The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	2170492	2178650	5747416		Escherichia_phage(42.86%)	7	NA	NA
WP_071680806.1|2170492_2171917_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.4	1.1e-53
WP_071680805.1|2171931_2173296_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.8	4.0e-34
WP_071680804.1|2173430_2174453_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.6	6.8e-79
WP_071680803.1|2175303_2176368_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.3	2.2e-104
WP_071680802.1|2176382_2177252_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.8	4.0e-112
WP_071680801.1|2177253_2177787_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	63.1	1.3e-60
WP_071680800.1|2177786_2178650_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.5	2.1e-44
>prophage 2
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	2271971	2280787	5747416	tRNA	Escherichia_phage(83.33%)	6	NA	NA
WP_024529865.1|2271971_2273264_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.4	8.0e-93
WP_071680750.1|2273526_2275980_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	7.3e-220
WP_071680749.1|2276189_2278640_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	4.9e-224
WP_024529862.1|2278650_2279268_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.9e-76
WP_071680748.1|2279269_2280130_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.1	9.0e-24
WP_037412102.1|2280178_2280787_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.8	7.5e-25
>prophage 3
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	2363583	2400511	5747416	coat,integrase,terminase,holin	Enterobacteria_phage(17.78%)	69	2358490:2358502	2373179:2373191
2358490:2358502	attL	GGCGAGGATGCGG	NA	NA	NA	NA
WP_071680706.1|2363583_2364639_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	51.5	6.1e-107
WP_071680705.1|2364580_2364832_-	hypothetical protein	NA	C6ZCU6	Enterobacteria_phage	51.5	1.3e-10
WP_071680704.1|2365287_2365503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137751142.1|2365484_2365718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680703.1|2365746_2366322_-	hypothetical protein	NA	J9RW52	Pseudomonas_phage	32.8	5.1e-07
WP_071680702.1|2366318_2366663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680701.1|2366664_2367141_-	hypothetical protein	NA	A0A125RNQ8	Pseudomonas_phage	39.4	2.5e-07
WP_071680700.1|2367137_2367329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680699.1|2367350_2367689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680698.1|2367685_2367910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680697.1|2367899_2368154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680696.1|2368153_2369041_-	DNA (cytosine-5-)-methyltransferase	NA	A0A120HUM8	Bacillus_phage	26.3	4.8e-20
WP_071680695.1|2369031_2369394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680694.1|2369390_2369768_-	hypothetical protein	NA	G3M144	Escherichia_virus	66.7	1.8e-45
WP_071680693.1|2369778_2370045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680692.1|2370074_2370476_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	84.0	1.8e-43
WP_071680691.1|2370475_2371081_-	ERF family protein	NA	A0A088CQ15	Enterobacteria_phage	65.3	2.0e-62
WP_071680690.1|2371225_2371432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680689.1|2371685_2372744_-	cell envelope biogenesis protein TolA	NA	A0A2I7R804	Vibrio_phage	47.1	1.8e-29
WP_137751143.1|2373116_2373314_-	hypothetical protein	NA	NA	NA	NA	NA
2373179:2373191	attR	CCGCATCCTCGCC	NA	NA	NA	NA
WP_071680687.1|2373607_2373859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680686.1|2373861_2374185_-	hypothetical protein	NA	Q9B030	Phage_GMSE-1	37.0	4.3e-11
WP_071680685.1|2374551_2374962_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	58.9	3.1e-38
WP_071680684.1|2374958_2375648_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	63.6	4.3e-69
WP_071680683.1|2375644_2375932_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	92.6	1.6e-46
WP_071680682.1|2376085_2376736_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	60.6	6.9e-69
WP_071680681.1|2376814_2377003_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	57.4	1.1e-11
WP_071680680.1|2377141_2377438_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	62.1	3.8e-22
WP_071680679.1|2377449_2377863_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	59.8	2.4e-43
WP_081366970.1|2377916_2378771_+	hypothetical protein	NA	A5VW95	Enterobacteria_phage	76.2	1.1e-50
WP_071680678.1|2378767_2379463_+	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	57.9	1.4e-67
WP_071680677.1|2379459_2379675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137751242.1|2379701_2379893_+	hypothetical protein	NA	A0A2P1CKR1	Pantoea_phage	57.4	2.5e-11
WP_071680675.1|2379909_2380251_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	38.8	2.7e-08
WP_071680674.1|2380243_2380525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680673.1|2380521_2380722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680672.1|2380846_2381308_+	hypothetical protein	NA	A0A1V0E789	Klebsiella_phage	61.6	3.2e-20
WP_071680671.1|2381311_2381590_+	DUF4752 family protein	NA	A0A1R3Y5T8	Salmonella_virus	31.3	1.8e-05
WP_071680670.1|2381573_2382023_+	recombination protein NinB	NA	F1C5C7	Cronobacter_phage	52.1	3.1e-36
WP_071680669.1|2382022_2382373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680668.1|2382369_2382903_+	phage N-6-adenine-methyltransferase	NA	M1FN83	Enterobacteria_phage	64.9	5.7e-61
WP_071680667.1|2382899_2383073_+	protein ninD	NA	C6ZR56	Salmonella_phage	66.7	8.6e-19
WP_137751144.1|2383039_2383210_+	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	46.6	9.1e-05
WP_071680666.1|2383206_2383617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680665.1|2383731_2384433_+	serine/threonine-protein phosphatase	NA	H6WZJ4	Escherichia_phage	64.8	1.9e-80
WP_071680664.1|2384404_2385007_+	protein NinG	NA	A0A1P8DTE0	Proteus_phage	54.1	4.9e-53
WP_071680662.1|2385388_2385907_+	antiterminator	NA	A0A192Y911	Salmonella_phage	76.2	3.1e-72
WP_071680843.1|2386122_2386440_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	44.9	9.0e-22
WP_071680842.1|2386493_2386763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680661.1|2386765_2387158_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	59.5	1.0e-35
WP_071680660.1|2387479_2388229_+	hypothetical protein	NA	A0A077K9Y9	Edwardsiella_phage	73.5	2.0e-48
WP_071680659.1|2388238_2388475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680658.1|2388598_2388979_+	hypothetical protein	NA	R9VYK9	Serratia_phage	54.2	3.5e-28
WP_071680657.1|2388995_2389223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071680656.1|2389245_2389818_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	77.5	2.0e-64
WP_071680655.1|2389814_2391374_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	83.6	1.5e-274
WP_071680654.1|2391379_2392759_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	72.8	3.2e-196
WP_071680653.1|2392768_2393881_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.5	5.6e-119
WP_071680652.1|2393985_2394750_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	68.1	1.9e-89
WP_071680651.1|2394841_2395984_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	48.2	6.0e-92
WP_071680650.1|2396032_2396227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680649.1|2396230_2396623_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	40.8	2.8e-09
WP_071680648.1|2396624_2397014_+	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	44.9	7.9e-20
WP_071680647.1|2397015_2397396_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	46.7	3.8e-27
WP_071680646.1|2397392_2397785_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_071680645.1|2397809_2398979_+	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	42.7	1.5e-58
WP_071680644.1|2399029_2399479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680643.1|2399598_2399796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680642.1|2399971_2400511_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	78.4	1.8e-78
>prophage 4
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	2403607	2412987	5747416		Klebsiella_phage(62.5%)	11	NA	NA
WP_071680640.1|2403607_2403934_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	73.1	4.7e-34
WP_071680639.1|2403981_2404503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680638.1|2404576_2405083_-	hypothetical protein	NA	S4TR57	Salmonella_phage	38.1	2.1e-12
WP_071680637.1|2405118_2405358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680636.1|2405465_2405933_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	54.0	4.5e-46
WP_071680635.1|2405929_2406412_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.9	1.1e-52
WP_071680634.1|2406422_2406803_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	82.5	1.3e-59
WP_071680633.1|2406799_2409868_+	kinase	NA	A0A286S259	Klebsiella_phage	51.4	5.1e-295
WP_071680632.1|2409925_2411755_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	40.0	2.9e-11
WP_071680631.1|2411757_2412456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680630.1|2412585_2412987_+	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	41.1	2.5e-16
>prophage 5
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	2712651	2755942	5747416	protease,integrase,coat	Escherichia_phage(23.08%)	40	2743785:2743802	2765023:2765040
WP_021804630.1|2712651_2713197_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071680453.1|2713260_2713779_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_071680452.1|2713790_2714315_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071680451.1|2714333_2715131_+	molecular chaperone	NA	NA	NA	NA	NA
WP_071680450.1|2715149_2717672_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_137751243.1|2717689_2718640_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071680448.1|2718643_2720080_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_071680447.1|2720248_2722882_-	PqiB family protein	NA	NA	NA	NA	NA
WP_071680831.1|2722850_2724098_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_021178215.1|2724338_2724836_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_021804621.1|2724931_2725645_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_071680446.1|2725664_2727713_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.0	7.0e-83
WP_071680445.1|2727979_2728858_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_071680444.1|2728945_2730337_-	MFS transporter	NA	NA	NA	NA	NA
WP_059200604.1|2730565_2731357_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_071680441.1|2733310_2734225_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_137751149.1|2734340_2735738_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_071680439.1|2735916_2736465_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.1	3.7e-07
WP_071680438.1|2736689_2737451_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	8.8e-15
WP_021804612.1|2737662_2738328_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_021178205.1|2738541_2739102_+	membrane protein	NA	NA	NA	NA	NA
WP_071680437.1|2739141_2740011_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_071680436.1|2740449_2741307_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_071680435.1|2741306_2742170_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_021178200.1|2742169_2743060_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	2.5e-08
WP_071680434.1|2743056_2743995_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2743785:2743802	attL	TGGTGATGGACTCTACCA	NA	NA	NA	NA
WP_071680433.1|2744124_2744424_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_021178197.1|2744533_2745196_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	34.3	5.0e-06
WP_071680432.1|2745503_2746229_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_071680431.1|2746231_2748016_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_137751150.1|2748012_2749368_+	cytochrome c	NA	NA	NA	NA	NA
WP_071680430.1|2749504_2750488_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.6	2.6e-112
WP_071680429.1|2750575_2750875_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	66.7	5.3e-32
WP_071680428.1|2750995_2751280_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	71.1	1.2e-33
WP_071680427.1|2751461_2751962_+	replication protein B	NA	M1SV55	Escherichia_phage	69.3	7.2e-66
WP_071680426.1|2752025_2752298_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_071680425.1|2752300_2752525_+	hypothetical protein	NA	Q9ZXI6	Pseudomonas_virus	41.9	3.1e-08
WP_071680424.1|2752647_2752920_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	51.1	1.0e-21
WP_071680423.1|2752916_2753639_+	Dcm methylase	NA	A0A1V0E7C5	Klebsiella_phage	60.4	3.1e-78
WP_071680422.1|2753635_2755942_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.1	1.3e-266
2765023:2765040	attR	TGGTGATGGACTCTACCA	NA	NA	NA	NA
>prophage 6
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	2760512	2796000	5747416	tRNA,terminase,lysis,tail,capsid,plate,portal,head	Escherichia_phage(31.03%)	39	NA	NA
WP_071680416.1|2760512_2761544_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.8	5.9e-163
WP_071680415.1|2761540_2763313_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	83.4	2.3e-292
WP_071680414.1|2763477_2764323_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.5	7.5e-108
WP_071680413.1|2764385_2765537_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	77.2	1.1e-154
WP_071680412.1|2765540_2766287_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.6	7.2e-70
WP_071680411.1|2766379_2766886_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	70.8	1.2e-60
WP_071680410.1|2766885_2767089_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	68.7	7.0e-20
WP_071680409.1|2767091_2767301_+	hypothetical protein	NA	B6SD15	Bacteriophage	46.4	1.7e-05
WP_071680408.1|2767284_2767794_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	71.9	2.1e-60
WP_071680407.1|2767790_2768231_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	48.2	2.5e-22
WP_071680406.1|2768311_2768779_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	4.5e-62
WP_071680405.1|2768771_2769224_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.3	3.5e-51
WP_071680404.1|2769666_2770371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071680403.1|2770655_2771297_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	70.9	1.6e-81
WP_071680402.1|2771293_2771641_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	71.9	2.5e-41
WP_071680401.1|2771646_2772555_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	77.5	1.0e-126
WP_071680400.1|2772547_2773075_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.4	5.2e-75
WP_137751151.1|2773088_2775335_+	hypothetical protein	NA	Q858V4	Yersinia_virus	55.0	4.1e-60
WP_071680399.1|2775337_2775763_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.5	3.8e-23
WP_071680398.1|2776043_2777213_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.1	2.7e-188
WP_071680397.1|2777227_2777749_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	76.7	1.0e-75
WP_071680396.1|2777812_2778109_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.2	7.1e-29
WP_071680395.1|2778123_2778261_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	80.0	3.5e-15
WP_137751152.1|2778253_2780701_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	48.6	2.2e-176
WP_071683685.1|2780714_2781200_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	66.9	7.5e-52
WP_071683684.1|2781196_2782375_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	71.3	2.7e-148
WP_071683683.1|2782449_2782668_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	65.3	1.8e-21
WP_071683682.1|2783515_2784400_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_071683681.1|2784630_2785914_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_021178152.1|2785948_2786635_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_071683680.1|2786707_2788072_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_071683679.1|2788163_2788754_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_024530019.1|2789059_2790988_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	3.8e-131
WP_071683678.1|2790991_2791543_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	1.2e-16
WP_004931418.1|2791640_2791838_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004963673.1|2791881_2792238_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_137751153.1|2792258_2792402_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_021804595.1|2792614_2793598_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_071683677.1|2793612_2796000_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	3884462	3891819	5747416		Pectobacterium_phage(33.33%)	10	NA	NA
WP_071681038.1|3884462_3884783_+	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	47.1	1.5e-16
WP_071681039.1|3884796_3885057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071681040.1|3885053_3885548_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	44.7	1.8e-21
WP_071681137.1|3885699_3885942_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	46.4	1.3e-09
WP_071681041.1|3886043_3886307_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	63.4	8.8e-15
WP_071681042.1|3886744_3887215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021178442.1|3887526_3887769_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	87.3	3.6e-31
WP_071681043.1|3888040_3888964_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071681044.1|3889129_3890545_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_071681045.1|3890541_3891819_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	39.1	2.7e-72
>prophage 8
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	4521838	4538661	5747416	tail	Enterobacteria_phage(27.27%)	12	NA	NA
WP_071683963.1|4521838_4522576_+	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	43.2	7.1e-54
WP_071683964.1|4525129_4530871_-	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	55.7	1.6e-286
WP_071683965.1|4530928_4531552_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	54.0	8.7e-53
WP_071683966.1|4531548_4532259_-	peptidase P60	NA	M9NZD8	Enterobacteria_phage	55.7	1.5e-80
WP_071683967.1|4532261_4533014_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	57.0	2.5e-86
WP_024486957.1|4533022_4533364_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	40.2	1.5e-14
WP_071683968.1|4533642_4535925_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	31.5	1.3e-93
WP_071683969.1|4535982_4536237_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	63.6	1.1e-17
WP_081367120.1|4536284_4536638_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	54.3	4.2e-28
WP_059201585.1|4536709_4537372_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	63.1	1.2e-71
WP_071683971.1|4537603_4538008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021807641.1|4538295_4538661_-	phage antitermination protein Q	NA	B6SCY2	Bacteriophage	55.0	4.6e-30
>prophage 9
NZ_CP040182	Serratia fonticola strain MS5 chromosome, complete genome	5747416	5178254	5217231	5747416	tRNA,terminase,lysis,tail,capsid,plate,portal,integrase,head	Escherichia_phage(21.43%)	46	5184409:5184456	5218011:5218058
WP_071682897.1|5178254_5179268_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	2.2e-109
WP_001144069.1|5179592_5179808_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_071682896.1|5179945_5181694_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	6.6e-74
WP_021179483.1|5181851_5183690_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_071682895.1|5183739_5184228_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
5184409:5184456	attL	CTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
WP_071682894.1|5184626_5184845_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	63.9	3.6e-22
WP_071682893.1|5184916_5186092_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	70.3	1.3e-150
WP_071682892.1|5186088_5186574_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	66.9	2.8e-51
WP_137751213.1|5186589_5189037_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	47.2	7.4e-172
WP_071682559.1|5189029_5189167_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	77.8	1.0e-14
WP_071682560.1|5189181_5189478_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	80.0	9.3e-29
WP_071682561.1|5189540_5190062_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	76.2	4.0e-75
WP_071682562.1|5190077_5191247_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	4.1e-189
WP_071682563.1|5191527_5191953_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.5	3.8e-23
WP_137751214.1|5191955_5194202_-	hypothetical protein	NA	Q858V4	Yersinia_virus	55.5	4.1e-60
WP_137751215.1|5194215_5194743_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.4	8.9e-75
WP_071682565.1|5194735_5195644_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	76.8	4.3e-125
WP_071682566.1|5195649_5195997_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	71.1	5.6e-41
WP_071682567.1|5195993_5196635_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	75.1	5.9e-89
WP_071682568.1|5196706_5197159_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	74.7	4.1e-52
WP_071682569.1|5197151_5197619_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	5.9e-62
WP_071682570.1|5197699_5198140_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	46.0	3.1e-20
WP_071682571.1|5198136_5198646_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	72.5	2.9e-62
WP_021178175.1|5198629_5198839_-	hypothetical protein	NA	B6SD15	Bacteriophage	46.4	5.0e-05
WP_071682572.1|5198841_5199045_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	70.1	1.1e-20
WP_071682573.1|5199044_5199551_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	72.0	8.3e-62
WP_071682574.1|5199643_5200390_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	2.7e-69
WP_071682575.1|5200393_5201545_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	76.6	4.7e-153
WP_071682576.1|5201607_5202453_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.9	2.6e-108
WP_071682577.1|5202617_5204390_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	81.3	1.1e-286
WP_071682578.1|5204386_5205418_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.0	6.3e-165
WP_071682579.1|5205752_5206895_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	43.5	9.3e-77
WP_071682580.1|5206894_5207617_+	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	28.3	2.6e-16
WP_071682581.1|5207592_5208639_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.9	6.0e-115
WP_071682582.1|5208730_5208943_-	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	78.2	2.4e-15
WP_071682583.1|5209231_5211547_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.7	3.6e-269
WP_071682584.1|5211543_5212266_-	Dcm methylase	NA	A0A1V0E7C5	Klebsiella_phage	63.4	3.6e-82
WP_071682585.1|5212262_5212535_-	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	46.7	3.2e-20
WP_071682586.1|5212657_5212882_-	hypothetical protein	NA	Q9ZXI6	Pseudomonas_virus	41.9	3.1e-08
WP_071682587.1|5212884_5213157_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_071682588.1|5213224_5213725_-	replication protein B	NA	M1SV55	Escherichia_phage	68.1	3.3e-63
WP_071682589.1|5213904_5214414_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	86.4	4.6e-76
WP_071682590.1|5214445_5214667_-	regulator	NA	NA	NA	NA	NA
WP_071682591.1|5214784_5215369_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	39.7	1.4e-31
WP_071682592.1|5215370_5216156_+	hypothetical protein	NA	M1PL51	Streptococcus_phage	28.5	7.0e-07
WP_071682593.1|5216205_5217231_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.5	4.5e-115
5218011:5218058	attR	CTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
