The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	4366	56399	3384950	transposase,terminase,integrase	unidentified_phage(22.22%)	56	43389:43404	60142:60157
WP_136408957.1|4366_4831_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_136408956.1|4834_6376_+	hypothetical protein	NA	H7BVH1	unidentified_phage	32.8	1.7e-60
WP_104403764.1|6414_6645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408955.1|6656_7088_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_136408954.1|7121_8081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408953.1|8080_8719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408952.1|8723_9962_+	DUF935 family protein	NA	A0A2H4JAU9	uncultured_Caudovirales_phage	36.6	1.7e-15
WP_136409202.1|10174_11476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403612.1|11605_11818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403613.1|11830_12301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408951.1|12302_12905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403615.1|12949_13198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104403616.1|13286_13505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408950.1|13509_14022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408949.1|14183_14453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168182134.1|14456_15677_-	DNA cytosine methyltransferase	NA	W8CQ31	Croceibacter_phage	39.9	1.4e-62
WP_136408947.1|15684_16152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408946.1|16164_16818_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_136408945.1|16843_17698_-	ATP-binding protein	NA	A0A0M3LP72	Mannheimia_phage	27.4	7.3e-10
WP_136408944.1|17729_19679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408943.1|20188_20584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408942.1|20583_20808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408941.1|20811_21225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107033041.1|21324_21759_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_168189995.1|22640_23555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408939.1|23589_24834_+	DUF4876 domain-containing protein	NA	NA	NA	NA	NA
WP_136408938.1|24860_26399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408937.1|26463_27366_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.8e-11
WP_136408936.1|27376_28048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408935.1|28064_29312_+	DUF4857 domain-containing protein	NA	NA	NA	NA	NA
WP_123399272.1|29352_29955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408934.1|30145_30595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168182132.1|30967_31969_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_136408932.1|32714_32924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408931.1|33104_34364_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	22.1	1.7e-07
WP_136408930.1|35044_37705_-	calcium-translocating P-type ATPase, PMCA-type	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	33.6	7.7e-106
WP_107033291.1|37783_38209_-	hypothetical protein	NA	W8D065	Erwinia_phage	34.7	3.1e-09
WP_136408929.1|38314_40300_-	SWF/SNF helicase family protein	NA	NA	NA	NA	NA
WP_136409147.1|40417_40915_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_123611188.1|41013_41406_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124076362.1|41829_42387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076360.1|42808_43540_+	hypothetical protein	NA	NA	NA	NA	NA
43389:43404	attL	ATGACAGTGCATTGAT	NA	NA	NA	NA
WP_124076375.1|43787_44027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076359.1|44023_44413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408928.1|44409_44946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123485472.1|44942_45509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076569.1|45519_46158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076567.1|46161_47271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076565.1|47346_48162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076563.1|48145_48481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136409201.1|48619_49756_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_136408927.1|50162_51173_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_124076073.1|51265_52162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124076071.1|52667_54203_-	DUF1186 domain-containing protein	NA	NA	NA	NA	NA
WP_124076069.1|54275_55310_-	Fic family protein	NA	NA	NA	NA	NA
WP_136408456.1|55415_56399_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	7.4e-22
60142:60157	attR	ATGACAGTGCATTGAT	NA	NA	NA	NA
>prophage 2
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	248445	256430	3384950	transposase,tRNA	Clostridium_phage(16.67%)	7	NA	NA
WP_107030980.1|248445_250653_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	65.3	1.5e-288
WP_107030981.1|250687_251164_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2R2ZH61	Clostridioides_phage	46.6	2.4e-34
WP_107030982.1|251209_251992_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	30.0	1.6e-11
WP_107030983.1|251988_252738_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_107030984.1|252861_254235_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	31.6	2.3e-45
WP_136408456.1|254378_255362_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	7.4e-22
WP_107030985.1|255575_256430_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.8	2.7e-20
>prophage 3
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	344477	374014	3384950	transposase,tail,terminase	Mannheimia_phage(20.0%)	43	NA	NA
WP_107031768.1|344477_344759_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_136408822.1|344936_346172_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_107037111.1|346202_346574_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_137426162.1|346548_347331_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_133166564.1|347391_347835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107033230.1|348115_348496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137426163.1|348627_349041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426164.1|349044_349269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426165.1|349268_349664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426166.1|350117_352124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403624.1|352155_353010_+	ATP-binding protein	NA	A0A0M3LP72	Mannheimia_phage	27.4	5.6e-10
WP_104403623.1|353035_353689_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_104403622.1|353701_354169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133159437.1|354176_354407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403620.1|354409_354703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403619.1|354699_355089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168189997.1|355085_355253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403618.1|355275_355542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426167.1|355703_356216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426168.1|356220_356427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426169.1|356515_356764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408951.1|356808_357411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104403613.1|357412_357883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104403612.1|357895_358108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136409202.1|358237_359539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408952.1|359751_360990_-	DUF935 family protein	NA	A0A2H4JAU9	uncultured_Caudovirales_phage	36.6	1.7e-15
WP_136408953.1|360994_361633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408954.1|361632_362592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408955.1|362625_363057_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_104403764.1|363068_363299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408956.1|363337_364879_-	hypothetical protein	NA	H7BVH1	unidentified_phage	32.8	1.7e-60
WP_136408957.1|364882_365347_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_136408958.1|365673_366627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426153.1|366650_367736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408960.1|367742_368249_+	lysozyme	NA	W8CPL1	Croceibacter_phage	47.3	6.9e-40
WP_136408961.1|368255_368702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408962.1|368874_369102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408963.1|369115_369472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408964.1|369471_370659_+	DUF2586 family protein	NA	NA	NA	NA	NA
WP_136408965.1|370678_371137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408966.1|371202_371562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104403993.1|371585_371789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408967.1|371806_374014_+|tail	phage tail tape measure protein	tail	E2ELJ5	Clostridium_phage	23.2	2.6e-06
>prophage 4
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	645457	691964	3384950	transposase,integrase	Bacillus_phage(50.0%)	44	665373:665418	681674:681719
WP_123400536.1|645457_646717_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.7	5.5e-30
WP_124076045.1|647457_648807_+|integrase	integrase catalytic domain-containing protein	integrase	NA	NA	NA	NA
WP_107036805.1|648852_650025_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	35.6	7.1e-64
WP_124076043.1|650175_650679_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_124076042.1|650769_651213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076041.1|651209_653678_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_124076040.1|653665_654637_+	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_124076039.1|654646_655174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076038.1|655184_655625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076037.1|655651_656083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076036.1|656091_656700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076035.1|656725_657712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076034.1|657763_658798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076033.1|658800_659814_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_124076032.1|659810_660161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136409058.1|660377_660662_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_124076030.1|660880_661963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076029.1|662053_663427_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_160631921.1|663407_663740_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124076028.1|664120_665125_-	hypothetical protein	NA	NA	NA	NA	NA
665373:665418	attL	AGGTGGTCCCACTTGGGCTTGAACCAAGGACTCCCTGATTATGAGT	NA	NA	NA	NA
WP_168190001.1|665655_667008_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_136409060.1|667216_668485_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_136409061.1|668553_668892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168190002.1|669113_669290_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136409063.1|669557_670685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136409064.1|670923_671253_+	DUF3853 family protein	NA	NA	NA	NA	NA
WP_136409065.1|671249_672293_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_136409066.1|672379_673267_+	DNA primase	NA	NA	NA	NA	NA
WP_168182153.1|673253_673742_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_136409068.1|673926_674313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136409069.1|674293_675250_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_136409070.1|675252_675996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136409071.1|676284_678321_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_136409072.1|678473_679892_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.1	2.6e-20
WP_136409073.1|679881_680562_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	6.0e-31
WP_136409074.1|680570_681362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168190003.1|681436_681610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076321.1|681968_683474_-	potassium/proton antiporter	NA	NA	NA	NA	NA
681674:681719	attR	AGGTGGTCCCACTTGGGCTTGAACCAAGGACTCCCTGATTATGAGT	NA	NA	NA	NA
WP_124076309.1|683650_684403_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_136409075.1|684534_685746_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_124076461.1|685920_688173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136409076.1|688169_688730_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_124076457.1|689077_690487_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_136409207.1|690827_691964_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	777060	893572	3384950	transposase,tRNA,integrase	unidentified_phage(11.76%)	106	816704:816730	864882:864897
WP_168182158.1|777060_777690_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_136409136.1|777945_778356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136409137.1|778352_778667_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_124029396.1|779523_780756_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.3	1.2e-29
WP_123550669.1|780821_781112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124029395.1|781089_781344_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124029394.1|781604_783140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124029393.1|783361_784783_-	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_123618588.1|784808_785171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124029392.1|785175_785397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168182160.1|785885_787160_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_168182162.1|787334_788213_-	GLPGLI family protein	NA	NA	NA	NA	NA
WP_123486669.1|788254_790606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168182164.1|790839_792057_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_123486671.1|792043_792736_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	2.7e-26
WP_124030620.1|792808_798550_-	N-6 DNA methylase	NA	A0A248SL14	Klebsiella_phage	25.3	1.5e-146
WP_123550740.1|798539_798992_-	DUF1896 family protein	NA	NA	NA	NA	NA
WP_124030619.1|799021_801022_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_124030618.1|801048_802380_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_124030617.1|802358_802781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123486677.1|803929_804688_+	ParA family protein	NA	NA	NA	NA	NA
WP_123550736.1|804692_805109_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_123486679.1|805130_805421_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_124030615.1|805420_806152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123486691.1|806255_806552_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_124030614.1|806565_806883_+	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_124030613.1|806879_809381_+	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_124030612.1|809533_810172_+	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_124030622.1|810212_811211_+	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
WP_123486682.1|811229_811853_+	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_124030611.1|811860_812187_+	DUF3989 domain-containing protein	NA	NA	NA	NA	NA
WP_124030610.1|812131_813352_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_124030609.1|813378_814401_+	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_124030608.1|814404_814986_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_124030607.1|814990_815413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124030606.1|815416_816283_+	DNA primase	NA	NA	NA	NA	NA
WP_136408028.1|816295_816748_+	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
816704:816730	attL	TCTAATGTGGCGATGACATTTATGTTT	NA	NA	NA	NA
WP_136408029.1|816843_818469_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	26.2	1.4e-09
816704:816730	attL	TCTAATGTGGCGATGACATTTATGTTT	NA	NA	NA	NA
WP_123487153.1|818465_819419_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_123487154.1|819411_820431_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	25.2	6.9e-07
WP_136408030.1|820463_820658_+	hypothetical protein	NA	NA	NA	NA	NA
820514:820540	attR	AAACATAAATGTCATCGCCACATTAGA	NA	NA	NA	NA
WP_136408031.1|820654_821140_+	lysozyme	NA	NA	NA	NA	NA
820514:820540	attR	AAACATAAATGTCATCGCCACATTAGA	NA	NA	NA	NA
WP_124030603.1|821190_822117_-	caspase family protein	NA	NA	NA	NA	NA
WP_124030602.1|822236_822602_-	caspase family protein	NA	NA	NA	NA	NA
WP_124030601.1|822609_823863_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_124030600.1|824410_824728_-	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	39.8	4.5e-13
WP_107033526.1|824735_824960_-	DUF3873 domain-containing protein	NA	NA	NA	NA	NA
WP_124030599.1|824971_825229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408032.1|825282_826575_-	PcfJ-like protein	NA	NA	NA	NA	NA
WP_136408033.1|826587_827025_-	PcfK-like protein	NA	NA	NA	NA	NA
WP_068959945.1|827037_827265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408034.1|827277_827493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168181922.1|827775_827913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123618502.1|828241_829396_+	ATP-binding protein	NA	V9QJ85	Oenococcus_phage	32.6	2.9e-09
WP_136408035.1|829398_829947_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_136408036.1|830650_831067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123615087.1|831080_831881_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_107037111.1|832020_832392_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_136408037.1|832422_833325_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.3	1.3e-28
WP_160631964.1|834273_834528_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_136408038.1|834524_835730_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_136408039.1|835883_837011_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_136408040.1|837007_837676_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_136408041.1|837679_838930_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_123475616.1|839144_840410_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_136408042.1|840414_842643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408043.1|842639_843845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408044.1|843926_845153_-|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	35.5	5.5e-43
WP_168190004.1|846551_847826_-	PcfJ-like protein	NA	NA	NA	NA	NA
WP_168181926.1|847839_848283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408047.1|848304_848517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408048.1|849213_850554_+	AAA family ATPase	NA	V9QJ85	Oenococcus_phage	22.9	1.5e-17
WP_136408049.1|850555_851269_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_136408050.1|851281_851578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123615087.1|852551_853352_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_107037111.1|853491_853863_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_136409146.1|853921_854218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128715094.1|854223_854562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123618638.1|854579_855179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408051.1|855375_855570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408052.1|855812_857165_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_136408053.1|857216_858332_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	38.4	1.8e-72
WP_136408054.1|860574_860850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408055.1|861598_861910_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_136408056.1|861909_862938_+	AAA family ATPase	NA	Q5ZGH5	Flavobacterium_phage	33.9	2.3e-26
WP_136408057.1|863034_863781_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_136408058.1|864004_864376_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_136408059.1|864379_865441_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_136408060.1|865931_869336_+	helicase	NA	A0A2K5B253	Erysipelothrix_phage	24.1	3.3e-45
WP_136408061.1|869325_872601_+	SAM-dependent methyltransferase	NA	A0A2R2ZGH5	Clostridioides_phage	24.2	5.7e-10
WP_136408062.1|872593_873598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408063.1|873597_874047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168181930.1|874125_874281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408065.1|875370_877065_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_136408066.1|877368_879069_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	55.4	9.7e-171
WP_136408067.1|879095_880619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076504.1|880990_882091_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_107031623.1|882250_883594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408068.1|883733_885149_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_123398298.1|885377_887027_+	putative transporter	NA	NA	NA	NA	NA
WP_107031625.1|887137_888082_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.0	8.6e-44
WP_136408069.1|888134_890294_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_168181931.1|890812_891250_-	GtrA family protein	NA	NA	NA	NA	NA
WP_107031628.1|891246_891867_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_136408071.1|891859_892498_-	endonuclease III	NA	NA	NA	NA	NA
WP_123398248.1|892552_893572_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	31.9	7.1e-28
>prophage 6
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	911229	989319	3384950	transposase,protease,integrase	uncultured_virus(20.0%)	54	981993:982013	997909:997929
WP_136409147.1|911229_911727_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_136408189.1|911863_913090_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	35.2	2.5e-43
WP_124076708.1|913189_914416_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	35.5	1.9e-43
WP_107031643.1|914508_915531_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_124075679.1|915570_916119_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_160630362.1|916244_917762_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_136408076.1|917858_920465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408077.1|920490_922497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408078.1|922542_924258_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_107031649.1|924291_927471_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_168181937.1|927907_931951_+	response regulator	NA	W8CYF6	Bacillus_phage	28.2	4.0e-21
WP_123398264.1|932147_935024_+	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_123398265.1|935067_937593_+	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	25.6	8.8e-27
WP_168181939.1|937600_939814_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_107031654.1|940104_941418_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_136408079.1|941525_943007_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	22.1	6.5e-30
WP_107031656.1|943155_944766_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_136408080.1|944839_945493_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_123398270.1|945585_946512_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_124075683.1|946744_947098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123398271.1|947182_948028_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	50.0	1.7e-06
WP_107031661.1|948196_949177_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_123398272.1|949224_949890_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	4.2e-37
WP_136408081.1|949879_950572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107031664.1|950773_951004_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_124075684.1|951080_952163_+	3-methyl-2-oxobutanoate dehydrogenase subunit VorB	NA	NA	NA	NA	NA
WP_123398275.1|952172_952946_+	2-oxoglutarate oxidoreductase	NA	NA	NA	NA	NA
WP_123398276.1|952978_953512_+	2-oxoglutarate ferredoxin oxidoreductase subunit gamma	NA	NA	NA	NA	NA
WP_136408082.1|953673_955428_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	46.3	8.3e-16
WP_123398277.1|955501_956404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123398278.1|956479_957361_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	35.1	3.3e-13
WP_123398279.1|957392_958160_-	ParA family protein	NA	Q8JL10	Natrialba_phage	36.7	9.8e-22
WP_124076708.1|958353_959580_-|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	35.5	1.9e-43
WP_136408083.1|959804_961253_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_136408084.1|961543_962893_+	gliding motility-associated protein GldE	NA	NA	NA	NA	NA
WP_136408085.1|962898_963486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408086.1|963488_964043_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_107031676.1|964254_967146_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	9.4e-33
WP_107031677.1|967402_967669_+	DUF4492 domain-containing protein	NA	NA	NA	NA	NA
WP_136408087.1|967764_969315_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_136408088.1|969347_970475_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_136408089.1|970585_971716_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.6	5.9e-07
WP_136408090.1|971729_973451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408281.1|973938_974481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408280.1|974553_974799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168181969.1|975109_976201_+	hypothetical protein	NA	H9YSG6	environmental_Halophage	30.5	2.2e-06
WP_136408278.1|976226_977108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168181967.1|977120_977288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408091.1|977768_979067_-	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_136408092.1|979209_981465_+	alpha-xylosidase	NA	NA	NA	NA	NA
981993:982013	attL	CCATCCGGAGCGGTAAATCGG	NA	NA	NA	NA
WP_137426179.1|982120_985438_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_124075690.1|985803_987096_+|integrase	site-specific integrase	integrase	A0A2I6UGM5	Salinibacter_virus	21.3	2.8e-05
WP_124075691.1|987361_988507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124075692.1|988617_989319_+|protease	CAAX protease	protease	NA	NA	NA	NA
997909:997929	attR	CCATCCGGAGCGGTAAATCGG	NA	NA	NA	NA
>prophage 7
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	1894303	1972106	3384950	transposase,protease,tRNA	Thermus_phage(11.11%)	60	NA	NA
WP_107037111.1|1894303_1894675_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_107037112.1|1894814_1895615_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_136408385.1|1895747_1896098_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_136408386.1|1896078_1896390_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_136408387.1|1896663_1898118_-	BACON domain-containing protein	NA	NA	NA	NA	NA
WP_136408388.1|1898130_1899420_-	DUF4302 domain-containing protein	NA	NA	NA	NA	NA
WP_136408389.1|1899441_1900335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123398149.1|1900392_1901985_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_137426194.1|1902007_1905301_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_136408390.1|1905960_1906407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124075823.1|1906419_1906899_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_123398153.1|1906898_1907315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107032333.1|1907406_1908255_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_107032332.1|1908396_1909272_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_136408391.1|1909357_1910461_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	34.9	9.5e-18
WP_107032330.1|1910524_1910923_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_136408392.1|1910950_1912618_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	24.1	1.1e-25
WP_136408393.1|1912930_1914556_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_123398157.1|1914724_1915699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123398158.1|1915716_1915965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123398159.1|1916257_1917559_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	5.6e-86
WP_136408394.1|1917599_1918991_-	TolC family protein	NA	NA	NA	NA	NA
WP_136408395.1|1918987_1922095_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_123398161.1|1922099_1923380_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_136408396.1|1923971_1925042_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	41.8	3.2e-71
WP_136408397.1|1925060_1925981_+	3-phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.5	4.5e-13
WP_107033165.1|1932245_1933277_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_107033166.1|1933285_1934668_+	bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_107033167.1|1934712_1935489_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_136408398.1|1935569_1936547_+	hypothetical protein	NA	A0A2P0VMP9	Tetraselmis_virus	29.5	3.0e-07
WP_133166560.1|1936543_1937104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107033170.1|1937174_1937627_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	51.1	6.1e-32
WP_124075928.1|1937633_1938179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107033172.1|1939120_1939807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107033173.1|1939817_1940117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075927.1|1940113_1942279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075926.1|1942765_1944076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107033176.1|1944244_1944751_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_107033177.1|1944747_1945284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123398827.1|1945343_1945937_+	DUF5024 domain-containing protein	NA	NA	NA	NA	NA
WP_107033179.1|1946038_1947025_-	ROK family protein	NA	NA	NA	NA	NA
WP_107033180.1|1947151_1948168_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	32.8	4.1e-07
WP_123398825.1|1948253_1949747_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_123398824.1|1950012_1950435_+	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_123398823.1|1950482_1951355_+	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_123398822.1|1951359_1952706_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_137426195.1|1952897_1954094_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_107033186.1|1954165_1955461_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	38.3	4.6e-72
WP_123398820.1|1956273_1957353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408399.1|1957448_1958039_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_123398818.1|1958328_1959360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123398817.1|1959635_1961744_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_123398816.1|1961848_1963063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107032384.1|1963059_1964001_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_107032439.1|1963987_1964722_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_123398815.1|1965041_1966124_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_123398831.1|1966240_1969327_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_136408402.1|1969403_1970723_+	TolC family protein	NA	NA	NA	NA	NA
WP_123615087.1|1970794_1971595_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_107037111.1|1971734_1972106_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	2089542	2205440	3384950	transposase,integrase,tRNA	unidentified_phage(16.67%)	91	2180830:2180849	2205536:2205555
WP_124076696.1|2089542_2090766_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_136408438.1|2091323_2092331_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_124076117.1|2092333_2093281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168182016.1|2093285_2093693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408440.1|2093699_2094281_-	radical SAM protein	NA	A0A2H4GY86	Pseudomonas_phage	30.6	4.8e-21
WP_136408441.1|2094323_2094659_-	6-carboxytetrahydropterin synthase	NA	S4U060	uncultured_phage	58.0	1.3e-34
WP_136408442.1|2094707_2096147_-	HD domain-containing protein	NA	B5LJ39	Mycobacterium_phage	31.7	1.6e-36
WP_124076119.1|2096206_2097397_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_160631765.1|2097404_2098292_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_123400389.1|2098724_2099186_+	dCMP deaminase family protein	NA	H6WFU3	Cyanophage	52.0	2.4e-31
WP_123400387.1|2099327_2100953_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.2	5.5e-22
WP_123400385.1|2100976_2101534_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_123400383.1|2101805_2102651_-	ATPase	NA	NA	NA	NA	NA
WP_123400391.1|2102726_2104046_-	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_107031812.1|2104255_2105284_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.9	7.0e-07
WP_123400381.1|2105280_2105985_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_136408443.1|2107158_2108250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408444.1|2108305_2108725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426196.1|2108733_2109636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168182018.1|2110161_2111115_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_137426237.1|2111147_2111903_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_136408447.1|2112006_2114433_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	27.9	1.7e-27
WP_168182021.1|2114584_2114893_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_160632170.1|2115238_2115385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408449.1|2115344_2115626_+	DMT family transporter	NA	NA	NA	NA	NA
WP_068960910.1|2116959_2118183_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_107032970.1|2118435_2118786_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_136408775.1|2119417_2120554_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_124076006.1|2120729_2121467_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_124076007.1|2121636_2122539_-	esterase	NA	NA	NA	NA	NA
WP_124076008.1|2122535_2123318_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_123399472.1|2123326_2125540_-	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_137426197.1|2125597_2127136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076010.1|2127202_2128855_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_136408450.1|2128883_2131850_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_124076011.1|2131865_2133467_-	BACON domain-containing protein	NA	NA	NA	NA	NA
WP_124076012.1|2133499_2134477_-	BACON domain-containing protein	NA	NA	NA	NA	NA
WP_107031794.1|2135018_2135819_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_124076013.1|2136113_2137778_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_136408451.1|2137790_2139062_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_124076014.1|2139082_2140330_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_136409169.1|2140425_2141895_+	MFS transporter	NA	NA	NA	NA	NA
WP_123399500.1|2141950_2142772_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_123399489.1|2142811_2145025_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_107031790.1|2145331_2145835_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_123399491.1|2146249_2146501_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_123399492.1|2146606_2149732_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	35.7	1.4e-167
WP_123399502.1|2149947_2150898_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107031787.1|2150985_2151714_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_123399493.1|2151679_2151865_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_123399494.1|2152268_2153480_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_136408452.1|2153556_2153928_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_107037112.1|2154067_2154868_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_136408775.1|2155505_2156642_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_124076716.1|2156772_2157744_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_136408453.1|2157916_2158702_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	39.1	5.7e-41
WP_124075992.1|2160712_2161732_+	DNA-binding protein	NA	Q331X4	Clostridium_botulinum_C_phage	29.7	1.6e-16
WP_124076005.1|2161724_2162171_+	death-on-curing protein	NA	NA	NA	NA	NA
WP_136408454.1|2162206_2162806_+	molecular chaperone Tir	NA	A0A0S2MYG4	Enterococcus_phage	59.0	1.9e-60
WP_136408455.1|2162807_2164025_+	DUF4071 domain-containing protein	NA	NA	NA	NA	NA
WP_124075997.1|2164134_2165307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124075998.1|2165865_2166921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075999.1|2166932_2167277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076000.1|2167278_2168385_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_124076001.1|2168780_2170064_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.8	2.2e-18
WP_124076002.1|2170129_2171419_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	47.0	2.2e-66
WP_124076003.1|2171430_2172456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076004.1|2172679_2172988_+	DUF3853 family protein	NA	NA	NA	NA	NA
WP_123615854.1|2173002_2174079_+	AAA family ATPase	NA	Q5ZGH5	Flavobacterium_phage	30.3	5.8e-28
WP_123400575.1|2174906_2176115_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.3	7.4e-08
WP_068960000.1|2176107_2177082_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068960001.1|2177065_2178112_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068960910.1|2179536_2180760_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2180830:2180849	attL	GTTTAGCGGACAGTAATAAT	NA	NA	NA	NA
WP_136408456.1|2181410_2182394_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	7.4e-22
WP_065538229.1|2183353_2184493_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_124076267.1|2184995_2185955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024988675.1|2186136_2186451_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124076265.1|2186456_2187869_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_107035600.1|2188429_2188810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076263.1|2188806_2190564_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_124076261.1|2191767_2193231_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_124076259.1|2193505_2194489_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.9	1.3e-21
WP_124076257.1|2194624_2195176_+	SocA family protein	NA	NA	NA	NA	NA
WP_124076255.1|2195172_2195625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408457.1|2197413_2197743_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107033482.1|2197735_2198965_+	helicase	NA	NA	NA	NA	NA
WP_136408458.1|2199375_2200317_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_136408459.1|2200599_2201859_+|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	21.4	8.6e-07
WP_136408460.1|2201869_2202244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160631798.1|2202989_2203832_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_136408462.1|2204216_2205440_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2205536:2205555	attR	GTTTAGCGGACAGTAATAAT	NA	NA	NA	NA
>prophage 9
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	2281176	2357548	3384950	transposase,tRNA	environmental_halophage(12.5%)	58	NA	NA
WP_124076696.1|2281176_2282400_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_136409171.1|2282708_2283179_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_136408477.1|2283500_2284418_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_123399371.1|2284439_2285660_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.9	7.8e-98
WP_123399373.1|2285737_2287087_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_123399375.1|2287083_2287848_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	2.3e-07
WP_123615087.1|2288345_2289146_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_107037111.1|2289285_2289657_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_136408478.1|2289965_2291237_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_136409172.1|2291233_2291719_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_136408479.1|2291888_2292629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408480.1|2292931_2294065_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_136408481.1|2294689_2296783_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_136408482.1|2296805_2297525_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_136408483.1|2297679_2299947_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_168182025.1|2300073_2300229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107032716.1|2300273_2300762_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_107032717.1|2300846_2301923_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.3	3.2e-87
WP_136408484.1|2301919_2302816_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_107032719.1|2302992_2303646_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_136408485.1|2303838_2305167_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	48.5	6.1e-104
WP_137426198.1|2305576_2308045_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_136408487.1|2308212_2309019_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_107032723.1|2309280_2309772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123399320.1|2309855_2312444_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	35.7	1.4e-123
WP_124075568.1|2312664_2313522_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_123399324.1|2313572_2314319_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_107032727.1|2314324_2315041_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_107032728.1|2315115_2315940_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
WP_136408488.1|2316300_2317644_+	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_123399328.1|2317673_2318882_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_107032731.1|2318927_2319644_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit C	NA	NA	NA	NA	NA
WP_107032732.1|2319676_2320303_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_107032733.1|2320352_2320970_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_107032734.1|2321005_2322271_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_136408489.1|2322390_2322975_-	nitroreductase	NA	NA	NA	NA	NA
WP_107032736.1|2323043_2324324_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_136408490.1|2324430_2325861_-	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_124075570.1|2325866_2327450_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_136408491.1|2327669_2330051_-	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_107032740.1|2330255_2331854_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_124075572.1|2331855_2333385_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_123399346.1|2333453_2334149_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_124075573.1|2334211_2335900_-	sodium/solute symporter	NA	A0A219Y9P9	Aeromonas_phage	29.7	1.5e-46
WP_107032744.1|2336009_2337167_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_123399351.1|2337493_2337784_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_123400410.1|2337979_2338810_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_124075574.1|2338841_2340203_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_168182027.1|2341236_2344869_+	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	24.6	1.2e-16
WP_168182029.1|2344928_2345153_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_124075577.1|2345319_2346165_+	glycoside hydrolase family 16 protein	NA	M1HJ43	Acanthocystis_turfacea_Chlorella_virus	27.3	1.0e-11
WP_136408495.1|2346174_2349366_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_136408496.1|2349380_2351048_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_123400445.1|2351068_2352325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136409173.1|2352341_2354648_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_068960910.1|2354808_2356032_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_107037111.1|2356236_2356608_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123615087.1|2356747_2357548_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	2519222	2586196	3384950	transposase,tRNA	Enterobacteria_phage(22.22%)	48	NA	NA
WP_136408532.1|2519222_2522669_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	29.9	4.7e-148
WP_124075789.1|2522779_2523394_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_124075788.1|2523422_2523860_-	TIGR04076 family protein	NA	NA	NA	NA	NA
WP_136408456.1|2524115_2525099_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	7.4e-22
WP_124075787.1|2525417_2526566_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_124075786.1|2526580_2528137_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_124075785.1|2528190_2528961_+	acyltransferase	NA	NA	NA	NA	NA
WP_168182035.1|2528965_2529979_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_107032935.1|2530008_2530404_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_124075783.1|2530502_2531858_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_107032908.1|2532040_2534089_+	1,4-alpha-glucan-branching enzyme	NA	NA	NA	NA	NA
WP_124075782.1|2534212_2535784_-	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_124075781.1|2536086_2538711_+	UvrD-helicase domain-containing protein	NA	A0A1V0SAV1	Catovirus	28.1	1.5e-16
WP_136408534.1|2538842_2540057_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_136408535.1|2540056_2541214_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_124075780.1|2541266_2542862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124075779.1|2542911_2544297_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.7	1.8e-45
WP_136408536.1|2544450_2545716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107032914.1|2545985_2546996_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_107032915.1|2547339_2547765_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_124075777.1|2547890_2548691_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_124075776.1|2548887_2549454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123399448.1|2549504_2551037_-	DUF5605 domain-containg protein	NA	NA	NA	NA	NA
WP_123399466.1|2551054_2553151_-	glycosyl hydrolase 43 family protein	NA	NA	NA	NA	NA
WP_136408537.1|2553174_2554605_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_137426201.1|2554725_2556258_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_136408538.1|2556297_2557809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408539.1|2557844_2559428_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_136408540.1|2559439_2562595_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_123399460.1|2562701_2564201_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_137426202.1|2564314_2568130_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	Q6XLV6	Feldmannia_irregularis_virus	27.3	7.1e-20
WP_107037111.1|2568160_2568532_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123615087.1|2568671_2569472_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_168190010.1|2569485_2569740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408542.1|2570237_2570666_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_136408543.1|2570995_2572132_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.1	1.6e-81
WP_161553598.1|2572133_2572646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408544.1|2572843_2573704_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.8	1.7e-38
WP_136408545.1|2573731_2574310_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	48.9	2.4e-41
WP_107032932.1|2574326_2575232_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.7	1.1e-99
WP_124075517.1|2575497_2577246_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_136408546.1|2577250_2580397_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_136408547.1|2581409_2582099_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_136408548.1|2582653_2583547_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_136408549.1|2583561_2583936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408551.1|2584302_2584854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107037111.1|2584884_2585256_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123615087.1|2585395_2586196_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	2832360	2868580	3384950	transposase,integrase,tRNA	Moraxella_phage(16.67%)	36	2855964:2856023	2874024:2875449
WP_123397995.1|2832360_2833365_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_107032508.1|2833361_2834057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123397994.1|2834146_2834872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408628.1|2834957_2836121_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_124075803.1|2836168_2838124_-	NAD(+) synthase	NA	NA	NA	NA	NA
WP_136408629.1|2838249_2838615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408630.1|2838611_2839703_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_160630832.1|2840224_2842612_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.4	1.9e-156
WP_136408632.1|2842658_2843249_+	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_107032516.1|2843251_2844322_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	8.1e-06
WP_123397989.1|2844428_2845307_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_107032518.1|2845324_2845612_+	DUF3098 domain-containing protein	NA	NA	NA	NA	NA
WP_123397988.1|2845644_2846463_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_107032520.1|2846485_2847211_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_107032521.1|2847602_2848655_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_123397987.1|2848712_2849345_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.9	8.9e-21
WP_123397986.1|2849443_2850391_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_123397985.1|2850387_2851266_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_107032525.1|2851321_2852167_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_136409184.1|2852289_2853285_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_107032526.1|2853391_2853727_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136408633.1|2854078_2855989_-	TonB-dependent receptor	NA	NA	NA	NA	NA
2855964:2856023	attL	CGGGTCAAGCCGAAAGCACGGTGCATGAATTTTGAGAAAAGTGTTAAATTTGTGGCATGA	NA	NA	NA	NA
WP_107037111.1|2856019_2856391_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123615087.1|2856530_2857331_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_136408634.1|2857344_2857593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408635.1|2857737_2858721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107032529.1|2859016_2859655_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_107032530.1|2859667_2859958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107032569.1|2860011_2860524_-	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	37.9	1.7e-17
WP_107032531.1|2860895_2861057_-	rubredoxin	NA	NA	NA	NA	NA
WP_016564205.1|2861341_2862577_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.3	5.4e-30
WP_016564204.1|2862595_2862985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016564203.1|2863295_2864537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068960001.1|2865374_2866421_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068960000.1|2866404_2867379_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_123400575.1|2867371_2868580_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.3	7.4e-08
2874024:2875449	attR	TCATGCCACAAATTTAACACTTTTCTCAAAATTCATGCACCGTGCTTTCGGCTTGACCCGTTTATTCATCAAACGGTTAGACGAAACCGTTCAGAATTTAAAATAGTTGAATTAATTTGTCAATGGCTATAACACCGGAGATGTCTGATTTGTTTATTGATGCTGATGGAAAAATTCCTTGATCTTTTAGTCCTCTGAATAGATCGAATTTCCATGCCTTGTTGATAGACCGGTATACCGGTAGCTTGTTTTTTTGCAAATGGGGGAGGGAGAAGTTGTTGATCTATAACGAAACAAACTTCTTGGTAAGGTGCATACCTGTCGGTAAGTTGTTGGTTTATTTTGGGTTCCATGTAATTTCGCAGTGTGAAAATAATAGGAACAAGATTGAAAATTAGTTAGACAATGAAAAAAGTAATAGTAATCAATGGCAGCCCCAGGCGTAATGGAAACACTCTTCGTATGGCTGATTCAGTGGTTGCCGGTATTCAAACTGTGCTTTCGGAAGTAGAGGTGAAGTGGTATGATCTTTATGAATTCAGGTATAGTGGATGTCGCAGTTGTTTTGCCTGTAAAGCGAAGGATGGTGGTAGCTATGGACGATGTGTGATTGGCGATGATTTGTCAGCAGTGCTTGACCAGATCGCCGATGCAGATTGCCTGATAGTTGCATCGCCAGTATATCTTATGGATGTAAGCGGTCAGACACGGAGCTTTGCCGAGCGGTTGTGTTTCTCGTTGGGCTCATATGAAAAGGGCTACCGGTCGCTTGCGAAGAAAAATATGCCTGTCGTAACGGTCTACACCATGAATGCACTACCAGAAATGGCCTCCTACAGGGCATTTGATAATATAGAATACTTCCTTGGACATATATTTTCACTACCACGGCGCCTGTGTGCACTCAATACTTATCAATTTCAGGATTATACCAAATATGTAGTCGAGACATTCTCCGAGCTGGAAAAGGCATACTGGCGTGACGTGCATTTTAAGGATGATTTGCAAGCAGCTTTTGATGCGGGCAAAGATATCGCCGGACAATTGCATGAAGGGTAGGGGACGGCGAAAGTCAGTTTCGGGCTTGTTTTTTTATATTGTTGTCATCGACATACGGCCCGGATGTCAAAAAAACAGAAATAATGACTCCCAAAAAATCGCATATGAAATAAGTTTGCAATTGTGACAGATATAAATGAATGTTTTTGTCTGGAAGAATCAGTTTGTGCGGTTGATGATGCTGGTCTTACTGGCAATCATCTGATGTATAATGTGTTGCTGCTCATATGAACGGTGCGGAATGATCTTGAACACTGAGTTGAGAAGATAAATGCGAAAAGAAAAACGAAAAGAAAAATCATTTTTTTGAAAAAAATATTCAAAAATATTTGCATGATTAAAAAAAACTCTCTACCTTTGCATCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	2872715	2910038	3384950	transposase,capsid,integrase	unidentified_phage(75.0%)	47	2885497:2885511	2916999:2917013
WP_123615087.1|2872715_2873516_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_107037111.1|2873655_2874027_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_124076480.1|2874428_2875082_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_123543107.1|2875784_2876774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160631494.1|2877148_2877466_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_136408637.1|2877440_2878820_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_107036991.1|2878910_2879996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408638.1|2879992_2880472_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_124076417.1|2880657_2881044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124076415.1|2881024_2881981_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_124076413.1|2881983_2882721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107036996.1|2882877_2885289_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_123475526.1|2885285_2885750_+	hypothetical protein	NA	NA	NA	NA	NA
2885497:2885511	attL	ATGTTAAGAATTTCA	NA	NA	NA	NA
WP_123475524.1|2885739_2887335_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_107036981.1|2887313_2887853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107036982.1|2888397_2888940_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161953445.1|2889121_2889727_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107036983.1|2889729_2889909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161953446.1|2889992_2891339_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_124076222.1|2892095_2892968_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.0	3.3e-05
WP_124076224.1|2893234_2893471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426209.1|2893908_2894391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408640.1|2894515_2894926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408641.1|2894930_2895203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408642.1|2895394_2895613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408643.1|2895621_2895894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408644.1|2895955_2896324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408645.1|2896328_2898332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408646.1|2898357_2899230_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_136409185.1|2899235_2899457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408647.1|2899459_2900086_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_136408648.1|2900086_2900308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408649.1|2900313_2900532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168182060.1|2901002_2901167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408650.1|2901188_2901842_+	DUF3164 family protein	NA	NA	NA	NA	NA
WP_136408651.1|2901853_2902048_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_136408652.1|2902051_2902300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408653.1|2902289_2902847_+	phage morphogenesis protein	NA	NA	NA	NA	NA
WP_136409186.1|2902933_2903335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408654.1|2903419_2904292_-	DNA adenine methylase	NA	H7BVG3	unidentified_phage	61.2	1.3e-94
WP_136409187.1|2904359_2904566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408775.1|2904698_2905835_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_136408655.1|2906324_2906810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408656.1|2906812_2908117_-	hypothetical protein	NA	H7BVG5	unidentified_phage	72.4	8.7e-180
WP_136408657.1|2908261_2908465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408658.1|2908500_2908734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136409188.1|2908841_2910038_-|capsid	minor capsid protein	capsid	A0A0M3LSH7	Mannheimia_phage	38.7	1.0e-09
2916999:2917013	attR	TGAAATTCTTAACAT	NA	NA	NA	NA
>prophage 13
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	2922604	2951640	3384950	transposase,tRNA,integrase	Staphylococcus_phage(28.57%)	25	2919032:2919047	2951721:2951736
2919032:2919047	attL	CTCCCGGCTTGAAAAA	NA	NA	NA	NA
WP_168182062.1|2922604_2924152_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.6	3.2e-64
WP_123615073.1|2925914_2927300_+|integrase	tyrosine-type recombinase/integrase	integrase	S0A3I4	Cellulophaga_phage	25.1	4.5e-09
WP_123615072.1|2927544_2928156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123615071.1|2928139_2929165_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_123615070.1|2929294_2930224_-|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	26.1	1.1e-22
WP_168182064.1|2930283_2931435_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_136408674.1|2931461_2932085_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_136408675.1|2932077_2933355_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_123615066.1|2933393_2934938_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.6	5.7e-162
WP_123615065.1|2934941_2937761_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_136408189.1|2938023_2939250_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	35.2	2.5e-43
WP_123615064.1|2939436_2940645_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_123615063.1|2940641_2941037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168182066.1|2941216_2941696_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_168182069.1|2941682_2942531_-	DNA primase	NA	NA	NA	NA	NA
WP_123615060.1|2942656_2943700_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_123399146.1|2943687_2944008_-	DUF3853 family protein	NA	NA	NA	NA	NA
WP_136408676.1|2944245_2945334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107037111.1|2945423_2945795_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123615087.1|2945934_2946735_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_124075939.1|2947542_2948748_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_107033491.1|2948935_2949562_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.3	7.7e-33
WP_107033490.1|2949593_2950391_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	3.5e-22
WP_123399154.1|2950604_2951036_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_107033488.1|2951076_2951640_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
2951721:2951736	attR	CTCCCGGCTTGAAAAA	NA	NA	NA	NA
>prophage 14
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	3109560	3173605	3384950	transposase,protease,tRNA	Orpheovirus(12.5%)	49	NA	NA
WP_136408761.1|3109560_3111348_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	28.8	7.5e-49
WP_136408762.1|3111469_3112759_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_136408763.1|3112852_3113512_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.0	3.0e-27
WP_123398625.1|3113530_3115705_-	DNA helicase RecQ	NA	A0A1V0SGM9	Hokovirus	37.0	5.5e-78
WP_107031913.1|3115843_3117118_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	50.2	9.0e-113
WP_107031914.1|3117140_3117827_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	44.8	4.2e-40
WP_136408764.1|3117938_3119276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107031916.1|3119522_3120056_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_107031917.1|3120296_3120557_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_107031918.1|3120579_3120900_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_136408765.1|3121242_3122643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408766.1|3123009_3124026_+	GSCFA domain-containing protein	NA	NA	NA	NA	NA
WP_136408767.1|3124025_3126503_+	bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase	NA	NA	NA	NA	NA
WP_124075748.1|3126579_3127155_+	zeta toxin	NA	NA	NA	NA	NA
WP_107031923.1|3127132_3127342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136408768.1|3127503_3127851_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136409147.1|3127938_3128436_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_123611188.1|3128534_3128927_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_124076506.1|3129488_3129911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076504.1|3130150_3131251_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_124076502.1|3131339_3131978_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_124076500.1|3132085_3132658_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_137426214.1|3134600_3134972_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123615087.1|3135111_3135912_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_136408769.1|3136575_3143970_-	cell surface protein SprA	NA	NA	NA	NA	NA
WP_107032625.1|3144059_3144653_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_123399777.1|3144823_3145225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075973.1|3145328_3146006_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_168182087.1|3146037_3146874_+	glycerol acyltransferase	NA	NA	NA	NA	NA
WP_107032629.1|3146902_3147847_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_136408771.1|3147882_3148914_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	42.6	1.9e-73
WP_136408772.1|3149094_3150798_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_107032632.1|3150816_3151842_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_123399766.1|3151850_3152723_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_137426215.1|3152762_3156467_-	phosphoribosylformylglycinamidine synthase	NA	Q80BR1	Saimiriine_herpesvirus	23.8	1.5e-38
WP_107032635.1|3156694_3157336_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_107032636.1|3157354_3158203_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_107032637.1|3158229_3158703_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_161553583.1|3158733_3158910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075968.1|3158916_3160116_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_124075967.1|3160152_3161736_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_124075966.1|3161751_3162525_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_124075965.1|3162897_3163362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075964.1|3163358_3164084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161553537.1|3165152_3166148_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_124075962.1|3166169_3169253_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.0	1.5e-89
WP_136408774.1|3169280_3170459_+	TolC family protein	NA	NA	NA	NA	NA
WP_168182184.1|3170633_3172175_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_136408775.1|3172468_3173605_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP040121	Duncaniella sp. B8 chromosome, complete genome	3384950	3325078	3376796	3384950	transposase,tail	Tupanvirus(18.18%)	47	NA	NA
WP_107037111.1|3325078_3325450_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123615087.1|3325589_3326390_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_168190014.1|3326407_3326680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123398884.1|3326849_3327314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123398883.1|3327310_3330205_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	47.5	1.2e-248
WP_136408818.1|3330257_3331247_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_123398881.1|3331314_3332625_-	gliding motility-associated C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_160631154.1|3332713_3332878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107031377.1|3332929_3333547_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_160631156.1|3333608_3334685_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_136408820.1|3334830_3336354_-	DUF4301 family protein	NA	NA	NA	NA	NA
WP_107031498.1|3336546_3337281_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4JFN3	uncultured_Caudovirales_phage	27.0	2.3e-12
WP_107031497.1|3337403_3338900_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.9	6.5e-70
WP_123398878.1|3339079_3340462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075623.1|3340458_3341835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075624.1|3341873_3343082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124075625.1|3343078_3344407_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_123398874.1|3344481_3345444_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	39.4	9.8e-19
WP_168182105.1|3345612_3346806_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_107031368.1|3346838_3347192_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_123398872.1|3347247_3348540_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_107031366.1|3348536_3350330_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	4.2e-47
WP_123398871.1|3350372_3350645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123398870.1|3350736_3352011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107031496.1|3352180_3352759_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.7	1.9e-41
WP_107031363.1|3352883_3353834_+	YitT family protein	NA	NA	NA	NA	NA
WP_123398869.1|3353972_3355364_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_123398868.1|3355576_3355858_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_123398867.1|3355854_3356478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107037112.1|3357144_3357945_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_107037111.1|3358084_3358456_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_123398798.1|3358578_3359658_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_123398797.1|3359868_3361374_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.6	9.7e-98
WP_124076395.1|3361551_3362661_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	24.5	5.4e-13
WP_124076396.1|3362791_3363340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124076398.1|3363754_3364474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137426218.1|3365110_3365308_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_137426219.1|3365528_3366299_-	hypothetical protein	NA	H7BW06	unidentified_phage	70.0	2.1e-101
WP_136408975.1|3366866_3368147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137426222.1|3368687_3369608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137426223.1|3369612_3371469_-	hypothetical protein	NA	H7BUL0	unidentified_phage	37.3	2.3e-61
WP_137426224.1|3371471_3371846_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_137426225.1|3371973_3373194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137426226.1|3373248_3373611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136408969.1|3373607_3373886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137426227.1|3373911_3374580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137426228.1|3374588_3376796_-|tail	phage tail tape measure protein	tail	A0A2K9V435	Faecalibacterium_phage	23.5	1.6e-08
