178763.1|1156640_1156868_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000785514.1|1156867_1157095_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_006493488.1|1157091_1157949_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
WP_006493489.1|1157945_1160339_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
WP_001749759.1|1160358_1160586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749760.1|1160723_1160912_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_006493490.1|1161242_1162445_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
WP_006493491.1|1162407_1163325_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_006493493.1|1163371_1164406_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
WP_006493495.1|1164405_1166172_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_006493498.1|1166314_1167148_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
WP_000730754.1|1167164_1168232_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_000059169.1|1168235_1168886_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000673541.1|1168979_1169444_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1169443_1169647_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1169650_1169866_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_006493502.1|1169846_1170356_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_000871620.1|1170360_1170735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1170731_1171160_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039964.1|1171255_1171687_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_000343939.1|1171679_1172126_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
WP_000993750.1|1172194_1172773_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_006493507.1|1172769_1173129_+|plate	baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
WP_006493508.1|1173115_1174024_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
WP_001086802.1|1174016_1174622_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
WP_045791118.1|1174618_1176193_+|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	3.3e-157
WP_006501158.1|1176162_1176780_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
WP_001287104.1|1176783_1177191_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_077918804.1|1177197_1178277_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	91.8	1.2e-182
WP_006501163.1|1178246_1178804_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
WP_006501164.1|1178906_1180079_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_001207653.1|1180088_1180604_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280962.1|1180658_1180961_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1180975_1181095_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_006501165.1|1181087_1183895_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
WP_000980409.1|1183891_1184377_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_006501166.1|1184373_1185474_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
WP_000980498.1|1185542_1185761_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101562.1|1186312_1187476_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1185877:1185923	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196152.1|1187483_1189664_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533851.1|1189660_1191070_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001128838.1|1191134_1202609_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1203223_1203706_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|1203855_1204332_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1204321_1204612_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1204773_1205112_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1205260_1206922_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1207007_1207886_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1208008_1208599_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287933.1|1208633_1209239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1209359_1210646_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1210665_1211457_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1211622_1212984_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1213236_1213485_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1213503_1214052_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1214096_1214864_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	1708217	1717388	4615193	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1708217_1709165_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1709148_1709880_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1709860_1709968_-	protein YohO	NA	NA	NA	NA	NA
WP_001240416.1|1710027_1710759_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1710981_1712667_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1712663_1713383_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1713429_1713897_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001221799.1|1713953_1714484_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1714655_1715114_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_000195336.1|1715354_1717388_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	1874562	1881829	4615193		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1874562_1874982_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457654.1|1874984_1876253_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
WP_000208509.1|1876707_1876920_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1876930_1877119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080686.1|1877377_1878589_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	2.6e-109
WP_000107430.1|1879238_1879538_+	membrane protein	NA	NA	NA	NA	NA
WP_000377052.1|1879629_1880325_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
WP_001157316.1|1880398_1881829_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	2160116	2167017	4615193		Salmonella_phage(28.57%)	11	NA	NA
WP_000230462.1|2160116_2160923_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2160924_2161917_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146139.1|2161916_2162807_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001543117.1|2162930_2163332_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	8.4e-33
WP_001135892.1|2163297_2163471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551817.1|2163711_2164599_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	37.7	2.1e-36
WP_001557003.1|2164904_2165078_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	80.6	4.9e-22
WP_001605117.1|2165493_2165634_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
WP_001640522.1|2165672_2165972_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	8.5e-14
WP_000727929.1|2165898_2166324_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|2166702_2167017_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 6
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	2617887	2632169	4615193	tail	Escherichia_phage(50.0%)	18	NA	NA
WP_000497452.1|2617887_2618127_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	2.5e-32
WP_001036547.1|2618344_2618509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2619006_2619816_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2619888_2620266_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158844.1|2620413_2620956_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	8.1e-71
WP_000733298.1|2621148_2621877_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
WP_000275698.1|2621893_2622307_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
WP_000917275.1|2623356_2624481_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_072102280.1|2624927_2625092_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	9.6e-20
WP_000557907.1|2625325_2626159_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905000.1|2626265_2626820_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
WP_001115580.1|2626849_2627368_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.9	2.9e-54
WP_001008237.1|2627941_2628385_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	99.3	1.8e-81
WP_071585783.1|2628405_2628810_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.0	2.4e-64
WP_001130332.1|2628758_2629220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180571.1|2629194_2629659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340437.1|2630180_2630795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444505.1|2630918_2632169_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 7
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	3012346	3051941	4615193	holin,lysis,coat,portal,terminase,protease,integrase	Salmonella_phage(61.82%)	56	3011995:3012016	3052007:3052028
3011995:3012016	attL	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
WP_031624840.1|3012346_3013600_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.8	1.1e-19
WP_000129926.1|3013663_3015415_-	hypothetical protein	NA	I6S5Y0	Salmonella_phage	88.3	3.0e-58
WP_024134398.1|3015654_3015984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029862.1|3016001_3017894_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	78.3	5.1e-245
WP_000246970.1|3017893_3019294_-	phage DNA ejection protein	NA	A0A192Y834	Salmonella_phage	91.8	5.8e-222
WP_000964862.1|3019304_3019997_-	hypothetical protein	NA	A0A0M4RTU3	Salmonella_phage	95.7	2.9e-105
WP_000627696.1|3019999_3020455_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	6.7e-87
WP_000774918.1|3020454_3021093_-	hypothetical protein	NA	A0A088CPT1	Enterobacteria_phage	99.1	7.0e-90
WP_001122421.1|3021096_3022515_-	Packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	97.7	6.2e-272
WP_001166104.1|3022474_3022975_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	98.2	3.6e-89
WP_000538678.1|3022958_3023519_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.4	4.1e-102
WP_001196934.1|3023559_3024852_-|coat	coat protein	coat	I1TEI8	Salmonella_phage	98.8	8.8e-241
WP_000433853.1|3024842_3025763_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	3.8e-161
WP_000774654.1|3025776_3027954_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.5	0.0e+00
WP_000417856.1|3027953_3029453_-|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	99.6	1.4e-306
WP_000729924.1|3029430_3029919_-	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_000013071.1|3029922_3030327_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	1.5e-66
WP_000807788.1|3030329_3030572_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000681556.1|3030875_3031565_-	hypothetical protein	NA	Q5G8R0	Enterobacteria_phage	99.6	4.2e-125
WP_000086778.1|3031782_3032220_-|lysis	lysis protein	lysis	A0A0N6WGE8	Salmonella_phage	97.2	2.9e-71
WP_001167373.1|3032216_3032654_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	99.3	2.5e-75
WP_000738703.1|3032637_3032964_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001047574.1|3033669_3034434_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	98.4	9.4e-142
WP_000286960.1|3034430_3034613_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	1.8e-22
WP_001185534.1|3034600_3035071_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	93.6	7.7e-86
WP_001089627.1|3035051_3035288_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	94.9	4.3e-37
WP_000950998.1|3035280_3035457_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_000924596.1|3035449_3035851_-	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_001254236.1|3035853_3036030_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_001154848.1|3036037_3036460_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	100.0	3.7e-79
WP_086009405.1|3036665_3036872_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	83.0	1.6e-19
WP_000975822.1|3036946_3037102_-	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	100.0	2.4e-20
WP_000248683.1|3037113_3037320_-	hypothetical protein	NA	A0A2H4FS13	Salmonella_phage	100.0	5.3e-31
WP_001556003.1|3037396_3039277_-	bifunctional DNA primase/helicase	NA	Q5G8S8	Enterobacteria_phage	98.4	0.0e+00
WP_108629566.1|3039384_3040041_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	53.9	3.6e-57
WP_000424136.1|3040203_3040494_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	9.0e-45
WP_001180316.1|3040630_3040858_-	transcriptional regulator	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|3040935_3041646_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_000434354.1|3041699_3042572_+	hypothetical protein	NA	I6NRL3	Burkholderia_virus	28.8	1.3e-22
WP_000834176.1|3042715_3042919_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	5.9e-27
WP_000198434.1|3043297_3043660_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	93.3	7.5e-57
WP_001083251.1|3043738_3044239_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	41.9	6.4e-30
WP_000394581.1|3044272_3044581_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	72.9	2.2e-33
WP_000141641.1|3044899_3045058_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3045038_3045227_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902090.1|3045216_3045360_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	9.3e-19
WP_001046984.1|3045356_3046064_+	recombinase	NA	I6R0N0	Salmonella_phage	98.3	4.2e-136
WP_001111292.1|3046394_3046688_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	97.9	8.8e-48
WP_001214770.1|3046698_3046869_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_000665850.1|3046865_3047558_+	HNH endonuclease	NA	C6ZR31	Salmonella_phage	96.0	4.0e-123
WP_000022453.1|3047554_3047956_+	hypothetical protein	NA	S4TTI6	Salmonella_phage	94.7	6.8e-67
WP_000155887.1|3047952_3048375_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	53.2	2.0e-37
WP_000582224.1|3048374_3049130_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_000509169.1|3050085_3050352_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_001556007.1|3050674_3050893_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3050870_3051941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3052007:3052028	attR	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
>prophage 8
NZ_CP040380	Salmonella enterica strain OSF005645 chromosome, complete genome	4615193	3521416	3582290	4615193	plate,protease,tRNA,transposase	Saccharomonospora_phage(22.22%)	54	NA	NA
WP_000118730.1|3521416_3522760_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001045934.1|3522763_3523300_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119439.1|3523366_3523852_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_079849240.1|3523994_3524378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081549.1|3524362_3524848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312803.1|3525141_3525627_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077905981.1|3525880_3526213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013884.1|3526513_3528022_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996815.1|3528045_3528588_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000175471.1|3528649_3528940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449780.1|3529025_3531689_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.2e-77
WP_000806697.1|3532056_3532959_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750536.1|3532945_3533770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108008.1|3533766_3534261_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371485.1|3534276_3536160_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145238.1|3536156_3537152_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367618.1|3537162_3538212_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001562201.1|3538742_3539474_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	9.9e-40
WP_000917872.1|3539537_3540005_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|3540001_3540724_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052773.1|3540758_3541514_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3541585_3542953_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207221.1|3543008_3543779_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|3543856_3544657_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127559.1|3544788_3545964_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648538.1|3546068_3546983_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154880.1|3547003_3547807_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	3.0e-37
WP_000502119.1|3548044_3548503_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001140160.1|3554462_3555029_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594021.1|3555218_3556250_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001287486.1|3556242_3556896_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874215.1|3556934_3557750_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|3557868_3558273_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093989.1|3558269_3558977_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260672.1|3559087_3560806_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000252581.1|3560879_3561581_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560524.1|3561612_3562035_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185319.1|3562031_3562577_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_001518678.1|3562774_3562975_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062330.1|3562961_3563222_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000210068.1|3563305_3564598_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901088.1|3564660_3565050_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021042.1|3565105_3567247_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000524168.1|3567322_3569086_-	chitinase	NA	NA	NA	NA	NA
WP_000055753.1|3569264_3570224_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294832.1|3570236_3573719_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000569411.1|3573742_3574339_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	4.3e-25
WP_000741216.1|3574335_3575484_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565950.1|3575483_3576272_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|3576275_3576731_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139265.1|3576836_3577862_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758966.1|3577865_3578351_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240931.1|3578473_3580906_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000949017.1|3580937_3582290_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
