The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	630432	667939	4994320	head,capsid,portal,terminase,integrase,tail,holin	Cronobacter_phage(72.97%)	45	633861:633878	665174:665191
WP_000478471.1|630432_631998_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|631994_632642_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213761.1|632873_633641_+	siderophore-interacting protein	NA	NA	NA	NA	NA
633861:633878	attL	TGCGACACTTTTGCGACA	NA	NA	NA	NA
WP_000627044.1|633898_635680_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145220.1|635669_636707_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|636710_637277_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|637293_637875_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|638018_638240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|638270_638774_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|638783_639011_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|639000_639426_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|639425_639827_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|639894_640128_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279408.1|640118_640979_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	2.2e-131
WP_000170875.1|640975_642997_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.1	1.7e-299
WP_000353141.1|643116_643323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|643296_643620_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_138727326.1|643616_644678_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	5.1e-162
WP_001151942.1|644674_646450_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.6	5.2e-292
WP_000018796.1|646610_647414_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.6e-78
WP_000550496.1|647475_648498_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218538.1|648501_649206_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	4.7e-87
WP_000398492.1|649209_649404_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000402396.1|649464_649953_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	1.1e-63
WP_000084222.1|649949_650456_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	3.4e-63
WP_000560078.1|650452_651160_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.4	1.0e-102
WP_000220203.1|651156_652284_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|652280_652736_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|652745_653039_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|653035_653377_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376370.1|653376_653709_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_001270303.1|653680_653869_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
WP_000411337.1|653855_654113_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811092.1|654300_656271_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	71.1	6.4e-275
WP_001002797.1|656267_656597_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136925.1|656593_657778_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.8e-179
WP_001534884.1|657770_658358_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.2e-90
WP_000084305.1|658367_660395_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	47.7	3.1e-155
WP_000421116.1|660412_660940_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.1	1.1e-51
WP_000267951.1|660929_661655_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200790.1|661626_662172_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	1.5e-64
WP_024135610.1|662174_663875_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	9.9e-224
WP_001215694.1|664525_665149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|665461_665968_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
665174:665191	attR	TGCGACACTTTTGCGACA	NA	NA	NA	NA
WP_001519776.1|666091_667939_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 2
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	1146413	1273456	4994320	tRNA,head,capsid,portal,lysis,terminase,transposase,integrase,plate,tail,holin	Cronobacter_phage(32.22%)	134	1155050:1155067	1266348:1266365
WP_000190912.1|1146413_1146986_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_000079789.1|1147077_1148580_+	flagellin FliC	NA	NA	NA	NA	NA
WP_000388873.1|1148647_1149187_+	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_138727327.1|1149866_1150883_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	86.4	7.0e-177
WP_138727328.1|1150882_1151449_-	Repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.4	2.2e-63
WP_138727329.1|1151594_1151798_+	hypothetical protein	NA	F1BUN7	Cronobacter_phage	56.0	1.4e-12
WP_138727330.1|1151835_1152339_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.7	5.0e-59
WP_057527447.1|1152349_1152535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057527449.1|1152531_1152714_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_057527452.1|1152718_1153147_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	56.8	9.9e-32
WP_138727331.1|1153146_1153548_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	3.8e-49
WP_071601531.1|1153694_1153871_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_138727332.1|1153861_1154290_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	70.0	4.2e-14
WP_138727333.1|1154286_1154616_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	44.2	1.7e-10
WP_138727334.1|1154605_1155436_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	67.8	1.1e-106
1155050:1155067	attL	AAAGCGTTTGCGGAGAAA	NA	NA	NA	NA
WP_057527463.1|1155504_1155843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138727335.1|1155871_1157887_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	60.7	6.6e-219
WP_115398788.1|1158000_1158219_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.1e-06
WP_001552031.1|1158192_1158516_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_138727336.1|1158512_1159574_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.7e-162
WP_138727337.1|1159570_1161346_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.8	1.8e-289
WP_000018798.1|1161506_1162307_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|1162368_1163391_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_138727338.1|1163394_1164096_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.4	4.7e-87
WP_058106404.1|1164156_1164645_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	5.0e-64
WP_138727339.1|1164641_1165148_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	6.8e-64
WP_070801889.1|1165144_1165852_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	1.5e-101
WP_000220205.1|1165848_1166976_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|1166972_1167428_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|1167437_1167731_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|1167727_1168069_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001748632.1|1168068_1168401_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	8.8e-36
WP_001270303.1|1168372_1168561_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
WP_000411337.1|1168547_1168805_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811087.1|1168992_1170963_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	9.2e-266
WP_064163070.1|1170959_1171289_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	4.2e-38
WP_138727340.1|1171285_1172470_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	77.9	2.6e-178
WP_057521310.1|1172462_1173050_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.9e-90
WP_138727341.1|1173058_1175086_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.3	2.9e-153
WP_114060489.1|1175103_1175631_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	4.0e-51
WP_138727342.1|1175620_1176346_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	2.3e-68
WP_000200789.1|1176317_1176863_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_138727367.1|1176865_1178566_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	8.3e-223
WP_071785330.1|1178724_1178946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342601.1|1179952_1181116_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196141.1|1181123_1183304_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533868.1|1183300_1184710_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001535045.1|1184774_1196249_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1196868_1197351_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1197500_1197977_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1197966_1198257_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1198422_1198761_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1198909_1200571_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1200656_1201535_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1201658_1202249_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287924.1|1202283_1202889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130559217.1|1203009_1204296_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1204315_1205107_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1205272_1206634_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1206947_1207196_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1207214_1207763_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469811.1|1207807_1208575_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1208615_1208963_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000972010.1|1209107_1209326_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_000627819.1|1209401_1210571_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	99.0	4.1e-213
WP_000978862.1|1210567_1211053_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	3.6e-86
WP_057515790.1|1211067_1213512_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
WP_085984508.1|1213504_1213660_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|1213656_1213992_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207675.1|1214054_1214573_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001279033.1|1214588_1215776_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	9.9e-223
WP_000122993.1|1215910_1216459_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	98.9	3.8e-100
WP_138727343.1|1216471_1218448_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	97.3	0.0e+00
WP_001000069.1|1218458_1218989_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	99.4	5.4e-104
WP_000246671.1|1218981_1219890_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.3	5.4e-160
WP_000127177.1|1219896_1220244_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	7.2e-57
WP_001094748.1|1220240_1220882_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	3.2e-111
WP_001293096.1|1220950_1221400_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_001169074.1|1221392_1221860_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_015633067.1|1221822_1221996_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	96.5	1.1e-24
WP_000866103.1|1221967_1222381_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	94.2	8.4e-44
WP_001144116.1|1222377_1222875_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000134659.1|1222861_1223158_-|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_000870102.1|1223161_1223365_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	97.0	8.8e-31
WP_000214255.1|1223364_1223871_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_000203475.1|1223964_1224714_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	96.8	6.4e-127
WP_086011253.1|1224880_1226135_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_001247246.1|1226116_1227100_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	98.2	1.4e-177
WP_001085932.1|1227176_1228031_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	100.0	9.9e-148
WP_000156055.1|1228196_1229966_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	100.0	0.0e+00
WP_000517959.1|1229965_1231012_+|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	100.0	4.0e-191
WP_015633065.1|1231146_1231329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633062.1|1231614_1231824_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	94.2	4.8e-32
WP_001222153.1|1232019_1232253_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	100.0	2.1e-36
WP_000232650.1|1232256_1232439_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_000556267.1|1232556_1234785_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	96.9	0.0e+00
WP_000058625.1|1234777_1235059_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	98.9	6.1e-46
WP_031624535.1|1235055_1235649_-	3'-5' exonuclease	NA	A0A218M4G8	Erwinia_phage	99.0	6.0e-112
WP_000752600.1|1235764_1235986_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	100.0	3.8e-35
WP_001246237.1|1235985_1236213_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000963464.1|1236280_1236619_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	6.8e-52
WP_000916539.1|1236582_1236783_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	2.1e-32
WP_000459331.1|1236790_1237300_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	100.0	3.3e-90
WP_001278194.1|1237332_1237704_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	99.2	1.4e-61
WP_000997320.1|1237817_1238660_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	70.8	3.9e-112
WP_000382813.1|1238659_1239223_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000218686.1|1239244_1240294_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	99.7	3.3e-206
WP_001030985.1|1240546_1241767_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1241759_1242278_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1242717_1243788_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1243797_1244919_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210993.1|1244976_1245885_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200078.1|1245845_1247006_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1247105_1247153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1247256_1247595_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_125039285.1|1247736_1247922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197660.1|1247866_1248604_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1248735_1249716_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992643.1|1249712_1250444_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1250573_1253147_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000985658.1|1259255_1259711_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
WP_000807803.1|1259814_1261116_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	4.5e-43
WP_001264475.1|1261112_1261436_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949287.1|1261480_1262836_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082657.1|1262950_1265611_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183637.1|1265664_1266345_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1266417_1266837_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
1266348:1266365	attR	AAAGCGTTTGCGGAGAAA	NA	NA	NA	NA
WP_000997368.1|1267040_1268078_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1268193_1268883_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1269201_1269585_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188415.1|1269646_1270234_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001535061.1|1270336_1271236_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1271253_1272588_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083345.1|1272718_1273456_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	1742715	1751886	4994320	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1742715_1743663_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1743646_1744378_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1744358_1744466_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1744525_1745257_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1745479_1747165_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1747161_1747881_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950422.1|1747927_1748395_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	1.1e-73
WP_001265351.1|1748451_1748982_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1749153_1749612_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195334.1|1749852_1751886_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	1826500	1832797	4994320		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001111837.1|1826500_1827904_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1828081_1828975_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1829351_1830437_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023657.1|1830436_1831336_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000857532.1|1831383_1832262_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.7e-107
WP_001100807.1|1832266_1832797_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	3.7e-52
>prophage 5
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	2022665	2093733	4994320	tRNA,head,capsid,portal,terminase,transposase,integrase,tail,holin	Salmonella_phage(32.08%)	88	2025686:2025701	2033982:2033997
WP_000004540.1|2022665_2023772_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476064.1|2023825_2024287_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825956.1|2024298_2024628_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249415.1|2024624_2025290_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|2025461_2026712_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2025686:2025701	attL	ACAGGTTTACGGCCAG	NA	NA	NA	NA
WP_000741325.1|2026825_2027968_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089142.1|2027957_2028194_-	excisionase	NA	NA	NA	NA	NA
WP_000008350.1|2028337_2028877_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	6.5e-97
WP_000080410.1|2029013_2029841_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.9	1.1e-151
WP_000997190.1|2029898_2030270_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000883481.1|2030808_2031006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2031340_2032036_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|2032133_2032358_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2032386_2032941_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001087399.1|2032937_2034080_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	93.4	2.5e-194
2033982:2033997	attR	CTGGCCGTAAACCTGT	NA	NA	NA	NA
WP_000620702.1|2034076_2034301_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000104923.1|2034297_2035257_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	83.4	3.2e-123
WP_001669427.1|2035258_2035741_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_000066940.1|2035740_2036634_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	7.3e-162
WP_000767086.1|2036630_2037020_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_001061461.1|2037036_2037897_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	2.3e-160
WP_024134153.1|2037904_2038894_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	7.1e-190
WP_000595052.1|2038908_2039181_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	77.6	9.4e-28
WP_001534776.1|2039177_2040014_+	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	77.4	3.5e-121
WP_000057291.1|2040316_2041012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046093575.1|2041069_2041261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658036.1|2041315_2041504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294875.1|2041593_2041983_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
WP_000226307.1|2041969_2042251_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075992.1|2042250_2042865_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	6.7e-106
WP_000636436.1|2042861_2043404_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001252725.1|2043506_2044010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|2044268_2044814_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_001534812.1|2044785_2046717_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.8e-259
WP_000201415.1|2046700_2046904_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|2046900_2048481_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|2048470_2049967_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011258.1|2049979_2050327_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	4.1e-20
WP_057515266.1|2050381_2051410_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.8	5.0e-114
WP_000235459.1|2051467_2051827_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083295.1|2051837_2052215_+|tail	tail attachment protein	tail	K7PHD8	Enterobacteria_phage	54.7	3.4e-28
WP_000677089.1|2052201_2052780_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_043991247.1|2052828_2053959_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_138727348.1|2054067_2054469_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	98.0	1.5e-50
WP_000971954.1|2054476_2055223_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|2055273_2055669_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077905125.1|2055665_2056004_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_057516411.1|2055975_2059017_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.8	3.4e-291
WP_000447369.1|2059019_2059349_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|2059358_2060057_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_057515768.1|2060063_2060801_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	5.7e-128
WP_057524907.1|2060698_2061346_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.0e-88
WP_057516412.1|2061408_2064771_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|2064809_2065052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138727349.1|2065105_2067547_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.1	7.3e-87
WP_000593428.1|2067543_2068368_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	94.9	4.9e-152
WP_000143155.1|2068357_2068933_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	86.9	1.0e-92
WP_000711200.1|2069582_2070140_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	32.8	3.9e-20
WP_057515787.1|2070430_2070631_-	PagK	NA	NA	NA	NA	NA
WP_071587004.1|2070810_2070972_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.5e-09
WP_043991223.1|2071092_2071764_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.0e-80
WP_001521673.1|2072015_2072228_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_000917260.1|2072674_2073799_+	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000787625.1|2074260_2074467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033398.1|2074788_2075577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497448.1|2076066_2076306_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.5	2.5e-32
WP_001534683.1|2076496_2077018_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_001537306.1|2077435_2077648_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_024134152.1|2077779_2078043_-	virulence protein PagD	NA	NA	NA	NA	NA
WP_000439556.1|2078091_2078283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586560.1|2078616_2078814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789472.1|2078847_2079405_+	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
WP_000977722.1|2080642_2080987_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000758944.1|2081364_2081490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905118.1|2081689_2081920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518864.1|2082111_2082582_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000780159.1|2082920_2083964_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_000929974.1|2084046_2084577_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_000182479.1|2084725_2085040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946087.1|2085721_2087356_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001520270.1|2087355_2088330_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000966636.1|2088319_2089132_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000950206.1|2089125_2089923_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.7e-11
WP_000947455.1|2089916_2090507_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|2090588_2091722_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001183697.1|2091915_2092242_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000234684.1|2092435_2093086_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000502119.1|2093274_2093733_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 6
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	2845894	2867775	4994320	plate,transposase	Shigella_phage(33.33%)	17	NA	NA
WP_086011254.1|2845894_2847057_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	3.4e-50
WP_000739390.1|2847250_2848216_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000449478.1|2848283_2848580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011251.1|2848715_2849877_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000081842.1|2849992_2851195_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_015632886.1|2851274_2851907_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.3	6.2e-22
WP_130559205.1|2851903_2852365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335208.1|2852390_2854187_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.3	1.8e-21
WP_001534622.1|2854191_2854404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103450.1|2858675_2860817_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-24
WP_001142967.1|2861039_2861558_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000031252.1|2862185_2862689_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000524272.1|2862718_2862931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058003.1|2862979_2864452_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611700.1|2864448_2864865_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393864.1|2864869_2866723_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000509050.1|2866686_2867775_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	2933028	3034359	4994320	tRNA,protease,portal,lysis,terminase,transposase,integrase,tail,holin	Salmonella_phage(41.07%)	100	2958080:2958099	3031432:3031451
WP_086011251.1|2933028_2934191_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000374046.1|2935287_2935947_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2936033_2936363_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2936359_2936641_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2936689_2937469_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859417.1|2937494_2938043_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2938257_2939469_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2939526_2939844_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2939888_2940305_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2940475_2941138_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2941232_2941691_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420523.1|2941726_2943781_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|2943904_2944351_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2944369_2946523_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2946509_2947115_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2947331_2947841_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2948197_2949250_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2949321_2949774_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156452.1|2949959_2951720_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2951788_2952307_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2952406_2952574_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759137.1|2952829_2953393_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2953389_2955030_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333145.1|2955034_2956288_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2956302_2958210_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2958080:2958099	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2958222_2960331_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224074.1|2960429_2961539_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2961535_2962078_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2962243_2963254_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|2963461_2966074_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|2966500_2966692_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_138727351.1|2967171_2968334_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	1.4e-51
WP_031603423.1|2968615_2968915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2968983_2969610_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001534738.1|2970257_2971226_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	1.1e-192
WP_000421115.1|2972337_2972856_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_001534724.1|2972870_2975549_-	shikimate transporter	NA	A0A1B0VFW4	Salmonella_phage	64.4	3.0e-150
WP_000178826.1|2975602_2975845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077905120.1|2975883_2976759_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_001576012.1|2979305_2980010_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606354.1|2979907_2980645_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	6.1e-114
WP_001152416.1|2980654_2981350_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2981439_2981973_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2982089_2982587_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2982685_2983018_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_010989010.1|2983014_2986002_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2986081_2986411_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2986407_2986806_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2986851_2987601_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|2987612_2988014_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453192.1|2988010_2988577_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2988557_2988857_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107907.1|2988849_2989173_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	1.3e-28
WP_077945123.1|2989263_2991345_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.2	3.5e-263
WP_077905122.1|2991268_2992786_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2992812_2993019_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2993015_2995154_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2995110_2995644_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001534723.1|2995851_2996331_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.7	5.0e-56
WP_000984585.1|2996348_2996801_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.4e-79
WP_001574216.1|2996784_2997114_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2997389_2998076_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2998436_2998886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2999021_2999147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2999320_2999638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047632.1|2999704_3000502_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	8.9e-151
WP_001617856.1|3000491_3000638_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096550.1|3000634_3001246_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241019.1|3001248_3001455_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|3001454_3002057_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|3002139_3002361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3002472_3002706_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|3002997_3003288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3003365_3003677_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3003673_3004021_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3004031_3004781_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3004783_3005767_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3005851_3006226_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3006191_3006431_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3006550_3006961_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|3007010_3007271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534728.1|3007574_3010502_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	94.1	0.0e+00
WP_077905121.1|3010464_3011622_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	1.0e-216
WP_001237031.1|3011664_3011904_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3011944_3012193_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|3012237_3013530_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191409.1|3013724_3014927_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893191.1|3015007_3016441_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544858.1|3016686_3017901_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3018218_3018680_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|3018880_3020281_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000977709.1|3020886_3021978_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|3022162_3023353_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109478.1|3023414_3024062_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3024089_3024638_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925895.1|3024897_3026745_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572742.1|3027089_3031556_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3031432:3031451	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3031555_3032260_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3032240_3033563_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3033555_3034359_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	3068003	3155460	4994320	tRNA,protease,lysis,terminase,transposase,integrase,tail,holin	Enterobacteria_phage(31.15%)	93	3059726:3059742	3160998:3161014
3059726:3059742	attL	GCTTTATTACCTTTTTC	NA	NA	NA	NA
WP_000886697.1|3068003_3069296_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067785.1|3069554_3070898_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_001519746.1|3070907_3071519_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001535019.1|3071661_3075801_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|3075935_3076430_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537406.1|3076976_3077945_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_001044534.1|3078058_3079825_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	9.2e-23
WP_001202257.1|3079825_3081547_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
WP_001241650.1|3081591_3082296_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001539595.1|3082296_3082680_+	membrane protein	NA	NA	NA	NA	NA
WP_001040187.1|3082607_3082826_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597932.1|3082916_3083828_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|3083936_3084797_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|3084816_3085494_+	hydrolase	NA	NA	NA	NA	NA
WP_001117984.1|3087456_3087654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3087864_3090141_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3090171_3090492_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3090815_3091037_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125895.1|3091166_3093113_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201754.1|3093109_3094228_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_001519667.1|3094373_3095324_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599770.1|3095320_3096979_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000491118.1|3097180_3098080_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458776.1|3098223_3099876_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178698.1|3099887_3100856_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815313.1|3101013_3102732_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
WP_000566346.1|3102770_3103772_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000079019.1|3103782_3105216_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866904.1|3105311_3106325_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202294.1|3106321_3107152_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_001160725.1|3107148_3107472_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057515227.1|3107801_3108041_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	87.3	5.5e-32
WP_057515232.1|3108914_3109733_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.4	1.9e-63
WP_001277616.1|3109805_3110183_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_057515229.1|3110331_3110874_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	2.3e-70
WP_057515230.1|3111065_3111794_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	1.0e-60
WP_057515231.1|3111810_3112224_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	3.2e-19
WP_057517999.1|3112997_3113519_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_138727352.1|3113533_3116212_-	shikimate transporter	NA	A0A1B0VFW4	Salmonella_phage	64.4	3.0e-150
WP_000178849.1|3116265_3116508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138727353.1|3116546_3119909_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	80.0	0.0e+00
WP_057524907.1|3119971_3120619_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.0e-88
WP_057515768.1|3120516_3121254_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	5.7e-128
WP_001152689.1|3121260_3121959_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|3121968_3122298_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_138727354.1|3122300_3125162_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.2	1.7e-284
WP_138727355.1|3125149_3125341_-	hypothetical protein	NA	A0A291AWX1	Escherichia_phage	79.5	2.5e-11
WP_077905125.1|3125312_3125651_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_000479607.1|3125647_3126043_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|3126093_3126840_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_057516608.1|3126847_3127249_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_043991247.1|3127357_3128488_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_077945269.1|3128536_3129121_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.6	3.3e-78
WP_023227232.1|3129124_3129400_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	42.9	6.0e-14
WP_001107911.1|3129392_3129716_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
WP_138727356.1|3129804_3131985_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	71.7	1.2e-274
WP_000196423.1|3133368_3133575_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_057516645.1|3133571_3135680_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.7	4.3e-293
WP_057516646.1|3135666_3136158_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	7.6e-44
WP_023227237.1|3136209_3136434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744510.1|3136509_3136701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516647.1|3136755_3137259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516648.1|3137438_3137921_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.5	8.0e-54
WP_057516649.1|3137917_3138532_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	86.3	6.1e-99
WP_000226307.1|3138531_3138813_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|3138799_3139189_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_057516650.1|3139501_3139927_-	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_071846998.1|3139853_3140408_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	63.9	2.0e-48
WP_057516612.1|3140664_3141858_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	65.0	8.4e-145
WP_057516611.1|3142013_3142829_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	73.1	4.0e-114
WP_057515165.1|3142825_3143149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057515164.1|3143151_3145023_-	AAA family ATPase	NA	K7PK08	Enterobacteria_phage	61.1	4.4e-225
WP_057515163.1|3145123_3146035_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	74.1	1.7e-52
WP_032652465.1|3146158_3146485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071846997.1|3146606_3146849_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.2	1.1e-14
WP_057515161.1|3146932_3147382_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	30.9	1.1e-09
WP_057515160.1|3147523_3147940_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	47.7	3.0e-09
WP_057515169.1|3148041_3148236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228515.1|3148232_3148418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000267316.1|3148605_3148815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077910712.1|3148777_3149155_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	54.8	5.0e-27
WP_057515159.1|3149154_3149391_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	75.3	2.0e-26
WP_057515158.1|3149380_3149776_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	74.6	1.2e-50
WP_077945176.1|3149730_3150585_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	68.9	2.3e-48
WP_077945177.1|3150614_3150992_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_057515156.1|3150981_3151407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057515155.1|3151403_3151628_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	2.9e-19
WP_057515154.1|3151624_3151933_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	82.7	4.2e-16
WP_071846996.1|3151932_3152148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001193375.1|3152300_3152540_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.0	2.5e-24
WP_072142541.1|3152565_3153891_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.0	1.9e-166
WP_001270724.1|3153986_3154502_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027181.1|3154731_3155460_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	6.7e-28
3160998:3161014	attR	GAAAAAGGTAATAAAGC	NA	NA	NA	NA
>prophage 9
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	3505708	3544229	4994320	head,protease,portal,lysis,terminase,integrase,tail	Salmonella_phage(62.5%)	58	3505119:3505165	3544243:3544289
3505119:3505165	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_057515762.1|3505708_3507631_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.2	0.0e+00
WP_072141682.1|3507976_3510094_-|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	99.1	0.0e+00
WP_057515761.1|3510249_3512220_-	hypothetical protein	NA	C6ZR18	Salmonella_phage	99.4	0.0e+00
WP_057515765.1|3512219_3513542_-	DNA transfer protein	NA	C6ZR17	Salmonella_phage	97.5	5.7e-235
WP_023206221.1|3513584_3514274_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	99.6	2.3e-102
WP_015995284.1|3514276_3514732_-	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	100.0	2.3e-87
WP_057515760.1|3514731_3515433_-	hypothetical protein	NA	I1TEJ2	Salmonella_phage	99.1	6.1e-71
WP_057515759.1|3515436_3516855_-	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	93.9	3.3e-265
WP_001531195.1|3516863_3517346_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	80.5	3.2e-71
WP_001531190.1|3517320_3517506_-	hypothetical protein	NA	Q716G9	Shigella_phage	82.0	7.5e-21
WP_057515758.1|3517545_3518823_-|head	head protein	head	Q9AYZ7	Salmonella_phage	94.5	1.2e-226
WP_057515757.1|3518833_3519718_-	hypothetical protein	NA	Q716H1	Shigella_phage	71.6	2.8e-89
WP_057515756.1|3519731_3521858_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	91.2	0.0e+00
WP_057515755.1|3521860_3523273_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	1.5e-278
WP_057515754.1|3523269_3523710_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	99.3	7.7e-80
WP_057515753.1|3523712_3523955_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	3.7e-36
WP_057515752.1|3524058_3524439_-	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	4.2e-66
WP_057515751.1|3524673_3524931_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	90.6	2.0e-35
WP_057515750.1|3524927_3525425_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	94.5	1.1e-90
WP_057515764.1|3525620_3526058_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	3.2e-70
WP_057515763.1|3526146_3526644_-	lysozyme	NA	A0A192Y6U3	Salmonella_phage	98.2	7.1e-90
WP_000286100.1|3526621_3526825_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000027545.1|3527316_3527805_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_057515749.1|3527801_3527984_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	90.0	1.0e-22
WP_057515748.1|3527971_3528442_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	97.4	1.7e-88
WP_057515747.1|3528422_3528659_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	96.2	8.7e-38
WP_057515746.1|3528651_3528828_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	96.6	9.7e-26
WP_057515745.1|3528820_3529162_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	1.0e-63
WP_000113767.1|3529164_3529341_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_071846983.1|3529307_3529481_-	protein ninD	NA	C6ZR56	Salmonella_phage	96.5	9.8e-31
WP_057515744.1|3529477_3530005_-	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	95.4	3.7e-97
WP_057515743.1|3530001_3530424_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	93.6	7.9e-74
WP_057515742.1|3530426_3530627_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	86.4	4.2e-25
WP_057515741.1|3530629_3530902_-	hypothetical protein	NA	H6WZI5	Escherichia_phage	84.3	1.7e-37
WP_057515740.1|3530972_3531278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077945146.1|3531274_3532120_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	72.8	8.1e-110
WP_057515738.1|3532122_3532965_-	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	8.5e-128
WP_057515737.1|3532951_3533596_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001103492.1|3533630_3533912_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3534022_3534238_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|3534356_3535019_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_057515736.1|3535373_3535676_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	96.0	7.0e-48
WP_138727359.1|3535754_3536873_+	hypothetical protein	NA	A0A0M4REI4	Salmonella_phage	92.8	1.7e-62
WP_001539177.1|3536941_3537142_+	hypothetical protein	NA	A0A2H4FQS9	Salmonella_phage	100.0	1.6e-32
WP_071846982.1|3537342_3537483_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	82.6	1.0e-17
WP_000361564.1|3537475_3537589_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001552364.1|3537585_3537774_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
WP_057515782.1|3537782_3538490_+	recombinase	NA	C6ZR37	Salmonella_phage	98.3	2.0e-122
WP_057515781.1|3538490_3538997_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	91.1	7.3e-82
WP_057515780.1|3539005_3539554_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	96.2	2.8e-103
WP_057515779.1|3539567_3539861_+	DUF2856 family protein	NA	I6R984	Salmonella_phage	95.9	2.3e-48
WP_077945144.1|3539886_3540249_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	79.8	1.6e-43
WP_057515777.1|3540253_3540751_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	74.8	3.4e-76
WP_057515776.1|3540747_3541419_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.9	1.5e-90
WP_057515783.1|3541454_3541898_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	82.7	9.0e-44
WP_000509169.1|3541974_3542241_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_001281207.1|3542485_3542836_+	hypothetical protein	NA	I6R980	Salmonella_phage	99.1	5.4e-60
WP_057515775.1|3543065_3544229_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.2	9.7e-223
3544243:3544289	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP040701	Salmonella enterica strain 3 isolate CFSAN047349 chromosome, complete genome	4994320	4249096	4291962	4994320	transposase,tRNA,portal	uncultured_virus(33.33%)	30	NA	NA
WP_000749992.1|4249096_4250062_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	8.2e-66
WP_001188918.1|4250540_4251782_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001033037.1|4251868_4253140_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000233263.1|4253359_4254544_+	MFS transporter	NA	NA	NA	NA	NA
WP_000068752.1|4255416_4256088_+	YjiH family protein	NA	NA	NA	NA	NA
WP_000211979.1|4256084_4256546_+	membrane protein	NA	NA	NA	NA	NA
WP_001113058.1|4256558_4257731_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000383513.1|4257849_4258758_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000683248.1|4258763_4259498_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_000907667.1|4259736_4260267_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001094612.1|4260984_4261998_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000841654.1|4261998_4262772_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000588699.1|4263121_4263796_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_001654330.1|4263792_4264254_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_138727361.1|4264687_4265850_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	1.4e-51
WP_000864865.1|4266985_4267594_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_001054380.1|4268082_4268340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979791.1|4268344_4269976_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000484490.1|4270587_4271313_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_138727362.1|4271613_4272816_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000199885.1|4273095_4273971_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000422448.1|4274048_4274243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081842.1|4275026_4276229_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_015632990.1|4276320_4279155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000213428.1|4279167_4285488_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.0	4.7e-45
WP_001023050.1|4285987_4287007_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001199743.1|4288163_4288472_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000016244.1|4288474_4288714_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000254752.1|4288826_4289075_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000369883.1|4290936_4291962_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.2	6.0e-168
>prophage 1
NZ_CP040702	Salmonella enterica strain 3 isolate CFSAN047349 plasmid unnamed, complete sequence	104768	23	88660	104768	transposase,integrase	Shigella_phage(27.78%)	66	61763:61779	84293:84309
WP_000502119.1|23_482_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.9e-14
WP_001808390.1|2795_3179_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001808391.1|3475_3925_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_130559243.1|4018_5129_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	1.2e-44
WP_001535116.1|5341_5575_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_001054221.1|5691_6051_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000398849.1|6052_6358_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001535119.1|6377_6941_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_004558346.1|6930_7671_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000024509.1|7657_9019_+	F-type conjugal transfer pilus assembly protein TraB	NA	NA	NA	NA	NA
WP_004558343.1|9129_9354_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_004558352.1|9464_10079_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001808381.1|10089_12681_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_004558355.1|12677_13142_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_000715590.1|13141_13777_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004558357.1|13773_14769_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_004558351.1|14779_15148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043991289.1|15144_15759_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_057515797.1|15755_17609_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_004558353.1|17605_18385_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_001808377.1|18406_19000_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_057515798.1|18999_20361_+	F-type conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_043991291.1|20362_23260_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000081842.1|23439_24642_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000682256.1|25310_26048_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000056179.1|26198_28433_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000949140.1|28432_33736_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000493830.1|33754_34321_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001068034.1|34317_35049_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	38.1	1.6e-05
WP_001576653.1|35901_36168_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001541552.1|36417_36495_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_015633268.1|36475_37357_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_015633269.1|37368_37584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001808376.1|38400_39126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000031011.1|39407_39713_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	49.5	9.3e-16
WP_001064756.1|39913_40141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004831.1|40217_40469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792037.1|40458_40674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247111.1|41640_42609_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_138009944.1|42667_42952_-|transposase	transposase	transposase	S5FM71	Shigella_phage	60.3	3.2e-10
WP_015633273.1|43006_43630_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.1	1.7e-72
WP_000057510.1|44420_46187_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001534988.1|46383_47433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001808380.1|47556_47820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534855.1|48366_48645_+	cloacin	NA	NA	NA	NA	NA
WP_000145248.1|48629_49592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000929810.1|49588_49849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195099.1|50160_50445_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000406363.1|50435_50918_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000750479.1|51301_51751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905131.1|51824_52679_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	5.2e-80
WP_000537154.1|52675_52960_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	46.0	8.1e-14
WP_000493752.1|53117_53876_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_106086674.1|53887_54999_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	1.2e-44
WP_000653672.1|55369_56629_-	MFS transporter	NA	NA	NA	NA	NA
WP_015633278.1|56882_70187_-	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	27.6	4.7e-95
61763:61779	attL	TATCCATACTCCACCCG	NA	NA	NA	NA
WP_024134209.1|70186_78568_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.6	1.9e-190
WP_086011258.1|80100_81304_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.8	1.1e-115
WP_000813644.1|81990_82209_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159862.1|82210_82516_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015633283.1|82585_82711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083588.1|82824_83607_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	3.5e-51
WP_000728920.1|83757_84699_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	1.4e-73
84293:84309	attR	CGGGTGGAGTATGGATA	NA	NA	NA	NA
WP_000427674.1|85124_86330_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	1.4e-163
WP_077905129.1|86326_87304_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.9	2.0e-83
WP_000271045.1|87385_88660_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	5.0e-156
