The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038439	Paracoccus sp. 2251 chromosome, complete genome	3271357	993578	1014779	3271357	holin,protease,tRNA	Bacillus_virus(33.33%)	24	NA	NA
WP_135312380.1|993578_994319_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_135312381.1|994474_995110_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	60.0	1.2e-60
WP_135312382.1|995271_996537_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	1.7e-135
WP_135312383.1|996632_997007_+	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_135312384.1|997008_997485_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_135312385.1|997481_997844_+	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_135312386.1|997810_998440_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_135312387.1|998446_999793_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_135312388.1|999797_1000310_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_135312389.1|1000439_1000748_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_135312390.1|1000752_1001514_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_135312391.1|1001647_1002364_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_135312392.1|1002503_1002887_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_135312393.1|1002973_1003792_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	26.8	9.5e-07
WP_135312394.1|1003842_1005018_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_135312395.1|1005132_1005810_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	3.0e-06
WP_135314327.1|1005806_1006925_-	sugar transporter	NA	NA	NA	NA	NA
WP_135312396.1|1007282_1008143_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_135312397.1|1008148_1009159_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	31.6	2.1e-19
WP_135312398.1|1009155_1010004_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_135314328.1|1010069_1011029_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_135312399.1|1011137_1011704_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_135312400.1|1011700_1013146_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_135312401.1|1013132_1014779_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.1	3.9e-60
>prophage 2
NZ_CP038439	Paracoccus sp. 2251 chromosome, complete genome	3271357	1364714	1374575	3271357	protease,portal,capsid,head,tail	Paracoccus_phage(22.22%)	15	NA	NA
WP_135314358.1|1364714_1366109_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	36.6	1.6e-67
WP_135312688.1|1366220_1367420_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	37.8	1.5e-61
WP_135312689.1|1367423_1367654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135312690.1|1367657_1368188_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	51.8	1.8e-35
WP_135312691.1|1368316_1369480_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	40.3	1.3e-62
WP_135312692.1|1369678_1370293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135312693.1|1370292_1370631_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_135312694.1|1370627_1371047_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_135312695.1|1371059_1371473_+|tail	phage major tail protein, TP901-1 family	tail	A0A0C5AMZ4	Paenibacillus_phage	31.0	4.1e-06
WP_135312696.1|1371472_1371787_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_135312697.1|1371783_1372050_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_135314359.1|1372063_1372681_+|tail	phage tail tape measure protein	tail	C0LP53	Escherichia_virus	44.8	3.2e-15
WP_135312698.1|1372694_1373327_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	48.6	5.2e-53
WP_135312699.1|1373323_1374154_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	38.3	1.4e-45
WP_135312700.1|1374146_1374575_+	peptidase	NA	F4YXU4	Roseobacter_phage	47.1	3.2e-30
>prophage 3
NZ_CP038439	Paracoccus sp. 2251 chromosome, complete genome	3271357	1568601	1581427	3271357		Pseudomonas_phage(33.33%)	12	NA	NA
WP_135312864.1|1568601_1569108_-	hypothetical protein	NA	A0A1B0T6I8	Thiobacimonas_phage	43.7	3.6e-12
WP_135314376.1|1569111_1569936_-	DUF3380 domain-containing protein	NA	A0A0A8IK88	Aurantimonas_phage	54.1	2.2e-72
WP_135312865.1|1570277_1570673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135312866.1|1570663_1570843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135312867.1|1570839_1571082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135312868.1|1571170_1571998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135312869.1|1571997_1574202_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.5	2.5e-70
WP_135312870.1|1574201_1574540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135312871.1|1574623_1574923_-	hypothetical protein	NA	A0A0S4L5F0	Pseudomonas_phage	52.9	4.8e-17
WP_135312872.1|1574922_1575615_-	hypothetical protein	NA	A0A1Y0SUE0	Pseudomonas_phage	35.0	8.3e-12
WP_135312873.1|1575662_1576556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135312874.1|1576552_1581427_-	hypothetical protein	NA	A0A2H4JC10	uncultured_Caudovirales_phage	27.6	1.3e-13
>prophage 4
NZ_CP038439	Paracoccus sp. 2251 chromosome, complete genome	3271357	2165956	2241515	3271357	head,terminase,transposase	Acidithiobacillus_phage(23.08%)	57	NA	NA
WP_135313367.1|2165956_2167453_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_135311672.1|2167449_2168214_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.5	9.4e-41
WP_135313368.1|2171224_2171530_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_135313369.1|2171526_2171913_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_135314432.1|2171917_2173582_+|terminase	terminase large subunit	terminase	D0R0D0	Streptococcus_phage	31.0	4.1e-65
WP_135313370.1|2173592_2176130_+	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	38.7	3.6e-52
WP_135313371.1|2176126_2176486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136883980.1|2176519_2176744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135313372.1|2177039_2177312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313373.1|2177308_2177545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313374.1|2177792_2179841_-	bifunctional sugar-binding transcriptional regulator/dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_135313375.1|2179840_2180545_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_135313376.1|2180591_2182343_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_135313377.1|2182360_2183119_-	D-threitol dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	8.5e-10
WP_135313378.1|2183236_2184229_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_135313379.1|2184290_2185334_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_135313380.1|2185383_2186865_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.2	7.0e-08
WP_135312192.1|2187320_2188895_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_135314433.1|2189328_2190741_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	25.1	8.1e-30
WP_135313381.1|2190979_2191525_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_135313382.1|2191615_2192350_-	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.6e-11
WP_135313383.1|2193061_2193310_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_135313384.1|2193356_2194868_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_135313385.1|2194872_2195829_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_135313386.1|2196342_2198028_-	chloride channel protein	NA	NA	NA	NA	NA
WP_135313387.1|2198209_2198965_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_135313388.1|2199073_2200057_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_135313389.1|2200191_2201034_-	hydratase	NA	NA	NA	NA	NA
WP_135313390.1|2201232_2202168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135313391.1|2203353_2204313_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_135313392.1|2204883_2205546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313393.1|2205957_2206143_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_135313394.1|2206215_2207094_+	hypothetical protein	NA	A0A1X9HW69	Ruegeria_phage	47.6	2.0e-23
WP_135313395.1|2207903_2208356_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	44.4	4.0e-23
WP_135313396.1|2208352_2209663_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	53.3	2.1e-120
WP_135313397.1|2209707_2210073_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	39.1	8.0e-14
WP_135313398.1|2210229_2210538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313399.1|2210743_2211847_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_135313400.1|2212116_2212794_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_135313401.1|2213129_2213912_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_135313402.1|2213921_2214971_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.4	4.8e-19
WP_135314434.1|2214993_2216274_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_135313403.1|2216301_2217174_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_135313404.1|2217170_2217971_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_135313405.1|2217981_2218752_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_135313406.1|2218770_2219553_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_135313407.1|2220213_2220957_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_135313408.1|2220953_2221181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313409.1|2221177_2222923_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_135313410.1|2222959_2223205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139615474.1|2223849_2227959_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_135313412.1|2228131_2229709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135313413.1|2229705_2230344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135313414.1|2230354_2231368_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	34.8	1.7e-50
WP_135314351.1|2233016_2234082_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_135313415.1|2234820_2237421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135314435.1|2240448_2241515_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP038439	Paracoccus sp. 2251 chromosome, complete genome	3271357	2251948	2300997	3271357	plate,tail,transposase,integrase	Acidithiobacillus_phage(23.08%)	42	2239333:2239352	2291894:2291913
2239333:2239352	attL	CTGGATCGGCGGCGTCTCGA	NA	NA	NA	NA
WP_135314436.1|2251948_2253015_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_135313421.1|2253110_2254317_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	48.2	6.0e-66
WP_135313422.1|2254325_2256023_+	Error-prone DNA polymerase 2	NA	Q8W6C3	Saccharomonospora_phage	27.6	1.3e-37
WP_135313423.1|2256369_2256594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135313424.1|2258171_2258621_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_135313425.1|2258970_2259411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_135313426.1|2259665_2259851_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_135313427.1|2260261_2260726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313428.1|2260722_2260905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313429.1|2260938_2261391_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	44.4	5.8e-22
WP_135313430.1|2261387_2262698_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	52.9	2.1e-120
WP_135313431.1|2262694_2263108_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	39.1	1.2e-13
WP_139615475.1|2263259_2263571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313433.1|2265089_2267999_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_135313434.1|2268113_2268446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313435.1|2268403_2271460_+	DUF1156 domain-containing protein	NA	K9MDJ7	Sulfolobus_virus	23.1	5.8e-33
WP_135313436.1|2271456_2272770_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_135313437.1|2272810_2276365_+	hypothetical protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	23.8	4.7e-26
WP_135313438.1|2276887_2278162_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	40.8	3.6e-77
WP_135313439.1|2278158_2279034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313440.1|2279138_2279333_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_135313441.1|2279529_2280282_+	helix-turn-helix domain-containing protein	NA	R9TH17	Synechococcus_phage	39.4	5.3e-12
WP_135313442.1|2280271_2280886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135312179.1|2280956_2282228_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.5	1.5e-99
WP_135314437.1|2282766_2282997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313443.1|2283377_2284203_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_135313444.1|2284397_2285849_+	RNA polymerase subunit sigma-54	NA	NA	NA	NA	NA
WP_135313445.1|2286091_2286697_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_135313446.1|2286693_2287347_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_135313447.1|2287385_2289014_+|tail	phage tail sheath family protein	tail	E3SL60	Synechococcus_phage	25.1	6.3e-10
WP_135313448.1|2289026_2289482_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_135313449.1|2289483_2291034_+|tail	phage tail sheath family protein	tail	A0A060AH07	Cronobacter_phage	27.5	5.6e-08
WP_135313450.1|2291030_2291528_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_135313451.1|2291524_2291719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313452.1|2291718_2292411_+	LysM domain-containing protein	NA	NA	NA	NA	NA
2291894:2291913	attR	TCGAGACGCCGCCGATCCAG	NA	NA	NA	NA
WP_135313453.1|2292407_2293550_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_135313454.1|2293546_2294131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135313455.1|2294144_2294531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135314438.1|2294541_2294955_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_135313456.1|2294951_2296931_+	hypothetical protein	NA	A0A1J0GW37	Streptomyces_phage	31.1	4.3e-05
WP_135313457.1|2296927_2298955_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_135313458.1|2298951_2300997_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 1
NZ_CP040765	Paracoccus sp. 2251 plasmid unnamed1, complete sequence	310431	66	42006	310431	transposase	Acidithiobacillus_phage(33.33%)	27	NA	NA
WP_139616468.1|66_1101_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_139616680.1|2300_3653_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.1	1.6e-51
WP_139616469.1|4108_4525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616470.1|4529_6101_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_139616471.1|6097_6844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616472.1|6846_7227_+	response regulator	NA	NA	NA	NA	NA
WP_139616473.1|10225_11071_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	48.9	1.7e-51
WP_139616474.1|11224_11479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135818143.1|11490_12255_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.2	9.3e-65
WP_135312179.1|13125_14397_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.5	1.5e-99
WP_139616681.1|14575_15490_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_139616475.1|15537_16635_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_139616682.1|16631_17801_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_139616476.1|17970_19695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139616477.1|19691_21710_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_139616478.1|21706_23119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139616479.1|23864_24635_-	sugar transferase	NA	NA	NA	NA	NA
WP_139616480.1|27030_28167_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_139616481.1|28163_30836_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_139616482.1|31534_32587_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_139616483.1|32628_33882_+	sugar transporter	NA	NA	NA	NA	NA
WP_139616683.1|33882_35316_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_139616484.1|35315_36458_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_139616485.1|37271_37991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616486.1|38276_39710_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.1	2.6e-52
WP_139616487.1|39887_41026_-|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	32.0	6.5e-22
WP_139616488.1|41076_42006_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP040765	Paracoccus sp. 2251 plasmid unnamed1, complete sequence	310431	93148	139084	310431	transposase	Mycobacterium_phage(36.36%)	35	NA	NA
WP_135312179.1|93148_94420_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.5	1.5e-99
WP_139616530.1|95029_95308_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_139616531.1|95304_96234_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_139616532.1|97241_98219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616533.1|98215_99520_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_139616534.1|99471_101694_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.1	4.0e-31
WP_139616535.1|101635_103210_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.2	1.4e-19
WP_139616536.1|103220_103892_+	response regulator	NA	W8CYM9	Bacillus_phage	35.5	9.1e-32
WP_139616537.1|103988_105512_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_135817455.1|105511_106564_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_139616538.1|106593_107394_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_139616539.1|107598_108297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135817458.1|108347_108839_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_139616540.1|108747_109290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139616541.1|109342_110452_+	S8 family serine peptidase	NA	A0A1V0SBG2	Catovirus	27.9	3.1e-08
WP_135312181.1|110922_112359_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_139616106.1|113530_113758_-	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_139616542.1|113822_114212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616543.1|114465_115521_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_139616544.1|116147_116756_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_139616545.1|117118_117364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616546.1|117555_117945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139616547.1|117941_118295_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	34.7	5.0e-13
WP_135314267.1|119301_120368_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_135312179.1|120897_122169_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.5	1.5e-99
WP_139616693.1|122673_123093_-	response regulator	NA	NA	NA	NA	NA
WP_139616548.1|123206_124244_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_139616549.1|124243_124786_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_139616550.1|126823_127540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139616104.1|130354_131605_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.6	5.4e-102
WP_139616551.1|131933_133421_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_139616552.1|133417_134182_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.3	6.5e-42
WP_139616553.1|134878_135163_-	integration host factor subunit beta	NA	M4SRV7	Rhodobacter_phage	33.3	6.8e-05
WP_135819359.1|135441_135849_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_135312179.1|137812_139084_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.5	1.5e-99
>prophage 3
NZ_CP040765	Paracoccus sp. 2251 plasmid unnamed1, complete sequence	310431	203700	255042	310431	holin,transposase	Bacillus_phage(20.0%)	45	NA	NA
WP_135819204.1|203700_204102_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_139616609.1|204094_204724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139616702.1|205309_205726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616610.1|205829_206675_-	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_139616611.1|206689_207004_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.4	3.5e-10
WP_139616612.1|207519_208119_-	response regulator	NA	NA	NA	NA	NA
WP_135314351.1|211973_213040_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_139616613.1|213589_213784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616614.1|214153_214354_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139616615.1|214545_214773_-	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_139616616.1|215182_215698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616703.1|216062_216350_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_139616617.1|216349_216760_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_139616618.1|216756_217020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139616619.1|217639_219139_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	28.0	6.4e-33
WP_139616620.1|219120_219855_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_139616621.1|219851_220955_-	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_139616622.1|220951_221734_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_139616623.1|221730_222561_-	alpha/beta fold hydrolase	NA	A0A222ZQ08	Mycobacterium_phage	27.2	5.3e-05
WP_139616624.1|222617_223706_-	tricarboxylate transporter	NA	NA	NA	NA	NA
WP_139616625.1|223758_224811_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_139616626.1|224923_225844_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_139616627.1|225840_226923_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_139616704.1|226993_227659_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_139616628.1|228048_228345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616629.1|228407_229502_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_139616630.1|229563_231564_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_139616631.1|231766_232867_-	tricarboxylate transporter	NA	NA	NA	NA	NA
WP_139616632.1|232965_234378_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.5	1.8e-16
WP_139616633.1|234374_235049_-	response regulator	NA	NA	NA	NA	NA
WP_139616634.1|235171_236284_+	tricarboxylate transporter	NA	NA	NA	NA	NA
WP_139616705.1|236267_237251_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	24.1	4.1e-12
WP_139616706.1|238283_239456_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_139616635.1|239660_240119_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_139616707.1|240707_242060_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.9	3.0e-50
WP_139616636.1|242135_242729_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_139616637.1|244688_244925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139616708.1|245041_245635_-	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	43.8	1.7e-29
WP_139616638.1|245819_246578_+	damage-inducible protein	NA	NA	NA	NA	NA
WP_139616639.1|246645_247014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616640.1|247323_248535_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	30.4	7.4e-24
WP_139616641.1|248748_249669_-	ParB/RepB/Spo0J family partition protein	NA	A0A240F4U0	Ochrobactrum_phage	30.6	7.9e-18
WP_139616642.1|249652_250846_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	54.3	2.5e-117
WP_139616643.1|250994_252161_-	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_139616095.1|253398_255042_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP040762	Paracoccus sp. 2251 plasmid unnamed2, complete sequence	244326	8354	62392	244326	transposase,integrase	Mycobacterium_phage(23.08%)	45	15179:15198	56416:56435
WP_139615942.1|8354_9326_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	27.0	4.6e-08
WP_139615943.1|9410_10286_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_139615944.1|10312_11371_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_139615945.1|11694_13209_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_139615946.1|13205_13553_+	response regulator	NA	NA	NA	NA	NA
WP_135818143.1|14923_15688_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.2	9.3e-65
15179:15198	attL	CCAATCGTCGAGGATGAGCA	NA	NA	NA	NA
WP_139615947.1|15699_17268_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.9	1.7e-129
WP_139615948.1|17982_19575_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_139615949.1|19571_19970_+	response regulator	NA	NA	NA	NA	NA
WP_139615950.1|20063_20288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135314267.1|20672_21739_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_139615951.1|21855_22140_+	integration host factor subunit beta	NA	M4SRV7	Rhodobacter_phage	33.3	6.8e-05
WP_139615952.1|22220_22484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616099.1|22830_24192_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_139616100.1|24209_25460_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.9	2.4e-102
WP_139615953.1|26451_26637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139615954.1|27325_27673_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_139615955.1|27744_28179_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_139616101.1|28223_28376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136887690.1|28678_28942_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_139616102.1|28950_29367_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_139615956.1|29563_29827_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_139615957.1|29823_30309_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_139615958.1|30777_31218_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_139615959.1|31202_31448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615960.1|32682_33534_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139615961.1|33521_34370_-	alpha/beta hydrolase fold domain-containing protein	NA	G1FGF0	Mycobacterium_phage	33.0	9.8e-15
WP_139615962.1|34418_35504_-	tricarboxylate transporter	NA	NA	NA	NA	NA
WP_139615963.1|35517_37461_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_135314351.1|38047_39114_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_139615964.1|39555_40338_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.4	1.6e-51
WP_139615814.1|40442_41447_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_135312179.1|42550_43822_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.5	1.5e-99
WP_139615965.1|45934_47395_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.1	9.3e-13
WP_139615966.1|47700_48687_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	6.5e-18
WP_139615967.1|48683_48917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615968.1|49226_52535_+	PAS domain S-box protein	NA	A0A127AWB9	Bacillus_phage	30.4	4.4e-10
WP_139615969.1|52888_55840_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_139615970.1|55817_56201_+	response regulator	NA	NA	NA	NA	NA
WP_139615971.1|56922_58152_+	GAF domain-containing protein	NA	NA	NA	NA	NA
56416:56435	attR	CCAATCGTCGAGGATGAGCA	NA	NA	NA	NA
WP_139615972.1|58272_59277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136887812.1|59705_59927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615973.1|59929_61582_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.7	6.0e-101
WP_136887810.1|61640_61991_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	51.4	7.9e-27
WP_139615974.1|61987_62392_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP040762	Paracoccus sp. 2251 plasmid unnamed2, complete sequence	244326	162194	200985	244326	transposase	Stx2-converting_phage(30.0%)	39	NA	NA
WP_139615504.1|162194_163847_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	37.2	2.4e-73
WP_139615503.1|163910_164264_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139615515.1|164260_164689_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139616047.1|165983_166640_-	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_139616048.1|166636_167473_-	BtpA/SgcQ family protein	NA	NA	NA	NA	NA
WP_139616049.1|167505_168387_+	ribokinase	NA	NA	NA	NA	NA
WP_139616050.1|168395_169157_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_136887137.1|169178_170243_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_136887138.1|170239_171241_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_136887139.1|171240_172011_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	5.6e-17
WP_139616051.1|172010_172940_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_139616052.1|172942_173986_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_139616053.1|174689_175646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616054.1|175813_176857_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_139616055.1|176856_177369_-	gluconate kinase	NA	NA	NA	NA	NA
WP_139616056.1|177400_178885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135816459.1|178960_179911_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_139616057.1|179969_180455_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_139616058.1|180836_181859_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_139616059.1|182198_182432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139616060.1|182487_182826_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_139616061.1|182911_183766_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.4	2.5e-50
WP_139616062.1|183779_185276_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	62.9	2.9e-163
WP_135816197.1|185422_186016_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_139616104.1|186400_187651_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.6	5.4e-102
WP_139616105.1|187921_189019_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	35.5	4.8e-30
WP_139616063.1|189002_189368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616064.1|189670_190600_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_139616065.1|190612_191695_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_139616066.1|192394_192553_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135819381.1|192784_193060_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	42.7	8.1e-11
WP_139616067.1|194283_194559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139616068.1|195024_195654_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_139616069.1|195845_196652_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_139616070.1|196677_197478_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	5.4e-31
WP_139616071.1|197495_198383_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_139616072.1|198634_200191_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.7	5.5e-96
WP_136886773.1|200245_200599_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	34.7	3.8e-13
WP_139616073.1|200595_200985_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP040761	Paracoccus sp. 2251 plasmid unnamed5, complete sequence	216963	46226	53662	216963		Ochrobactrum_phage(33.33%)	6	NA	NA
WP_139615791.1|46226_47306_-	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	36.6	4.0e-05
WP_135816872.1|47525_48710_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	59.1	7.5e-130
WP_139615792.1|48709_49630_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	37.6	1.5e-45
WP_139615793.1|49803_50970_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	27.5	2.7e-15
WP_139615922.1|51091_52558_-	mannitol dehydrogenase family protein	NA	G9E6E2	Micromonas_pusilla_virus	27.9	1.4e-48
WP_139615794.1|52648_53662_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.4	6.2e-24
>prophage 1
NZ_CP040758	Paracoccus sp. 2251 plasmid unnamed7, complete sequence	82441	8985	57751	82441	transposase	Paenibacillus_phage(20.0%)	43	NA	NA
WP_139615525.1|8985_9393_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.3	8.3e-12
WP_135312247.1|9485_10514_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_139615526.1|11705_12014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139615527.1|13997_14312_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_135817904.1|15333_15687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615528.1|16330_16540_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_139615529.1|17681_17900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139615530.1|17998_18694_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_139615531.1|19347_20484_+	DUF563 domain-containing protein	NA	NA	NA	NA	NA
WP_139615532.1|21654_21957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139615533.1|21931_24181_+	glycosyltransferase family 92 protein	NA	NA	NA	NA	NA
WP_139615534.1|24237_26364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139615535.1|26496_27315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139615536.1|27652_28138_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_139615537.1|28343_29546_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_139615538.1|29602_30523_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	33.0	8.1e-39
WP_139615539.1|30831_32421_+	DUF563 domain-containing protein	NA	NA	NA	NA	NA
WP_139615540.1|32949_33627_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_139615541.1|34085_35180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615542.1|35176_35737_-	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_139615543.1|35859_36054_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	67.5	1.4e-06
WP_139615544.1|36160_37333_-	DUF563 domain-containing protein	NA	NA	NA	NA	NA
WP_139615581.1|37772_38027_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_139615545.1|38073_38655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615546.1|38951_39650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615547.1|39706_41254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615548.1|41336_42017_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_139615549.1|42257_42866_-	CatB-related O-acetyltransferase	NA	A0A1V0SAW9	Catovirus	28.3	5.4e-15
WP_135816297.1|43536_44226_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.4	1.5e-37
WP_139615550.1|44229_44949_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_135816299.1|44984_45779_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	1.9e-12
WP_139615551.1|45789_47151_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_139615552.1|47147_48608_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_139615553.1|48671_49718_-	phosphonate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	38.0	8.9e-58
WP_139615582.1|50315_50900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139615554.1|51354_51738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615555.1|52109_52991_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	54.7	3.2e-32
WP_135816305.1|53166_53442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135816306.1|53512_54139_-	ParA family protein	NA	M4HZI5	Mycobacterium_phage	44.7	2.7e-09
WP_139615556.1|54196_55036_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_139615557.1|55614_56001_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_135312247.1|56114_57143_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_139615558.1|57358_57751_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.5	2.3e-19
>prophage 1
NZ_CP040759	Paracoccus sp. 2251 plasmid unnamed8, complete sequence	83454	19088	43561	83454	transposase	Stx2-converting_phage(50.0%)	19	NA	NA
WP_139615601.1|19088_20645_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.9	3.8e-97
WP_139615602.1|20699_20894_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_135312179.1|20939_22211_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.5	1.5e-99
WP_139615603.1|22273_22462_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139615604.1|22458_22848_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139615605.1|25355_27389_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_139615606.1|27381_28068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615607.1|28067_29069_-	type I-D CRISPR-associated protein Cas7/Csc2	NA	NA	NA	NA	NA
WP_139615608.1|29077_31990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615609.1|32001_32706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615610.1|32786_33746_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_139615611.1|34161_35514_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	45.7	2.5e-52
WP_139615612.1|35634_36228_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_139615613.1|36164_36506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615614.1|39206_39812_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_139615615.1|40347_41127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139615515.1|41066_41495_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139615503.1|41491_41845_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139615504.1|41908_43561_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	37.2	2.4e-73
