The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039849	Lactobacillus animalis strain LL1 chromosome, complete genome	2280577	485449	492403	2280577		Enterococcus_phage(66.67%)	7	NA	NA
WP_056958271.1|485449_486400_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	68.4	1.8e-126
WP_066023502.1|486415_488587_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	62.1	1.3e-257
WP_010688503.1|488576_488951_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1W6JK40	Lactococcus_phage	43.7	6.2e-14
WP_004051414.1|488947_489178_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	39.0	8.0e-12
WP_137421065.1|489346_489937_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	50.9	7.0e-28
WP_137421066.1|490177_491353_+	acetate kinase	NA	NA	NA	NA	NA
WP_035448453.1|491431_492403_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.6	2.8e-42
>prophage 2
NZ_CP039849	Lactobacillus animalis strain LL1 chromosome, complete genome	2280577	1171186	1181436	2280577	tRNA,terminase,integrase	Streptococcus_phage(28.57%)	14	1172784:1172801	1187721:1187738
WP_137421540.1|1171186_1172464_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.1	5.1e-23
1172784:1172801	attL	GGGTCTCCTTTGGGTCTC	NA	NA	NA	NA
WP_137421541.1|1172809_1173940_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	36.3	5.3e-56
WP_137421542.1|1174438_1174903_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	59.0	8.6e-13
WP_137421543.1|1175038_1175230_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_137421544.1|1175244_1176009_+	hypothetical protein	NA	D2IYT0	Enterococcus_phage	34.5	2.3e-10
WP_137421545.1|1176134_1176962_+	helix-turn-helix domain-containing protein	NA	Q4ZC33	Staphylococcus_virus	42.8	5.2e-21
WP_066023954.1|1177099_1177348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137421546.1|1177347_1177713_+	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	36.7	9.4e-07
WP_137421547.1|1177693_1178002_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_137421548.1|1178096_1178474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137421549.1|1178476_1178719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137421550.1|1178738_1179095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137421551.1|1179091_1179889_+	DNA replication protein	NA	NA	NA	NA	NA
WP_137421552.1|1179879_1181436_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	36.0	6.5e-65
1187721:1187738	attR	GGGTCTCCTTTGGGTCTC	NA	NA	NA	NA
>prophage 3
NZ_CP039849	Lactobacillus animalis strain LL1 chromosome, complete genome	2280577	1205761	1309644	2280577	head,tRNA,tail,portal,terminase,capsid,protease,holin,integrase	Lactobacillus_phage(29.41%)	98	1308967:1308989	1309680:1309702
WP_137421573.1|1205761_1206667_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004047989.1|1206753_1207119_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_137421574.1|1207143_1209465_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.1	1.6e-22
WP_089135801.1|1209537_1209852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010689155.1|1209841_1210141_-	YlxR family protein	NA	NA	NA	NA	NA
WP_137421575.1|1210152_1211310_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004047998.1|1211339_1211810_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_137421576.1|1211969_1213325_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_137421577.1|1213334_1218431_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_137421578.1|1218412_1220731_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_137421579.1|1220819_1223255_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_137421580.1|1223251_1223578_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_137421581.1|1223588_1223909_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_137421582.1|1223919_1224819_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_137421583.1|1224835_1226113_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_137422604.1|1226324_1227512_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_137421584.1|1227552_1228032_-	ParB N-terminal domain-containing protein	NA	L0P6I1	Lactobacillus_phage	44.3	1.5e-31
WP_137421585.1|1228110_1234557_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_137421586.1|1235531_1235648_-	XkdX family protein	NA	NA	NA	NA	NA
WP_137421587.1|1235640_1235925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421588.1|1235929_1236967_-	collagen-like protein	NA	NA	NA	NA	NA
WP_137421589.1|1236976_1238332_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	48.0	8.7e-106
WP_137421590.1|1238337_1238682_-|holin	phage holin	holin	E3W8H7	Leuconostoc_phage	42.3	9.8e-14
WP_137421591.1|1238699_1238987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421592.1|1239028_1239934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421593.1|1239940_1240450_-	Ig-like domain-containing protein	NA	A0A1P8BL30	Lactococcus_phage	43.2	4.5e-07
WP_135941761.1|1240465_1240597_-	XkdX family protein	NA	NA	NA	NA	NA
WP_137421594.1|1240598_1240979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421595.1|1240997_1241465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421596.1|1241481_1242387_-	hypothetical protein	NA	A0A1X9IGH6	Lactococcus_phage	41.4	3.2e-19
WP_137422605.1|1242383_1243166_-|holin	holin	holin	A0A1U9WQS3	Geobacillus_phage	33.2	2.3e-18
WP_137421597.1|1244299_1245061_-|tail	phage tail protein	tail	Q6SEC3	Lactobacillus_prophage	38.7	7.4e-46
WP_137421598.1|1245060_1249371_-|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	46.7	1.2e-79
WP_137421599.1|1249360_1249675_-	hypothetical protein	NA	A0A1B0Y2Q4	Lactobacillus_phage	32.1	1.5e-05
WP_137421600.1|1249701_1250103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421601.1|1250176_1250692_-|tail	phage major tail protein, TP901-1 family	tail	C9W9I5	Streptococcus_virus	47.7	1.7e-33
WP_137421602.1|1250706_1251099_-	hypothetical protein	NA	A0A2P1JTV2	Anoxybacillus_phage	39.2	4.7e-20
WP_137421603.1|1251095_1251464_-	hypothetical protein	NA	A0A2P1JTW2	Anoxybacillus_phage	41.4	5.2e-13
WP_137421604.1|1251441_1251759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421605.1|1251758_1252088_-|head,tail	phage head-tail connector protein	head,tail	A0A1P8BKW2	Lactococcus_phage	36.3	2.0e-11
WP_137421606.1|1252093_1252924_-|capsid	N4-gp56 family major capsid protein	capsid	D7RWD0	Brochothrix_phage	58.9	2.7e-81
WP_137421607.1|1252925_1253543_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_137421608.1|1255566_1256973_-|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	39.2	1.3e-83
WP_137421609.1|1256984_1258244_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0A1ELG3	Lactobacillus_phage	75.4	1.2e-186
WP_137421610.1|1258233_1258653_-|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	57.5	2.9e-28
WP_137421611.1|1259195_1259696_-	DUF1492 domain-containing protein	NA	B8R690	Lactobacillus_phage	34.0	2.6e-15
WP_137421612.1|1259726_1260101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421613.1|1260097_1260313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137422606.1|1260691_1261099_-	RusA family crossover junction endodeoxyribonuclease	NA	D7RWH1	Brochothrix_phage	47.0	1.3e-28
WP_137421614.1|1261168_1261390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421615.1|1261394_1261589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421616.1|1261669_1261921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421617.1|1261921_1262353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421618.1|1262358_1262559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421619.1|1262599_1262842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421620.1|1262845_1263631_-	ATP-binding protein	NA	B4XYS7	Lactobacillus_phage	45.6	4.0e-47
WP_137421621.1|1263636_1264404_-	helix-turn-helix domain-containing protein	NA	B8R680	Lactobacillus_phage	58.8	5.9e-27
WP_137421622.1|1264477_1264771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421623.1|1264933_1265755_-	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	57.0	3.2e-87
WP_137421624.1|1265759_1266764_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	61.6	7.9e-72
WP_137421625.1|1266768_1267041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421626.1|1267045_1267366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421627.1|1267677_1268040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137421628.1|1268036_1268318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421629.1|1268396_1268582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421630.1|1268598_1268844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421631.1|1268857_1269571_-	hypothetical protein	NA	A0A059NT90	Lactococcus_phage	46.4	7.2e-51
WP_135998244.1|1269567_1269774_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.0	5.9e-06
WP_137421632.1|1270006_1270405_+	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	41.7	1.9e-13
WP_137421633.1|1270417_1270846_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_137421634.1|1270907_1271360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137421635.1|1271437_1272628_+|integrase	site-specific integrase	integrase	A9D9I9	Lactobacillus_prophage	32.8	2.9e-49
WP_137421636.1|1272742_1277086_-	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	27.3	5.6e-13
WP_137421637.1|1277155_1278877_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_137421638.1|1278904_1280179_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_137421639.1|1280212_1281001_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_137421640.1|1281004_1281781_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	51.2	1.7e-26
WP_137421641.1|1281886_1282450_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_010689163.1|1282458_1283181_-	UMP kinase	NA	NA	NA	NA	NA
WP_004048014.1|1283394_1284273_+	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	33.9	9.2e-16
WP_004048016.1|1284460_1284742_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_137421642.1|1284764_1285091_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_004048019.1|1285112_1285421_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_137421643.1|1286577_1287249_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_010689167.1|1287245_1287578_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_029507329.1|1287567_1288443_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_137421644.1|1293543_1297476_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_137421645.1|1299860_1300058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137421646.1|1300668_1300863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421647.1|1300927_1301407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421648.1|1301576_1302086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137421649.1|1302257_1302593_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_137421650.1|1302592_1302865_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_137421651.1|1302993_1303461_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	34.5	1.2e-17
WP_137421652.1|1303776_1304847_-	DNA/RNA helicase	NA	F2Y298	Organic_Lake_phycodnavirus	27.8	1.2e-17
WP_137422607.1|1304809_1308058_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_137421653.1|1308050_1308956_-	restriction endonuclease	NA	NA	NA	NA	NA
1308967:1308989	attL	AGGCGTCATTTTTACCCAGTGAC	NA	NA	NA	NA
WP_137421654.1|1309047_1309644_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	37.6	6.2e-24
WP_137421654.1|1309047_1309644_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	37.6	6.2e-24
1309680:1309702	attR	GTCACTGGGTAAAAATGACGCCT	NA	NA	NA	NA
