The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040235	Bifidobacterium longum strain ZJ1 chromosome, complete genome	2414672	1117565	1162034	2414672	head,tRNA,lysis,portal,terminase,integrase	Bifidobacterium_phage(26.67%)	57	1123371:1123395	1162938:1162962
WP_131209030.1|1117565_1119599_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.1	3.7e-108
WP_007052850.1|1121408_1122293_-	undecaprenyl-diphosphatase UppP	NA	NA	NA	NA	NA
WP_007054285.1|1122437_1123229_+	phosphotransferase	NA	NA	NA	NA	NA
WP_137658409.1|1123351_1124515_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	37.4	2.7e-55
1123371:1123395	attL	TTTTTGCCCACATTTTGCCCACATT	NA	NA	NA	NA
WP_032685228.1|1124592_1125129_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_008783518.1|1126199_1128254_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_008783517.1|1128246_1129296_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	49.7	3.1e-87
WP_008783515.1|1129881_1130136_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008783514.1|1130135_1130417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106628567.1|1130343_1130958_-	hypothetical protein	NA	I3NLD1	Bifidobacterium_phage	44.0	9.0e-18
WP_008783512.1|1131229_1131514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008783511.1|1131595_1131784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783510.1|1131780_1132026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783509.1|1132289_1132553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783508.1|1132555_1132777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783507.1|1132773_1133154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783506.1|1133153_1133771_+	single-stranded DNA-binding protein	NA	A6N1Y1	Microbacterium_phage	50.7	1.1e-31
WP_137658410.1|1133780_1134188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118068992.1|1134320_1135736_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	38.7	2.3e-69
WP_008783686.1|1136832_1137249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783687.1|1137245_1137455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783688.1|1137451_1138045_+	hypothetical protein	NA	I3NLB8	Bifidobacterium_phage	35.7	3.8e-21
WP_008783689.1|1138184_1138379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783690.1|1138371_1138692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783691.1|1138804_1139056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783692.1|1139132_1139396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783693.1|1139392_1139578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783694.1|1139666_1140419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080968888.1|1140600_1140804_+	tensin-4	NA	NA	NA	NA	NA
WP_008783696.1|1140800_1141154_+	HNH endonuclease	NA	V5R8P9	Arthrobacter_phage	61.8	4.7e-19
WP_008783697.1|1141285_1141726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783698.1|1141694_1143158_+|terminase	terminase	terminase	A0A1D8EU11	Propionibacterium_phage	46.2	1.4e-109
WP_118068997.1|1143154_1144657_+|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	33.4	1.3e-65
WP_108912164.1|1144694_1145864_+	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	50.9	2.5e-24
WP_008783572.1|1146098_1146629_+	heavy metal transporter	NA	NA	NA	NA	NA
WP_008783571.1|1146660_1147557_+|head	head protein	head	A0A2P1CHC1	Mycobacterium_phage	31.7	8.2e-36
WP_008783570.1|1147556_1147853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065443712.1|1147865_1148282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783568.1|1148281_1148599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783567.1|1148602_1148848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032685239.1|1148889_1149243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108912160.1|1149280_1149907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032685234.1|1150052_1150427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783564.1|1150327_1150807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783563.1|1150857_1153584_+	tape measure protein	NA	A0A1D8ETJ9	Propionibacterium_phage	40.5	1.7e-44
WP_008783562.1|1153570_1154416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783561.1|1154400_1155972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118069001.1|1155971_1156370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783559.1|1156366_1156681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032685233.1|1156673_1157396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008783558.1|1157412_1158252_+	collagen-like protein	NA	NA	NA	NA	NA
WP_108912161.1|1158472_1158967_+	collagen-like protein	NA	NA	NA	NA	NA
WP_008783556.1|1158979_1159186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080826491.1|1159685_1160027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080826403.1|1160297_1161161_-|integrase	site-specific integrase	integrase	A0A160DFH7	Gordonia_phage	27.5	1.1e-10
WP_021649547.1|1161242_1161599_+	DUF2746 domain-containing protein	NA	NA	NA	NA	NA
WP_008783552.1|1161611_1162034_+|lysis	phage lysis protein	lysis	I3NL83	Bifidobacterium_phage	77.7	5.0e-36
1162938:1162962	attR	TTTTTGCCCACATTTTGCCCACATT	NA	NA	NA	NA
