The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	570231	577613	5318075	transposase	Enterobacteria_phage(83.33%)	8	NA	NA
WP_012579081.1|570231_571155_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_004152202.1|571788_572355_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|572372_572618_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|572614_573352_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004153681.1|574175_574724_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|574720_574948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|574944_575265_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_014342869.1|575279_577613_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	1048355	1060012	5318075	integrase	Enterobacteria_phage(70.0%)	13	1036489:1036503	1059549:1059563
1036489:1036503	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_014342877.1|1048355_1050689_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.4	0.0e+00
WP_004152206.1|1050703_1051024_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1051020_1051248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1051244_1051802_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1051798_1052065_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|1052606_1053344_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1053340_1053586_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1053603_1054170_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|1054738_1055164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1055163_1056114_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1056101_1057292_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1057644_1058898_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1058908_1060012_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1059549:1059563	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 3
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	1259741	1317040	5318075	protease,transposase,integrase,tRNA,capsid,terminase	Escherichia_phage(18.87%)	76	1272447:1272493	1322850:1322896
WP_002892267.1|1259741_1260368_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004151324.1|1260335_1261022_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
WP_004147400.1|1261018_1263433_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142997.1|1263614_1264760_+	porin	NA	NA	NA	NA	NA
WP_004151323.1|1264867_1265944_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004143002.1|1266055_1267123_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151322.1|1267119_1267629_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004151321.1|1267725_1268064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151320.1|1268171_1268894_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004151319.1|1268897_1269392_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004143010.1|1269567_1270953_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1270995_1271208_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1271209_1272076_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1272447:1272493	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|1272506_1273670_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|1273546_1273882_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1273883_1274099_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1274100_1274319_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_014342888.1|1274315_1275086_-	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	8.5e-66
WP_014342889.1|1275082_1275610_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	6.4e-57
WP_071570658.1|1275606_1275765_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	5.1e-10
WP_014342890.1|1275761_1276385_-	hypothetical protein	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
WP_014342893.1|1276895_1277180_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	1.5e-28
WP_071646962.1|1277260_1277467_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	3.1e-31
WP_039108792.1|1278144_1278492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937863.1|1278692_1279415_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_004194000.1|1279483_1279711_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_001548453.1|1279750_1279972_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|1280196_1281096_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|1281085_1282516_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|1282515_1282809_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1282805_1283312_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_032419573.1|1283308_1283557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342898.1|1283549_1284224_+	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	63.0	7.8e-07
WP_041937862.1|1284223_1284742_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	2.3e-91
WP_004151288.1|1286192_1286648_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_023342724.1|1286647_1286818_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_014342900.1|1286810_1287449_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.3	1.4e-74
WP_041937861.1|1287445_1287625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342901.1|1287621_1287744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041937860.1|1287740_1288520_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	76.7	6.3e-101
WP_004151282.1|1289464_1289713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342902.1|1289715_1290246_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	79.7	9.3e-80
WP_014342903.1|1290242_1290632_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	47.9	1.1e-21
WP_014342905.1|1291090_1291726_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
WP_060613562.1|1291756_1292242_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	2.2e-67
WP_014342907.1|1292243_1293920_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.4	2.3e-249
WP_014342908.1|1293920_1295441_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	2.2e-105
WP_014342909.1|1295493_1296183_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	52.2	6.7e-62
WP_137440870.1|1296246_1296615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342911.1|1296622_1297630_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	51.2	1.6e-56
WP_000608644.1|1297809_1299072_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_012579081.1|1299303_1300227_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_014342913.1|1300793_1301276_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
WP_004196839.1|1301275_1302313_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	1.1e-84
WP_014342914.1|1302314_1302641_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	2.1e-10
WP_065799716.1|1302640_1303084_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	2.5e-14
WP_014342915.1|1303086_1303650_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.4	2.4e-17
WP_060613554.1|1303646_1304015_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.6e-06
WP_014342917.1|1303996_1304548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342918.1|1304551_1306033_+	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	35.0	9.3e-61
WP_014342919.1|1306032_1306476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342920.1|1306656_1307214_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	89.3	1.2e-88
WP_001518122.1|1307293_1307770_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_014342922.1|1307971_1309897_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	53.2	1.7e-38
WP_014342923.1|1309900_1310743_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.1	1.3e-27
WP_032425989.1|1310744_1311050_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	45.5	2.4e-19
WP_032425987.1|1311046_1311901_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.8	2.4e-29
WP_040155013.1|1311902_1312490_+	hypothetical protein	NA	A0A1I9SEV6	Klebsiella_phage	25.9	1.5e-06
WP_100222754.1|1312492_1312843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153255413.1|1312842_1313118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425981.1|1313096_1313459_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	53.5	1.5e-12
WP_014342925.1|1313574_1313751_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_101987940.1|1313821_1314796_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	84.5	2.8e-98
WP_001518114.1|1314863_1315220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342927.1|1315227_1316460_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	3.9e-105
WP_014342928.1|1316452_1317040_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.9	1.0e-34
1322850:1322896	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	1762522	1836538	5318075	protease,plate,integrase,tail,tRNA,capsid,portal,terminase,lysis,head	Salmonella_phage(56.82%)	73	1762430:1762448	1792730:1792748
1762430:1762448	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|1762522_1763575_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|1763993_1765478_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001154434.1|1765578_1765767_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1765777_1766011_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1766125_1766803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1767078_1768821_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1768882_1769908_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1769907_1771674_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1771816_1772650_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1772666_1773725_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1773728_1774379_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1774474_1774939_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1774938_1775142_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1775145_1775361_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1775341_1775851_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1775855_1776239_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1776235_1776664_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|1776759_1777191_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1777183_1777630_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1777626_1778319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1778413_1778986_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1778982_1779345_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1779331_1780240_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1780232_1780832_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|1780833_1783785_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|1783788_1784520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1784516_1784720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1784749_1785826_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1785964_1787137_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1787146_1787662_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1787714_1788014_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1788028_1788148_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896224.1|1790765_1791251_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1791247_1792348_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_135406301.1|1792439_1792658_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	5.8e-20
WP_002896351.1|1794828_1795212_+	membrane protein	NA	NA	NA	NA	NA
1792730:1792748	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_002896352.1|1795218_1795482_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|1795684_1795972_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|1796793_1797696_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|1797784_1798264_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|1798612_1799725_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|1799888_1801022_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|1801032_1801986_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|1801982_1802828_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|1802885_1803374_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|1803415_1804543_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|1804621_1805338_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|1805334_1806807_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896384.1|1806849_1807581_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004150852.1|1807764_1808433_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896386.1|1808432_1809149_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|1809155_1809887_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896392.1|1809907_1810636_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|1810862_1811378_-	lipoprotein	NA	NA	NA	NA	NA
WP_004150851.1|1812255_1813395_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896397.1|1813426_1814257_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_002896399.1|1814253_1815267_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896401.1|1815354_1816797_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896404.1|1816807_1817809_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896406.1|1817847_1819566_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896408.1|1819717_1820152_+	DoxX family protein	NA	NA	NA	NA	NA
WP_002896410.1|1820363_1821332_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896412.1|1821342_1822995_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147773.1|1823138_1824038_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896434.1|1824153_1824849_-	aquaporin Z	NA	NA	NA	NA	NA
WP_002896440.1|1827074_1828190_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1828186_1830127_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1830203_1830425_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1830750_1831068_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1831098_1833378_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1833498_1833717_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1834070_1834772_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1834816_1836538_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 5
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	2261601	2302530	5318075	terminase,transposase,integrase	uncultured_Caudovirales_phage(32.0%)	59	2259682:2259696	2268622:2268636
2259682:2259696	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2261601_2262363_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2262579_2264112_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2264310_2264859_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2265055_2266237_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2266217_2266460_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|2266638_2267118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2267114_2267327_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2267323_2267548_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2267537_2268248_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2268253_2268772_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2268622:2268636	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2268876_2269704_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2269700_2269895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2269891_2270317_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2270313_2270532_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2270503_2270758_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2270750_2271116_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2271285_2271474_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2271466_2271781_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2271951_2272620_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2272717_2272939_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2273516_2275175_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2275176_2276139_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2276135_2276612_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2276608_2277391_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_014343019.1|2277796_2278000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201219.1|2278010_2279549_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_000612626.1|2279597_2279945_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_003031976.1|2279941_2280346_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_004152169.1|2280509_2281040_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2281036_2281426_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2281660_2281981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|2282082_2282835_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|2282785_2284186_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2284423_2285875_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2285930_2286479_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2286530_2287733_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2287736_2288231_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_014343020.1|2288242_2289184_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	3.9e-137
WP_000725700.1|2289223_2289505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2289473_2289893_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2289889_2290396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2290395_2290782_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2290876_2291317_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2291320_2292466_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|2292476_2292917_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|2292920_2293346_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2293381_2293534_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2293523_2295527_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2295526_2296126_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|2296126_2296429_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|2296431_2297454_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2297453_2297795_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2297844_2298027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2298069_2298636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2298689_2299343_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2299344_2299698_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2299697_2300894_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2300890_2301664_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2301663_2302530_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 6
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	2529700	2536130	5318075		Escherichia_phage(100.0%)	6	NA	NA
WP_002210516.1|2529700_2530321_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2530313_2531579_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2531590_2532493_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2532753_2533515_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2533535_2534396_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001620097.1|2535041_2536130_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
>prophage 7
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	3208121	3275724	5318075	protease,tRNA,plate,transposase	Microcystis_phage(22.22%)	59	NA	NA
WP_002910404.1|3208121_3209378_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3209648_3210260_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004891134.1|3210256_3211108_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_014343189.1|3211291_3212239_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.2	6.6e-44
WP_004200291.1|3212363_3214043_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_004175547.1|3214043_3215090_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3215311_3215587_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|3215859_3216444_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3216561_3217653_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004145442.1|3217736_3218066_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3218149_3219064_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004200294.1|3219195_3220611_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|3220630_3221074_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004189400.1|3221076_3221619_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032440110.1|3221593_3222640_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014343191.1|3222639_3224403_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014343192.1|3224536_3227947_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014343193.1|3227930_3229088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004175522.1|3229091_3229358_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014343194.1|3229655_3229898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579081.1|3232224_3233148_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_137440875.1|3233269_3233602_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_014343201.1|3233777_3234671_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_014343203.1|3234854_3235748_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	28.8	8.8e-14
WP_015958629.1|3235769_3236075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040216891.1|3237303_3237495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023158128.1|3237491_3238001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040200757.1|3238084_3238591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557516.1|3238685_3239042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3239278_3239788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343209.1|3239788_3241144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343210.1|3241167_3243654_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_014343211.1|3244113_3245811_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004189358.1|3245814_3246468_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014343212.1|3246464_3247805_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_077258549.1|3248042_3248288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910650.1|3248374_3248704_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|3248773_3249358_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_014907357.1|3249383_3250082_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|3250272_3250755_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|3250864_3251764_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175495.1|3251738_3252545_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002910715.1|3254160_3255087_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|3255185_3255662_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004148802.1|3255711_3257355_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_004145473.1|3257638_3258532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014343216.1|3258537_3259257_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_004148803.1|3259253_3260129_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_014343219.1|3261420_3262335_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009484368.1|3262444_3263560_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175486.1|3266311_3267520_-	propionate kinase	NA	NA	NA	NA	NA
WP_004200322.1|3267547_3268879_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910762.1|3268904_3269894_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_002910764.1|3269987_3270929_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004145488.1|3271545_3271668_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_014343224.1|3271705_3272506_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_023158138.1|3272498_3273512_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014343226.1|3273640_3274498_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_004175481.1|3274977_3275724_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	3537272	3545649	5318075		Escherichia_phage(28.57%)	8	NA	NA
WP_004175262.1|3537272_3538277_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_004144151.1|3538677_3538800_+	small membrane protein	NA	NA	NA	NA	NA
WP_004175261.1|3539222_3540389_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004175260.1|3540568_3541123_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175259.1|3541137_3542028_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|3542059_3542929_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_014343304.1|3542955_3544020_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.2e-105
WP_014343305.1|3544242_3545649_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 9
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	3588976	3595882	5318075	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|3588976_3590455_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3590451_3591174_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3591492_3592854_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|3593100_3593994_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|3594234_3595008_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|3595018_3595882_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 10
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	4001030	4075936	5318075	plate,transposase,integrase,tail,tRNA,holin,capsid,portal,terminase,lysis,head	Escherichia_phage(31.91%)	75	4024386:4024401	4043716:4043731
WP_002914079.1|4001030_4001768_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4001899_4003231_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4003276_4003660_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4003973_4004663_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4004720_4005806_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4006009_4006435_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4006504_4007203_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|4007237_4009889_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4010009_4011365_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4011406_4011730_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4011733_4013032_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4018995_4021569_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4021698_4022430_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4022426_4023407_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4023538_4024276_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
4024386:4024401	attL	TTATCGGGTTCGACAA	NA	NA	NA	NA
WP_002914111.1|4024546_4024882_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4024988_4025036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4025136_4026297_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4026293_4027166_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4027228_4028350_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4028359_4029430_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4029772_4030282_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4030274_4031498_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4031511_4031994_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4032002_4033373_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4033429_4033888_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_014343376.1|4034119_4035151_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	83.7	1.6e-173
WP_101987948.1|4035153_4036026_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	44.8	2.1e-68
WP_023317540.1|4036151_4036379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343379.1|4036410_4036920_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	94.1	4.1e-85
WP_040165606.1|4036927_4037128_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	9.3e-17
WP_014343381.1|4037208_4037496_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	55.9	2.3e-24
WP_014343382.1|4037561_4037786_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	71.9	4.4e-15
WP_014343383.1|4037785_4038013_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.8e-24
WP_014343384.1|4038009_4038591_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	77.7	2.6e-83
WP_014343385.1|4038587_4038860_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	73.3	1.1e-31
WP_042945817.1|4038856_4039138_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.0	1.3e-11
WP_101987949.1|4039128_4041345_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.6	0.0e+00
WP_004152765.1|4041490_4042975_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014343387.1|4043381_4043564_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	78.3	5.3e-19
WP_064172876.1|4043567_4043798_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	69.7	4.8e-25
4043716:4043731	attR	TTATCGGGTTCGACAA	NA	NA	NA	NA
WP_014343389.1|4043877_4044609_+	hypothetical protein	NA	Q37850	Escherichia_phage	85.6	2.4e-118
WP_014343390.1|4044722_4045520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343391.1|4045890_4046934_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	2.6e-166
WP_014343392.1|4046933_4048703_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	2.4e-305
WP_014343393.1|4048868_4049723_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	4.8e-126
WP_101987951.1|4050857_4051601_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	80.3	6.7e-100
WP_014343397.1|4051697_4052204_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_014343398.1|4052203_4052407_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	79.1	3.6e-24
WP_004195910.1|4052411_4052702_+|holin	holin	holin	O80308	Escherichia_phage	85.7	5.3e-37
WP_014343399.1|4052688_4053186_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.7	3.0e-80
WP_014343400.1|4053182_4053614_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	3.7e-42
WP_014343402.1|4053709_4054177_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	6.3e-64
WP_085841837.1|4054169_4054619_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	1.9e-49
WP_085841838.1|4054687_4055329_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	3.4e-92
WP_014343405.1|4055325_4055673_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_014343406.1|4055677_4056586_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.5	1.9e-112
WP_101987952.1|4056578_4057178_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	57.0	4.9e-53
WP_137440876.1|4057831_4061410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343410.1|4061425_4062496_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	8.9e-29
WP_014343411.1|4062606_4063788_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.9	2.1e-196
WP_014343412.1|4063801_4064317_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|4064377_4064653_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343413.1|4064685_4064805_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_014343414.1|4064797_4067239_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.1	1.1e-289
WP_101987954.1|4067252_4067732_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	82.2	9.3e-71
WP_014343416.1|4067731_4068892_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.2	9.8e-175
WP_071839001.1|4068972_4069191_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	7.8e-33
WP_002914145.1|4069350_4069698_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4069737_4070505_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4070536_4071085_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4071103_4071352_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4071611_4072976_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4073139_4073931_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000608644.1|4074673_4075936_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 11
NZ_CP037927	Klebsiella pneumoniae strain CRKP I chromosome, complete genome	5318075	4767524	4816367	5318075	protease,tail,tRNA,capsid,portal,terminase,head	uncultured_Caudovirales_phage(66.67%)	55	NA	NA
WP_002918465.1|4767524_4768019_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4768022_4768661_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4768630_4768915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4768972_4769365_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4769380_4769809_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4770074_4771202_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4771392_4771791_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4771964_4773332_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4773419_4774478_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4774614_4775553_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4775967_4776438_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4776813_4777077_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4777175_4777442_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4777492_4777768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|4777847_4779815_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4779820_4780753_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4780760_4780964_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4781095_4782025_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4782060_4783506_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4783594_4787392_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|4787429_4788899_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4788901_4789483_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4789490_4789979_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4789978_4790971_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4791041_4792085_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4792390_4794331_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4794410_4794602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4794830_4795832_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4795831_4796440_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4796663_4797116_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4797138_4797606_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4797616_4798966_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4799076_4799319_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4799308_4800760_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4800771_4801653_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4802010_4802976_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4803000_4803297_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4803450_4803642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4803644_4805306_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4805289_4805646_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|4805921_4806365_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4806364_4806664_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4806660_4806996_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4806992_4808234_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4808235_4808796_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4808847_4810014_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4810277_4810790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4810838_4811174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4811516_4813652_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4813651_4814017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4814013_4814382_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4814378_4814693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4814685_4814874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4814866_4815136_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4815587_4816367_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
