The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038022	Acinetobacter radioresistens strain DD78 chromosome, complete genome	3009347	66876	76364	3009347		Tupanvirus(33.33%)	7	NA	NA
WP_138000391.1|66876_68052_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	49.3	4.6e-103
WP_005404727.1|68212_70087_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	26.2	3.6e-17
WP_101160977.1|70101_70980_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	4.5e-63
WP_005017373.1|70993_72259_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	E3SLH6	Synechococcus_phage	24.1	1.5e-11
WP_034675583.1|72255_73932_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_138000392.1|73924_74944_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	4.3e-81
WP_138000393.1|74990_76364_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.5	1.3e-29
>prophage 2
NZ_CP038022	Acinetobacter radioresistens strain DD78 chromosome, complete genome	3009347	899850	905076	3009347		Acinetobacter_phage(83.33%)	6	NA	NA
WP_034686146.1|899850_901209_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.2	4.4e-17
WP_171053875.1|901278_901827_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	96.2	4.0e-94
WP_005406118.1|901918_902608_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	76.4	1.5e-90
WP_101161532.1|902600_903425_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	84.3	2.1e-123
WP_005025217.1|903444_904491_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	87.0	3.7e-165
WP_171261063.1|904500_905076_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	91.1	6.5e-103
>prophage 3
NZ_CP038022	Acinetobacter radioresistens strain DD78 chromosome, complete genome	3009347	1007556	1048299	3009347	integrase,capsid,terminase	Acinetobacter_phage(55.0%)	57	1003248:1003261	1014362:1014375
1003248:1003261	attL	TTTATCGCCACTGT	NA	NA	NA	NA
WP_026444215.1|1007556_1008567_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	50.9	6.7e-87
WP_026444214.1|1008746_1009028_-	hypothetical protein	NA	A0A0R6PCX9	Moraxella_phage	39.5	1.4e-05
WP_138000587.1|1009027_1009381_-	hypothetical protein	NA	K4HZ79	Acinetobacter_phage	61.6	1.6e-32
WP_138000588.1|1009436_1009946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138000589.1|1010039_1010366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138000590.1|1010358_1010958_-	hypothetical protein	NA	A0A1J0MGM9	Acinetobacter_phage	34.4	1.4e-28
WP_075040180.1|1010967_1011192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138000591.1|1011264_1011888_-	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	95.2	4.9e-112
WP_138000592.1|1011868_1012732_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	56.7	2.5e-58
WP_138000593.1|1012742_1013762_-	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	34.7	6.7e-18
WP_138000594.1|1013771_1014128_-	hypothetical protein	NA	A0A2H4J365	uncultured_Caudovirales_phage	96.6	4.2e-60
WP_138000595.1|1014124_1014403_-	hypothetical protein	NA	NA	NA	NA	NA
1014362:1014375	attR	TTTATCGCCACTGT	NA	NA	NA	NA
WP_138000596.1|1014399_1014783_-	hypothetical protein	NA	A0A2H4J356	uncultured_Caudovirales_phage	95.3	6.7e-64
WP_138000597.1|1015040_1015490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138000598.1|1015452_1016334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171462105.1|1016477_1017137_-	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	64.4	6.6e-67
WP_075040170.1|1017251_1017452_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	69.7	2.0e-19
WP_026444203.1|1017460_1017736_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	79.5	2.0e-33
WP_138000600.1|1017901_1018798_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	60.2	7.5e-90
WP_026444201.1|1018794_1019544_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	68.9	3.1e-97
WP_101162187.1|1019737_1020121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138000601.1|1020117_1020312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034685746.1|1020322_1020568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138000602.1|1020564_1020909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138000969.1|1020905_1021163_+	hypothetical protein	NA	A0A2H4JB88	uncultured_Caudovirales_phage	58.2	8.4e-10
WP_075040254.1|1021218_1021587_+	DUF1064 domain-containing protein	NA	NA	NA	NA	NA
WP_138000603.1|1021602_1022043_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.7	3.0e-23
WP_138000604.1|1023273_1023495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138000605.1|1023569_1023806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171462106.1|1023808_1023982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138000606.1|1024017_1024605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138000607.1|1024579_1025833_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	53.6	1.7e-119
WP_138000608.1|1025832_1027248_+	DUF4055 domain-containing protein	NA	A0A1B1P9C6	Acinetobacter_phage	61.5	1.3e-168
WP_138000609.1|1027253_1028357_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	57.7	9.8e-116
WP_138000610.1|1028353_1028581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125824967.1|1028658_1029381_+	hypothetical protein	NA	A0A1B1P9C7	Acinetobacter_phage	70.0	2.9e-44
WP_138000611.1|1029390_1030410_+	hypothetical protein	NA	A0A1B1P9D0	Acinetobacter_phage	71.7	1.4e-137
WP_125824965.1|1030420_1030630_+	hypothetical protein	NA	A0A0R6PCI4	Moraxella_phage	77.0	8.0e-19
WP_138000612.1|1030640_1031024_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	53.5	2.4e-29
WP_125824963.1|1031031_1031397_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	66.4	1.8e-37
WP_138000970.1|1031396_1031774_+	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	44.9	3.8e-19
WP_138000613.1|1031775_1032174_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	50.8	5.1e-30
WP_138000614.1|1032239_1033160_+	hypothetical protein	NA	A0A1B1P9E0	Acinetobacter_phage	77.1	5.5e-136
WP_138000615.1|1033200_1033668_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	53.4	3.6e-35
WP_138000616.1|1033682_1033955_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	67.5	6.7e-26
WP_138000617.1|1034169_1034679_+	Rha family transcriptional regulator	NA	I6R9D7	Salmonella_phage	41.2	3.3e-18
WP_138000618.1|1034756_1035095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138000619.1|1035179_1035704_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	81.6	2.2e-81
WP_138000620.1|1036346_1040447_+	tape measure protein	NA	A0A220VZA0	Acinetobacter_phage	35.5	4.6e-102
WP_171462107.1|1040602_1040752_+	hypothetical protein	NA	A0A0P0HSS3	Acinetobacter_phage	71.4	2.3e-12
WP_138000621.1|1040803_1042015_+	hypothetical protein	NA	A0A2H4J3F5	uncultured_Caudovirales_phage	86.6	2.1e-207
WP_138000622.1|1042014_1042935_+	phage BR0599 family protein	NA	A0A2H4J350	uncultured_Caudovirales_phage	88.2	2.2e-153
WP_138000623.1|1042950_1046175_+	hypothetical protein	NA	A0A2H4J328	uncultured_Caudovirales_phage	58.7	0.0e+00
WP_138000624.1|1046167_1047055_+	LamG domain-containing protein	NA	A0A2H4J503	uncultured_Caudovirales_phage	65.2	2.6e-26
WP_138000625.1|1047124_1047451_+	hypothetical protein	NA	A0A2H4JB44	uncultured_Caudovirales_phage	89.8	1.2e-48
WP_034672195.1|1047431_1047734_+	hypothetical protein	NA	A0A2H4JCY6	uncultured_Caudovirales_phage	85.0	3.7e-41
WP_138000971.1|1047714_1048299_+	glycoside hydrolase	NA	A0A2H4JAK8	uncultured_Caudovirales_phage	96.4	2.7e-104
>prophage 4
NZ_CP038022	Acinetobacter radioresistens strain DD78 chromosome, complete genome	3009347	1051606	1060013	3009347		uncultured_Caudovirales_phage(88.89%)	9	NA	NA
WP_138000630.1|1051606_1052161_+	hypothetical protein	NA	A0A2H4J326	uncultured_Caudovirales_phage	46.4	8.4e-23
WP_171462107.1|1052316_1052466_+	hypothetical protein	NA	A0A0P0HSS3	Acinetobacter_phage	71.4	2.3e-12
WP_138000621.1|1052517_1053729_+	hypothetical protein	NA	A0A2H4J3F5	uncultured_Caudovirales_phage	86.6	2.1e-207
WP_138000622.1|1053728_1054649_+	phage BR0599 family protein	NA	A0A2H4J350	uncultured_Caudovirales_phage	88.2	2.2e-153
WP_138000623.1|1054664_1057889_+	hypothetical protein	NA	A0A2H4J328	uncultured_Caudovirales_phage	58.7	0.0e+00
WP_138000624.1|1057881_1058769_+	LamG domain-containing protein	NA	A0A2H4J503	uncultured_Caudovirales_phage	65.2	2.6e-26
WP_138000625.1|1058838_1059165_+	hypothetical protein	NA	A0A2H4JB44	uncultured_Caudovirales_phage	89.8	1.2e-48
WP_034672195.1|1059145_1059448_+	hypothetical protein	NA	A0A2H4JCY6	uncultured_Caudovirales_phage	85.0	3.7e-41
WP_138000971.1|1059428_1060013_+	glycoside hydrolase	NA	A0A2H4JAK8	uncultured_Caudovirales_phage	96.4	2.7e-104
>prophage 5
NZ_CP038022	Acinetobacter radioresistens strain DD78 chromosome, complete genome	3009347	1862954	1874069	3009347		Indivirus(16.67%)	9	NA	NA
WP_106439023.1|1862954_1865606_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.9	2.7e-34
WP_005019709.1|1866269_1866593_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_089041196.1|1866774_1867440_+	peptidase M15	NA	NA	NA	NA	NA
WP_005026590.1|1867586_1868255_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	38.5	7.7e-31
WP_005019705.1|1868441_1869284_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	32.5	4.2e-34
WP_005026591.1|1869436_1870054_-	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.4	3.4e-09
WP_005026592.1|1870046_1870643_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.9	5.8e-22
WP_005026600.1|1870737_1871928_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010700220.1|1871924_1874069_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.5	1.7e-18
>prophage 1
NZ_CP038023	Acinetobacter radioresistens strain DD78 plasmid pAR1, complete sequence	88584	76696	82919	88584		uncultured_Caudovirales_phage(75.0%)	10	NA	NA
WP_000221358.1|76696_76990_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	46.9	2.6e-15
WP_000246755.1|76979_77225_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	42.0	1.9e-11
WP_000877730.1|77383_77812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004282172.1|78036_78603_-	recombinase family protein	NA	Q2A092	Sodalis_phage	37.8	2.4e-25
WP_138001018.1|78918_79347_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.7	3.6e-42
WP_138001019.1|79391_79715_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	1.1e-22
WP_031380725.1|79719_80193_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	50.6	2.1e-35
WP_004644740.1|80198_81239_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_004644739.1|81243_81948_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.8	3.1e-91
WP_005021621.1|81965_82919_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.3	1.0e-60
>prophage 1
NZ_CP038025	Acinetobacter radioresistens strain DD78 plasmid pAR3, complete sequence	80103	5071	64694	80103	transposase,integrase	uncultured_Caudovirales_phage(21.43%)	55	23334:23353	45550:45569
WP_138001047.1|5071_10123_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005155746.1|10119_10791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005155747.1|10912_11113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138001048.1|11161_12304_-	DUF3387 domain-containing protein	NA	NA	NA	NA	NA
WP_004676046.1|12761_13340_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	60.0	1.5e-54
WP_004676048.1|13355_14660_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.9	1.0e-156
WP_005134734.1|14824_15112_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	4.0e-21
WP_138001049.1|15101_15350_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_138001050.1|15352_15814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016541981.1|16346_17648_-	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138001051.1|17658_17949_-	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_138001075.1|17941_18988_-	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_002058091.1|18987_19551_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002058083.1|19561_20641_-	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_138001052.1|20676_21669_-	Nit6803 family nitriliase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	31.6	5.7e-06
WP_002058090.1|21696_22179_-	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_121595018.1|22396_24334_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
23334:23353	attL	ATTTGCAGGAAGAAATATTA	NA	NA	NA	NA
WP_138001053.1|24529_25879_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_138001054.1|26025_27306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138001055.1|27367_27907_-	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_171462127.1|29119_29281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138001056.1|29270_29495_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_005155758.1|29545_30718_-	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	29.4	9.8e-05
WP_019383547.1|31631_32408_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	36.6	1.8e-18
WP_138001057.1|32426_33326_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	37.4	3.0e-14
WP_138001058.1|35238_35580_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	84.1	1.5e-51
WP_138000528.1|35623_36789_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	85.2	2.3e-139
WP_004658364.1|37797_38019_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004658363.1|38213_38465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138001059.1|38717_38939_-	antitoxin HicB	NA	NA	NA	NA	NA
WP_138001060.1|38972_40172_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	32.1	1.8e-46
WP_138000526.1|40603_41533_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.6	1.3e-60
WP_138001061.1|41544_41769_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138001062.1|42245_43190_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_138001063.1|43278_44538_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_138001064.1|44534_46148_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
45550:45569	attR	ATTTGCAGGAAGAAATATTA	NA	NA	NA	NA
WP_048881878.1|46205_47123_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138001065.1|47225_48335_+	muconate cycloisomerase	NA	NA	NA	NA	NA
WP_138001066.1|48349_48640_+	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_138001067.1|48858_49530_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_138001068.1|49550_50204_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_138001069.1|50313_51519_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_138001070.1|51654_52437_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_138001071.1|53003_53294_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_138001072.1|53295_53697_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138001073.1|53806_54917_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.2	1.9e-18
WP_004726718.1|56382_56991_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	36.8	2.7e-14
WP_004726714.1|57085_60052_+|transposase	Tn3-like element ISAcsp1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	68.4	0.0e+00
WP_075315314.1|60106_60226_+	Hin recombinase	NA	NA	NA	NA	NA
WP_000029507.1|60317_60737_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000378064.1|60738_61203_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000186299.1|61259_62231_-	BtrH N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000952904.1|62227_62854_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000149466.1|62937_63807_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004656998.1|64463_64694_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
