The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	244946	310279	4908183	protease,transposase,plate,tRNA	uncultured_Mediterranean_phage(10.0%)	55	NA	NA
WP_000753958.1|244946_246374_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
WP_000929420.1|246526_247684_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272193.1|247772_248159_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000017194.1|248405_249707_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001186673.1|249743_250568_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094519.1|250597_253270_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018214.1|253506_254301_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246886.1|254751_255477_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000808106.1|255734_256586_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224567.1|256730_257456_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622423.1|257602_258160_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811905.1|258300_259497_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000947413.1|259809_260568_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
WP_000922422.1|260580_261438_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000949017.1|261449_262802_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240935.1|262833_265248_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758966.1|265370_265856_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139265.1|265859_266885_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|266990_267446_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565950.1|267449_268238_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000741212.1|268237_269386_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569412.1|269382_269979_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_001294826.1|270002_273485_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055753.1|273497_274457_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000502119.1|274651_275110_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000524168.1|275348_277112_+	chitinase	NA	NA	NA	NA	NA
WP_001021054.1|277187_279329_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901088.1|279384_279774_+	VOC family protein	NA	NA	NA	NA	NA
WP_000210056.1|279836_281129_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062330.1|281212_281473_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000955207.1|281459_281678_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185319.1|281857_282403_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000560527.1|282399_282822_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000252573.1|282853_283555_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260683.1|283628_285347_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000093986.1|285457_286165_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202315.1|286161_286566_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874215.1|286684_287500_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001287486.1|287538_288192_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594021.1|288184_289216_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001051726.1|289405_289972_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000154871.1|296231_297035_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_000648534.1|297055_297970_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127538.1|298074_299250_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230968.1|299381_300182_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207224.1|300259_301030_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644706.1|301085_302453_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052775.1|302524_303280_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801238.1|303314_304037_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|304033_304501_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|304564_305296_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000367626.1|305827_306883_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000145244.1|306893_307889_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371508.1|307885_309769_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108007.1|309784_310279_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	364924	408610	4908183	tail,integrase,terminase,portal,lysis	Salmonella_phage(90.16%)	61	355694:355710	417201:417217
355694:355710	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|364924_365977_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366259_367363_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367374_368625_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_010835868.1|368830_369994_-|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	3.7e-230
WP_016048814.1|370223_370574_-	hypothetical protein	NA	A0A192Y649	Salmonella_phage	100.0	8.3e-61
WP_016048815.1|370644_371313_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	100.0	2.5e-130
WP_010835870.1|371316_371505_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	100.0	4.6e-26
WP_010835871.1|371627_371915_-	hypothetical protein	NA	A0A192Y6Q6	Salmonella_phage	100.0	4.3e-47
WP_010835872.1|371925_372219_-	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	100.0	1.9e-50
WP_016048817.1|372265_372550_-	sigma-70 family RNA polymerase sigma factor	NA	A0A192Y7Y0	Salmonella_phage	100.0	4.0e-45
WP_010835873.1|372549_373257_-	Recombination protein	NA	A0A192Y8X7	Salmonella_phage	100.0	1.1e-139
WP_010835874.1|373948_374314_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	100.0	3.6e-59
WP_023890943.1|374457_375036_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	100.0	8.8e-100
WP_016048819.1|375056_375440_-	hypothetical protein	NA	A0A192Y8Y8	Salmonella_phage	100.0	3.0e-64
WP_000834165.1|375771_375975_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	100.0	9.1e-28
WP_001532928.1|376013_377093_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_001104735.1|377226_377880_-	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	100.0	4.6e-129
WP_001059982.1|377989_378199_+	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_000424138.1|378332_378623_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_010835877.1|378791_379613_+	replication protein	NA	A0A192Y6S6	Salmonella_phage	100.0	5.2e-154
WP_016048822.1|379609_380986_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	100.0	1.5e-254
WP_000248681.1|381058_381265_+	hypothetical protein	NA	A0A192Y802	Salmonella_phage	100.0	1.1e-31
WP_016048823.1|381279_381477_+	hypothetical protein	NA	A0A192Y900	Salmonella_phage	100.0	3.4e-27
WP_023890942.1|381737_382001_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	100.0	8.2e-45
WP_016048826.1|382225_382663_+	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	100.0	1.3e-79
WP_023890941.1|382659_382833_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	98.2	2.0e-31
WP_016048827.1|382799_382976_+	NinE family protein	NA	A0A1V0E5I9	Salmonella_phage	100.0	4.6e-28
WP_016048828.1|382978_383320_+	DUF2591 family protein	NA	A0A192Y677	Salmonella_phage	100.0	1.2e-64
WP_010835878.1|383312_383489_+	protein ninF	NA	A0A192Y808	Salmonella_phage	100.0	6.7e-27
WP_010835879.1|383481_383751_+	hypothetical protein	NA	A0A192Y905	Salmonella_phage	100.0	1.6e-43
WP_000002244.1|383750_384041_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_016048829.1|384037_384433_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y6T7	Salmonella_phage	100.0	3.1e-72
WP_001287665.1|384429_384999_+	HNH endonuclease	NA	A0A192Y683	Salmonella_phage	100.0	1.1e-107
WP_000149880.1|384995_385199_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_016048830.1|385179_385359_+	hypothetical protein	NA	A0A192Y814	Salmonella_phage	100.0	7.1e-24
WP_000027541.1|385355_385874_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_000286100.1|386337_386541_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_023890940.1|386518_387016_+	lysozyme	NA	A0A192Y6U3	Salmonella_phage	100.0	3.8e-91
WP_010835883.1|387012_387480_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	100.0	1.0e-77
WP_016048832.1|387692_388379_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000808100.1|388689_388932_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_016048833.1|388934_389339_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	100.0	4.0e-67
WP_000729925.1|389342_389831_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_010835897.1|389808_391308_+|terminase	terminase large subunit	terminase	I1TEI5	Salmonella_phage	100.0	8.2e-307
WP_010835896.1|391308_393483_+|portal	portal protein	portal	I1TEI6	Salmonella_phage	100.0	0.0e+00
WP_000433852.1|393496_394408_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_010835895.1|394407_395700_+	protein Coat	NA	I1TEI8	Salmonella_phage	100.0	4.2e-243
WP_010835894.1|395738_395948_+	hypothetical protein	NA	I1TEI9	Salmonella_phage	100.0	2.8e-32
WP_010835893.1|395931_396432_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_010835892.1|396391_397810_+	Tail accessory protein	NA	I1TEJ1	Salmonella_phage	100.0	6.4e-277
WP_016048834.1|397813_398515_+	hypothetical protein	NA	I1TEJ2	Salmonella_phage	100.0	9.4e-72
WP_016048835.1|398514_398970_+	DUF2824 family protein	NA	I1TEJ3	Salmonella_phage	100.0	1.8e-87
WP_006819472.1|398972_399662_+	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	3.9e-94
WP_016048836.1|399704_401042_+	phage DNA ejection protein	NA	I1TEJ5	Salmonella_phage	100.0	1.4e-244
WP_016048837.1|401041_402973_+	hypothetical protein	NA	I1TEJ6	Salmonella_phage	100.0	0.0e+00
WP_071533035.1|403111_403405_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|403425_403674_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_016048838.1|403809_405813_+|tail	tailspike protein	tail	I1TEJ8	Salmonella_phage	100.0	0.0e+00
WP_016048812.1|405871_407329_-	O-antigen conversion translocase	NA	I1TED7	Salmonella_phage	100.0	5.8e-241
WP_016048813.1|407318_408251_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	100.0	5.5e-176
WP_000915523.1|408247_408610_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
417201:417217	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 3
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	1016590	1025322	4908183	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1016590_1017709_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1017705_1019652_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1019781_1020003_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1020326_1020647_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1020677_1022954_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1023145_1023604_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_085983316.1|1024066_1025322_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 4
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	1075406	1174214	4908183	protease,tail,integrase,terminase,portal,holin,lysis,tRNA	Salmonella_phage(42.11%)	102	1078315:1078334	1150102:1150121
WP_001154025.1|1075406_1076210_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1076202_1077525_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1077505_1078210_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1078209_1082676_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1078315:1078334	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1083020_1084862_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1085121_1085670_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1085697_1086345_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1086406_1087597_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1087781_1088873_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1089479_1090880_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1091080_1091542_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1091858_1093073_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1093317_1094754_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1094831_1096034_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1096228_1097521_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1097565_1097814_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1097854_1098094_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1098136_1099294_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1099256_1102142_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1102268_1102568_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1102589_1102748_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_077905303.1|1102740_1103001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1103050_1103461_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1103580_1103820_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1103785_1104160_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1104244_1105228_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1105230_1105980_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1105990_1106338_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1106334_1106646_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1106723_1107014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1107305_1107539_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1107650_1107872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1107954_1108557_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1108765_1109377_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1109373_1109520_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1109509_1110307_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1110373_1110691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1110864_1110990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1111125_1111575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1111935_1112622_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1112897_1113227_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1113210_1113663_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1113680_1114160_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1114367_1114901_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1114857_1116996_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1116992_1117199_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1117225_1118743_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1118666_1120748_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1120838_1121162_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1121154_1121454_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1121434_1122001_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1121997_1122399_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1122410_1123160_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1123205_1123604_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1123600_1123930_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077905305.1|1124009_1126997_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_000978296.1|1126993_1127326_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1127424_1127922_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1128038_1128572_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1128661_1129357_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1129366_1130104_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1130001_1130706_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1130777_1133225_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_031615525.1|1133203_1134127_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_000178849.1|1134165_1134408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1134461_1136900_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1136899_1137481_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1137956_1138925_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1139572_1140199_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1140267_1140567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1140551_1141238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1141508_1141700_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1142126_1144739_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1144946_1145957_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1146122_1146665_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1146661_1147771_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1147869_1149978_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1149990_1151898_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1150102:1150121	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1151912_1153166_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1153170_1154811_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1154807_1155371_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1155626_1155794_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1155893_1156412_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1156480_1158241_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1158426_1158879_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1158950_1160003_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1160359_1160869_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1161085_1161691_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1161677_1163831_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1163849_1164296_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1164419_1166474_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1166509_1166968_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1167062_1167725_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1167898_1168312_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1168356_1168674_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1168731_1169943_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1170157_1170706_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1170731_1171511_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1171559_1171841_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1171837_1172167_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1172253_1172913_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1173533_1174214_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	1962891	1969700	4908183	integrase,tail	Salmonella_phage(33.33%)	11	1957754:1957776	1967469:1967491
1957754:1957776	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1962891_1963773_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1964245_1964434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1964498_1964666_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1964922_1965456_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1965509_1965740_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1965929_1966424_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1966483_1967338_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1967711_1968065_-	YebY family protein	NA	NA	NA	NA	NA
1967469:1967491	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1968081_1968957_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1968957_1969332_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1969469_1969700_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	2045150	2123809	4908183	protease,head,tail,integrase,plate,terminase,portal,transposase,holin,capsid	Salmonella_phage(81.16%)	103	2051688:2051703	2125432:2125447
WP_000502119.1|2045150_2045609_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000659236.1|2045789_2046995_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2047073_2048561_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2048817_2050221_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2050235_2050643_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2050642_2051011_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2051082_2052567_+	alpha-amylase	NA	NA	NA	NA	NA
2051688:2051703	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2052606_2053032_-	lipoprotein	NA	NA	NA	NA	NA
WP_000790504.1|2054418_2054652_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2054916_2055303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2055422_2055737_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2055953_2057636_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2057628_2058624_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2058616_2059324_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_138020332.1|2059323_2060694_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2060715_2061159_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2061155_2062373_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2062477_2062945_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2062949_2063954_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2063950_2064364_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2064363_2064741_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2064740_2065478_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2065487_2065757_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2065765_2066560_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2066841_2067465_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2067503_2067752_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2067826_2068054_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2068363_2069179_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2069157_2070870_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2071034_2071280_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2071296_2072208_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2072383_2073304_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2073292_2073763_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2073743_2075174_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2075247_2075943_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2076034_2076334_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2076983_2078180_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2078440_2078629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2078639_2078852_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2079306_2080575_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2080577_2080997_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2081123_2081285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2082478_2082691_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2082687_2083101_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2083148_2083262_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2083336_2083570_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2083683_2084289_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2084258_2085821_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2085807_2086395_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2086397_2087477_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2087469_2087883_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2087887_2088421_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2088420_2089479_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2089475_2090816_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2090849_2092778_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2092862_2093156_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2093185_2093542_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2093541_2095038_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2095027_2095192_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2095195_2095756_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2095752_2096265_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2096236_2096641_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2096637_2096961_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2096963_2097164_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2097214_2098420_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2098434_2099085_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2099062_2100304_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2100303_2100486_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2100497_2102231_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2102227_2102722_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2102847_2103198_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2103248_2103581_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2104043_2104436_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2104432_2105047_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2105046_2105328_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2105314_2105701_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2105846_2106104_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2106254_2107007_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2107020_2108010_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2108017_2108878_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2108894_2109284_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2109280_2110174_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2110173_2110656_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2110657_2111476_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2111472_2111697_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2111693_2112851_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2112847_2113402_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2113430_2113655_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2113752_2114448_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2114653_2114992_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2114954_2115179_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2115718_2116090_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2116147_2116975_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2117111_2117651_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2117721_2118255_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2118256_2118514_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2118524_2119106_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2119109_2119679_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2119703_2119946_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2119947_2120937_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2121228_2122026_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024159751.1|2122397_2122688_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
WP_001219015.1|2123335_2123809_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2125432:2125447	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	2269341	2341327	4908183	head,tail,integrase,terminase,portal,holin,capsid,tRNA	Cronobacter_phage(54.05%)	73	2270853:2270874	2300860:2300881
WP_001517981.1|2269341_2270703_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.4	2.3e-207
2270853:2270874	attL	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
WP_033574042.1|2270984_2272307_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_058815650.1|2273367_2275068_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	5.4e-222
WP_000200789.1|2275070_2275616_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267956.1|2275587_2276313_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_058815646.1|2276302_2276857_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.5	1.2e-90
WP_138020336.1|2276869_2278975_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	68.8	2.6e-197
WP_001001828.1|2278984_2279572_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|2279564_2280749_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_023210885.1|2280745_2281075_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	73.3	2.2e-39
WP_023210886.1|2281071_2283039_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.6	8.3e-267
WP_000411500.1|2283226_2283484_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000376378.1|2283630_2283963_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_000175558.1|2283962_2284304_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154426.1|2284300_2284597_-|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000166745.1|2284609_2285065_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_033574048.1|2285061_2286189_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	1.8e-173
WP_033574049.1|2286185_2286890_-	phage protein	NA	F1BUL6	Cronobacter_phage	59.1	8.9e-70
WP_033574050.1|2286886_2287369_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	3.0e-37
WP_077917291.1|2287365_2287818_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	63.3	8.0e-48
WP_000505908.1|2287911_2288103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574052.1|2288121_2288820_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.0	2.3e-62
WP_033574053.1|2288830_2289850_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.5	5.5e-137
WP_033574054.1|2289884_2290703_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	1.4e-45
WP_033574055.1|2290846_2292631_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.4	1.9e-249
WP_033574056.1|2292627_2293647_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	7.9e-136
WP_033574057.1|2293646_2293976_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	58.2	1.5e-27
WP_033574064.1|2294021_2294993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574058.1|2295127_2297782_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	46.8	2.1e-241
WP_033574059.1|2298042_2298612_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	48.4	1.8e-44
WP_033574060.1|2298621_2298957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574061.1|2298953_2299229_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.4	5.2e-42
WP_033574062.1|2299346_2299646_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	86.9	3.9e-43
WP_033574063.1|2299761_2300775_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	89.3	3.2e-177
WP_010989041.1|2301160_2302207_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	75.2	1.6e-147
2300860:2300881	attR	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
WP_001669236.1|2302242_2302659_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_001542166.1|2302780_2303116_-	membrane protein	NA	NA	NA	NA	NA
WP_001273389.1|2303677_2304577_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_000129590.1|2304629_2305682_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858692.1|2305935_2307207_+	MFS transporter	NA	NA	NA	NA	NA
WP_000642793.1|2307203_2308208_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001012658.1|2308204_2309170_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434062.1|2309143_2309890_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001188957.1|2309925_2310726_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001182156.1|2310712_2311510_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000837534.1|2311919_2312234_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000765279.1|2312496_2313504_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945364.1|2313519_2316009_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000698773.1|2316022_2316706_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830686.1|2316761_2317292_-	fimbrial protein YehD	NA	NA	NA	NA	NA
WP_000760404.1|2317570_2317852_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005424.1|2318129_2319239_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000195332.1|2319403_2321437_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2321677_2322136_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2322307_2322838_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2322894_2323362_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2323408_2324128_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2324124_2325810_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2326032_2326764_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2326823_2326931_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2326911_2327643_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2327626_2328574_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_001278110.1|2328566_2329736_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000155869.1|2329739_2330657_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871560.1|2330837_2333135_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000095232.1|2333401_2335132_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000911555.1|2335189_2336137_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001017057.1|2336302_2336890_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_000930540.1|2337021_2337618_+	DedA family protein	NA	NA	NA	NA	NA
WP_000169608.1|2337666_2338428_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001081453.1|2338493_2339930_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000698460.1|2340247_2340331_+	protein YohP	NA	NA	NA	NA	NA
WP_001264832.1|2340388_2341327_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	2400626	2410932	4908183	holin,tail	Salmonella_phage(44.44%)	9	NA	NA
WP_000806401.1|2400626_2401130_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2401157_2401448_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_138020337.1|2402496_2403042_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.2e-11
WP_000554739.1|2403044_2404286_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2404878_2405208_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2405504_2406836_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2406864_2407233_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2407247_2408237_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2408565_2410932_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
>prophage 9
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	2751949	2854921	4908183	protease,head,tail,integrase,terminase,portal,transposase,holin,capsid,lysis,tRNA	Salmonella_phage(33.33%)	107	2778805:2778820	2850010:2850025
WP_000940032.1|2751949_2752681_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2752799_2753603_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2753747_2754626_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2754807_2755851_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2755854_2756673_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2756683_2757697_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2757697_2758684_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2758674_2759313_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2759438_2760716_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2760710_2761850_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2762045_2763299_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2763623_2764814_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2764995_2766540_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2766900_2768232_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2768314_2770459_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2770514_2771975_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2772023_2772362_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2772438_2773776_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2773772_2774537_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2774538_2775969_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000502119.1|2776684_2777143_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000970045.1|2777330_2781218_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2778805:2778820	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2781239_2781473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2781473_2783018_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2783068_2783620_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2783644_2784280_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2784283_2785645_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2785655_2786549_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2786664_2787513_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2787551_2788469_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2788490_2789687_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2789802_2790729_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2790766_2791027_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2791138_2791519_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2791518_2792250_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2792261_2792990_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2793001_2793907_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2793903_2794584_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2794857_2795832_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2795848_2797648_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_138020340.1|2798052_2799516_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	2.9e-248
WP_001542312.1|2800819_2800957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2801669_2801834_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2802413_2802479_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2802541_2802754_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2802860_2803088_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2803184_2803763_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2803752_2804577_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2804573_2806946_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2806999_2807242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2807280_2810643_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2810704_2811352_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2811249_2811987_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2811993_2812692_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2812701_2813031_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2813033_2816129_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2816100_2816439_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2816435_2816831_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2816881_2817628_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2817635_2818037_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2818145_2819276_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2819324_2819903_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2819930_2820314_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2820324_2820684_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2820741_2821770_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2821824_2822172_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2822184_2823681_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2823670_2825251_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2825247_2825451_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2825434_2827366_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2827337_2827883_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2828169_2828571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2828806_2829259_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2829276_2829729_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2829712_2830042_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2830317_2831004_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2831218_2831407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2831913_2832477_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2832749_2833427_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2833423_2833564_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2833560_2834172_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2834380_2834983_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2835017_2835266_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2835382_2835616_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2835858_2836491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2836598_2837297_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2837310_2838006_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2838002_2838887_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2838978_2839353_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2839312_2839555_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2839654_2840050_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2840108_2840948_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2840940_2841327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2841326_2841989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2842445_2842604_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2842625_2842976_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2843102_2846030_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001237031.1|2847193_2847433_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2847473_2847758_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2847735_2848965_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2849462_2849942_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2849938_2850895_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2850010:2850025	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2850894_2851545_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2851576_2852152_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2852148_2852313_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989191.1|2852576_2854199_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2854183_2854921_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP040318	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 chromosome, complete genome	4908183	4468658	4489078	4908183	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4468658_4469387_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4469583_4469874_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4470122_4470578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4470574_4471180_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4471184_4472930_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4472932_4473565_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4473557_4474673_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4474663_4475023_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4475186_4476734_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4476733_4477663_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4477659_4478022_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4478349_4479072_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4479081_4480125_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4480112_4480322_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4480321_4481275_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4481274_4483629_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4483725_4483854_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4483813_4484131_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4484182_4484707_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4484706_4486134_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4486123_4486321_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4486317_4486773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033566939.1|4486932_4487247_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	48.2	3.2e-19
WP_001270441.1|4487259_4487865_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4487867_4488155_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4488730_4489078_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP040319	Salmonella enterica subsp. enterica serovar Rough O:-:- strain PNCS009887 plasmid p11-0883.1, complete sequence	47477	14906	21494	47477		Escherichia_phage(33.33%)	9	NA	NA
WP_000633913.1|14906_15551_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103697.1|15779_16751_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000340829.1|16755_17148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457496.1|17152_18424_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|18423_18861_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|18857_19106_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_001302618.1|19523_20426_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032155763.1|20429_20735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086160.1|20810_21494_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
