The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	0	51042	4809386	tail,plate,lysis,head,holin,portal,capsid,tRNA,terminase	Escherichia_phage(50.0%)	55	NA	NA
WP_112860928.1|0_2301_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_001752365.1|2718_3207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752366.1|3220_4312_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	33.3	9.1e-05
WP_001752367.1|4474_4912_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	86.0	1.4e-65
WP_000038161.1|5616_6651_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156872.1|6650_8423_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_135804992.1|8596_9451_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	90.1	3.1e-141
WP_001248569.1|9509_10583_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.7	3.9e-202
WP_000203450.1|10586_11330_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	5.6e-123
WP_000988633.1|11429_11939_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|11938_12142_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|12145_12427_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|12426_12924_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_103927127.1|12938_13364_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	4.7e-58
WP_072778444.1|13351_13777_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	98.6	1.9e-67
WP_001300730.1|13748_13922_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_103927128.1|13884_14352_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
WP_001001780.1|14344_14797_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_048256448.1|14863_15499_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	3.4e-113
WP_000127164.1|15495_15843_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_063501944.1|15847_16756_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.8e-161
WP_025670916.1|16748_17360_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	8.4e-117
WP_024214860.1|17356_18556_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.2	1.3e-214
WP_001624294.1|18576_19020_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.3	5.9e-80
WP_001624293.1|18991_19387_-|tail	tail assembly chaperone	tail	A0A0M4S6V4	Salmonella_phage	44.0	4.6e-15
WP_072163622.1|19395_19758_-|tail	phage tail protein	tail	M1FN94	Enterobacteria_phage	41.7	3.5e-14
WP_135804997.1|19901_20219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024247059.1|20417_21011_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	1.1e-102
WP_072664081.1|21070_22261_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	9.0e-224
WP_001251408.1|22273_22792_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|22848_23124_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|23156_23276_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_103927080.1|23268_25716_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.7	0.0e+00
WP_000978911.1|25730_26210_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882975.1|26209_27373_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_000468308.1|27454_27673_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_046464067.1|27991_30274_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	7.6e-163
WP_000642546.1|30328_31186_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001295344.1|31591_33352_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642849.1|33481_34174_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057138.1|34372_35461_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|35531_36815_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|36983_37748_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|37920_38604_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|38714_40388_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|40547_40832_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|41039_43304_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|43340_45089_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_046464068.1|45085_46072_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056538.1|46108_47341_+	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000350058.1|47392_47575_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011620.1|47571_48318_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436932.1|48471_49365_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|49341_50121_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|50256_51042_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	59794	70764	4809386	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|59794_60343_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|60369_61017_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|61238_62429_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|62613_63702_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|64304_65705_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|65873_67076_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|67341_69954_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|69996_70764_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 3
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	86683	88591	4809386		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|86683_88591_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 4
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	101190	103245	4809386		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|101190_103245_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 5
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	107478	108138	4809386	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|107478_108138_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 6
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	127402	139717	4809386		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|127402_127615_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|127625_127814_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|127788_128019_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|128008_128182_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|128230_129304_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001381077.1|129375_132120_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.1e-37
WP_001264933.1|132202_133231_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|133203_133896_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|134025_135198_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062091.1|135197_137744_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209896.1|137740_138340_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|138491_138797_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|138796_139717_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 7
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	144022	146296	4809386		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|144022_144196_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|144452_145781_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028083.1|145801_146296_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 8
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	161210	161999	4809386		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|161210_161999_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 9
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	168818	171380	4809386	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409871.1|168818_170177_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	7.3e-20
WP_085947771.1|170217_171380_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 10
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	176612	177446	4809386		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|176612_177446_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 11
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	181581	182115	4809386		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|181581_182115_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 12
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	191423	192344	4809386		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|191423_192344_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 13
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	197004	197250	4809386		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|197004_197250_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 14
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	214457	215399	4809386		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|214457_215399_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 15
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	227756	228938	4809386		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|227756_228491_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|228701_228938_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 16
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	232210	233853	4809386		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|232210_232852_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|232848_233853_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 17
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	246159	246417	4809386		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|246159_246417_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 18
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	253705	257446	4809386		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|253705_254407_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|254406_255651_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|255679_256591_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952734.1|256606_257446_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	9.7e-23
>prophage 19
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	260703	262681	4809386		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|260703_261561_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|261544_262681_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 20
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	267702	269073	4809386		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|267702_269073_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 21
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	272209	275943	4809386		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444488.1|272209_273460_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001295666.1|273562_273886_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|274423_274534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|274586_274991_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|275211_275943_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 22
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	292650	294338	4809386		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|292650_293070_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|293069_294338_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 23
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	321007	323759	4809386		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|321007_322687_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|322811_323759_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 24
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	326895	330903	4809386		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|326895_327978_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|327977_328811_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|328807_329200_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|329203_330013_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|330048_330903_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 25
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	334002	334233	4809386		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|334002_334233_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 26
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	345487	356028	4809386		Escherichia_phage(25.0%)	10	NA	NA
WP_000702650.1|345487_347026_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571681.1|347022_347733_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|347732_348410_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|349665_350508_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|350557_351016_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|351128_352034_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|352125_353139_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|353340_354249_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|354392_354806_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|355410_356028_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 27
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	365438	367453	4809386		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|365438_366452_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|366448_367453_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 28
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	375388	444502	4809386	tail,integrase,protease,lysis,head,holin,portal,capsid,terminase	Enterobacteria_phage(39.58%)	78	375225:375252	425397:425424
375225:375252	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|375388_376519_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|376496_376745_-	excisionase	NA	NA	NA	NA	NA
WP_000048527.1|376809_379281_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	3.0e-56
WP_001090200.1|379373_379565_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_024242712.1|379561_379750_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001351093.1|380149_380587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001435739.1|380564_380885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021538048.1|380896_381049_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001003382.1|381241_381649_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
WP_000476993.1|381726_381954_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|381937_382459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|382439_383405_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_046464132.1|383445_383868_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	2.4e-62
WP_000566847.1|384120_385020_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001373963.1|385334_385988_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|386000_386696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|387381_387594_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000980987.1|387810_388062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032340036.1|388128_388407_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	2.5e-12
WP_001265118.1|388408_389455_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	1.7e-109
WP_000904106.1|389467_389842_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_000762908.1|389838_390660_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	7.6e-81
WP_000917761.1|390886_391084_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	1.4e-28
WP_000935516.1|391234_392284_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
WP_106104550.1|392584_392671_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|393159_393372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871291.1|393442_393778_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874301.1|394038_395895_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	88.4	0.0e+00
WP_000284510.1|396045_396261_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193285.1|396265_396580_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	98.1	1.4e-51
WP_001274714.1|396635_397169_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_000091924.1|397165_397624_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	88.2	1.5e-65
WP_000654791.1|398040_398661_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	2.3e-53
WP_000077907.1|398602_399670_-	beta family protein	NA	NA	NA	NA	NA
WP_000867575.1|400080_400629_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622379.1|400600_402529_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000259002.1|402512_402719_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|402715_404308_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253958.1|404297_405803_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256824.1|405839_406187_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522591.1|406244_407273_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|407324_407708_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|407700_408054_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|408069_408603_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|408599_408995_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|409002_409755_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|409768_410200_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|410226_410640_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082389.1|410620_413194_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.3	0.0e+00
WP_000846687.1|413190_413520_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	1.6e-58
WP_001152648.1|413519_414218_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_046464133.1|414222_414966_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.4e-145
WP_000090863.1|414902_415505_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	6.8e-87
WP_001332187.1|415577_415916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515674.1|415982_419462_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.4	0.0e+00
WP_001228225.1|419529_420129_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	3.7e-101
WP_046464134.1|420193_423169_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	88.0	2.7e-51
WP_000885580.1|423168_423753_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000241000.1|423807_424476_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000251936.1|424915_425086_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079505.1|425574_426081_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
425397:425424	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056490.1|426126_426627_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|426712_426892_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|427272_428079_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|428078_429272_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983871.1|429283_430645_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763511.1|430645_432241_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|432240_433803_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|433894_433939_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|434076_434958_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|434954_435575_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001326916.1|435602_437498_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|437708_438584_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|438623_439214_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|439210_439969_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|440188_441238_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|441273_441525_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|441904_444502_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 29
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	450202	450793	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|450202_450793_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 30
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	458610	464267	4809386		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|458610_460545_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|460612_461740_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|461883_462672_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|463039_463393_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|463460_464267_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 31
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	477182	478448	4809386		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|477182_478448_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 32
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	492453	493536	4809386		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057985.1|492453_493536_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 33
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	510155	510671	4809386		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|510155_510671_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 34
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	516997	524268	4809386	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628058.1|516997_518230_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|518484_519468_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|519945_521319_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081417.1|521447_522383_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001300461.1|522559_522994_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|523134_524268_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 35
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	529228	530218	4809386		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|529228_530218_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 36
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	552912	554075	4809386	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|552912_554075_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 37
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	569137	573040	4809386		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|569137_573040_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 38
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	576978	580187	4809386		Escherichia_phage(33.33%)	4	NA	NA
WP_000428998.1|576978_577509_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|577753_577927_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|577998_578148_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098562.1|578546_580187_+	methyl-accepting chemotaxis protein Trg	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.0	1.6e-05
>prophage 39
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	589733	599907	4809386	transposase	Escherichia_phage(25.0%)	10	NA	NA
WP_000826421.1|589733_590942_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	8.6e-206
WP_001326689.1|590981_592196_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|592248_592785_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001303492.1|592857_594819_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|594910_595141_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001447010.1|595362_595539_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	NA	NA	NA	NA
WP_001270286.1|595584_596001_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760626.1|596079_597486_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|597730_598876_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|598893_599907_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 40
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	607039	609142	4809386		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|607039_609142_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 41
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	614048	616157	4809386		Ralstonia_phage(100.0%)	1	NA	NA
WP_046464189.1|614048_616157_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
>prophage 42
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	627817	629362	4809386		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|627817_629362_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 43
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	637021	637312	4809386		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|637021_637312_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 44
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	643503	644944	4809386		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|643503_643788_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|643933_644944_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 45
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	648234	650140	4809386		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285520.1|648234_649161_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-13
WP_000193547.1|649153_650140_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 46
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	654456	658263	4809386		Klosneuvirus(50.0%)	2	NA	NA
WP_001581743.1|654456_656856_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|656880_658263_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 47
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	663529	666313	4809386		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_001244979.1|663529_666313_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.3e-19
>prophage 48
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	684563	685964	4809386		Escherichia_phage(100.0%)	1	NA	NA
WP_001083595.1|684563_685964_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 49
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	693388	694924	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194860.1|693388_694924_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
>prophage 50
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	711472	711856	4809386		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|711472_711856_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 51
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	714857	715748	4809386		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|714857_715748_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 52
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	721112	788158	4809386	tail,integrase,lysis,transposase,head,portal,capsid,terminase	Enterobacteria_phage(37.7%)	84	752075:752090	788229:788244
WP_000214712.1|721112_721316_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|721350_722811_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|722899_724183_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|724787_724901_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|724969_725203_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|725519_726110_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|726207_726783_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_072053404.1|726782_729857_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001230375.1|729921_730521_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_046464172.1|730590_734088_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.5	0.0e+00
WP_071594567.1|734148_734781_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_001441739.1|734717_735461_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152619.1|735465_736164_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847347.1|736163_736493_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_046464171.1|736489_739051_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.0	0.0e+00
WP_000459457.1|739043_739478_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_046464170.1|739459_739882_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.5e-72
WP_001349920.1|739897_740638_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_021526108.1|740645_741041_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.3e-70
WP_046464169.1|741037_741616_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	3.9e-79
WP_046464168.1|741627_741981_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	4.9e-61
WP_000158880.1|741992_742388_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_046464167.1|742429_743455_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_046464166.1|743510_743843_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	1.2e-53
WP_000123305.1|743852_745172_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_046464165.1|745152_746754_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000198149.1|746750_746957_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_046464164.1|746953_748879_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453611.1|748853_749399_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|749787_750021_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|750078_750489_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_123377231.1|750984_751140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|751219_751285_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|751287_751476_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|751486_751699_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|752061_752559_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
752075:752090	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_046464162.1|752555_753044_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.3	1.0e-88
WP_085947771.1|753056_754219_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000189916.1|754347_754659_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|754663_754879_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|755632_755848_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|756148_756361_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|756415_756505_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|756782_757535_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|757548_758598_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|758599_758878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|758944_759196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|759412_759568_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|759639_759927_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|759926_760166_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|760190_760496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|760698_761031_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|761467_762781_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|762958_763141_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000839179.1|764058_764463_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|764459_764807_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|764855_766391_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_001310834.1|766910_767267_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|767263_767686_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|767726_768692_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|768672_769194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|769177_769408_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|769491_769899_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|770065_770221_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|770380_770599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|770602_770767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|771166_771355_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|771351_771543_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048342.1|771635_774107_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|774179_774431_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876958.1|774465_775746_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|775765_775876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|775933_776953_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|776964_778179_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|778384_778711_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|778845_779187_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|779221_779782_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|779784_780495_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|780602_780908_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|781106_783533_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|783593_786017_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|786027_786645_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|786646_787501_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|787543_788158_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
788229:788244	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 53
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	805919	807221	4809386		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|805919_807221_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 54
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	817297	819109	4809386		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|817297_819109_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 55
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	838985	840260	4809386	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|838985_840260_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 56
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	847171	848670	4809386		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|847171_847693_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|847773_848670_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 57
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	857472	866353	4809386		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|857472_858288_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|858415_858997_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|859231_860401_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|860566_860656_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|860954_861980_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|861976_862909_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182332.1|863021_864233_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|864523_865672_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|865711_866353_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 58
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	871857	874124	4809386		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|871857_872670_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|872673_873459_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|873455_874124_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 59
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	882413	887497	4809386		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|882413_883634_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|883630_884902_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_046464076.1|884876_885623_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_001481637.1|885632_887120_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|887128_887497_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 60
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	906141	925681	4809386	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001336282.1|906141_907788_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.9e-31
WP_000069375.1|907844_910223_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|910555_911389_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|911545_912592_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|912723_912915_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175703.1|912918_914355_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|914417_915131_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|915377_915842_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|915919_916669_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|916668_917220_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|917282_918263_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|918363_918663_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|918667_921055_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|921069_922053_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|922336_922381_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|922503_922860_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|922912_923110_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|923206_923749_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|923752_925681_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 61
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	936977	939239	4809386		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|936977_939239_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 62
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	945568	946396	4809386		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|945568_946396_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 63
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	953872	955093	4809386		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|953872_955093_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 64
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	961857	962511	4809386		Planktothrix_phage(100.0%)	1	NA	NA
WP_001300558.1|961857_962511_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 65
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	968109	970071	4809386		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|968109_970071_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 66
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	974997	979082	4809386		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|974997_975639_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438807.1|975731_977090_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719096.1|977206_977965_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|978101_979082_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 67
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	987892	988747	4809386		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|987892_988747_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 68
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	992065	996642	4809386		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|992065_993349_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|993495_994971_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|995151_996642_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 69
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1011171	1019278	4809386	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|1011171_1012857_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1013062_1013644_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|1013683_1014379_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1014436_1016347_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1016478_1016823_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1017184_1017544_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1017663_1017843_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|1017916_1019278_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 70
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1023136	1024693	4809386		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1023136_1024693_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 71
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1031110	1031320	4809386		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1031110_1031320_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 72
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1036652	1038701	4809386		Moraxella_phage(100.0%)	1	NA	NA
WP_001055811.1|1036652_1038701_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	5.2e-86
>prophage 73
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1046197	1050667	4809386		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|1046197_1046854_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976476.1|1047249_1047591_-	YebY family protein	NA	NA	NA	NA	NA
WP_046464082.1|1047603_1048476_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|1048479_1048854_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1048992_1049223_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1049324_1049981_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1050004_1050667_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 74
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1058723	1060199	4809386		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1058723_1060199_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 75
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1064197	1071261	4809386		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|1064197_1065520_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|1065535_1066468_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1066546_1067302_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571457.1|1067298_1068084_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1068230_1069241_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1069249_1069861_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|1069999_1070065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|1070135_1070738_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1070739_1071261_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 76
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1075279	1077330	4809386		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|1075279_1076098_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1076150_1076546_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019590.1|1076586_1077330_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 77
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1083946	1085680	4809386	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025299.1|1083946_1085680_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	2.0e-86
>prophage 78
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1090932	1096576	4809386		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1090932_1091322_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036361.1|1091336_1092386_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_000204337.1|1092388_1093249_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483239.1|1093267_1094869_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_001297437.1|1094914_1096576_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 79
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1106662	1108177	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|1106662_1108177_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 80
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1120168	1120921	4809386		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1120168_1120921_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 81
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1132305	1134535	4809386	transposase	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_073511829.1|1132305_1132803_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	64.5	1.3e-51
WP_001336494.1|1132684_1133014_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_088895425.1|1133307_1134535_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 82
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1155062	1163439	4809386		Burkholderia_phage(40.0%)	8	NA	NA
WP_000786006.1|1155062_1155533_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001157238.1|1155513_1156932_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365562.1|1156998_1157694_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_072132661.1|1157733_1158099_-	permease	NA	NA	NA	NA	NA
WP_001475434.1|1158665_1159859_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.6	9.7e-101
WP_000218212.1|1160450_1161302_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826748.1|1161409_1162768_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|1162767_1163439_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 83
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1166983	1167514	4809386		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1166983_1167514_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 84
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1194204	1195356	4809386	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_024176387.1|1194204_1195356_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 85
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1208544	1215044	4809386	transposase	Stx2-converting_phage(50.0%)	10	NA	NA
WP_046464190.1|1208544_1209363_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
WP_000855059.1|1209704_1210178_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186774.1|1210193_1210670_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1210732_1210954_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001295723.1|1211116_1211485_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854761.1|1211574_1211952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1212163_1212277_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001333339.1|1212711_1214247_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|1214295_1214643_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1214639_1215044_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
>prophage 86
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1219012	1220179	4809386		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001310935.1|1219012_1220179_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.5e-226
>prophage 87
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1227824	1228724	4809386		Cellulophaga_phage(100.0%)	1	NA	NA
WP_032329340.1|1227824_1228724_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 88
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1241496	1247245	4809386		Paramecium_bursaria_Chlorella_virus(25.0%)	4	NA	NA
WP_000704810.1|1241496_1242663_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
WP_032298966.1|1242803_1244174_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.3	1.1e-31
WP_032298965.1|1244196_1245612_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	1.1e-53
WP_001518042.1|1245838_1247245_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 89
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1263553	1273858	4809386	transposase	Staphylococcus_phage(20.0%)	6	NA	NA
WP_147577588.1|1263553_1264705_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.9e-41
WP_024192426.1|1265883_1266774_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	1.6e-44
WP_024188875.1|1268633_1270217_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	4.2e-35
WP_001518066.1|1270668_1272522_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|1272543_1273125_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|1273216_1273858_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 90
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1278522	1279875	4809386		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469729.1|1278522_1279875_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	1.6e-06
>prophage 91
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1293320	1299435	4809386	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675150.1|1293320_1294724_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|1294720_1295443_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_038999770.1|1295633_1295966_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1296112_1297474_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_077785296.1|1297804_1298122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|1298535_1299435_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 92
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1308655	1312212	4809386		Serratia_phage(50.0%)	4	NA	NA
WP_000846231.1|1308655_1309660_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000011957.1|1309656_1310622_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1310595_1311342_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046464104.1|1311393_1312212_-	glycoside hydrolase family 25 protein	NA	A0A2K9V3I9	Faecalibacterium_phage	30.3	4.4e-12
>prophage 93
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1322860	1324894	4809386	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1322860_1324894_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 94
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1337460	1346901	4809386		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000040703.1|1337460_1338597_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
WP_046464101.1|1338593_1340594_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|1340718_1341180_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|1341219_1341690_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|1341736_1342456_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1342452_1344138_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1344359_1345091_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1345150_1345258_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1345238_1345970_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|1345974_1346901_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 95
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1358932	1458961	4809386	tail,protease,lysis,portal,terminase,tRNA	Enterobacteria_phage(42.59%)	100	NA	NA
WP_001264869.1|1358932_1359880_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|1360118_1360517_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|1360513_1361209_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553559.1|1361338_1362223_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920064.1|1362372_1363092_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000383096.1|1363094_1363334_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136372.1|1363652_1364891_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956041.1|1364884_1366120_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275118.1|1366190_1367201_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000255042.1|1367216_1368737_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_001036965.1|1368797_1369796_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628645.1|1370075_1371116_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_000440879.1|1371257_1372415_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139613.1|1372431_1373100_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425428.1|1373357_1374194_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489233.1|1374225_1376217_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000253273.1|1376509_1377979_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548294.1|1378183_1379065_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182053.1|1379163_1380213_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873890.1|1380286_1381144_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
WP_000999819.1|1381147_1382236_+	sugar kinase	NA	NA	NA	NA	NA
WP_000382941.1|1382291_1383542_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000415429.1|1383641_1384583_-	ribosylpyrimidine nucleosidase	NA	NA	NA	NA	NA
WP_000658580.1|1384712_1385411_+	transcriptional regulator YeiL	NA	NA	NA	NA	NA
WP_000353897.1|1385481_1386732_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_001293148.1|1386825_1387764_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001368055.1|1387751_1388693_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_000854479.1|1389149_1390841_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091263.1|1390857_1391796_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487246.1|1391795_1392926_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_135804994.1|1393293_1394475_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001349348.1|1394471_1394726_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136827.1|1394880_1395453_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000848222.1|1395675_1397142_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	3.0e-43
WP_000198829.1|1397259_1398246_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296828.1|1398284_1398998_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1399409_1399976_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_135804993.1|1400156_1401713_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001296836.1|1401794_1403609_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501584.1|1403609_1404704_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000088916.1|1404703_1405729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000194940.1|1405730_1407320_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1407323_1407668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213392.1|1408000_1409191_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	24.0	4.4e-21
WP_001234850.1|1409218_1409914_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_001296832.1|1410062_1411823_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	7.1e-100
WP_000494183.1|1411947_1412232_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1412370_1413378_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|1413559_1413787_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256200.1|1413806_1415567_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001351450.1|1416494_1417697_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_147577590.1|1418799_1419384_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.3e-103
WP_021548648.1|1419383_1422782_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|1422846_1423446_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_147577592.1|1423516_1427014_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	97.6	0.0e+00
WP_104951098.1|1427074_1427722_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_104951097.1|1427619_1428363_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	1.1e-142
WP_104951096.1|1428368_1429067_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.0e-130
WP_000847325.1|1429066_1429396_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	7.6e-56
WP_147577594.1|1429392_1432467_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.7	0.0e+00
WP_001161009.1|1432438_1432768_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001370402.1|1432776_1433163_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_104951094.1|1433223_1433967_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001079398.1|1433978_1434380_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677108.1|1434376_1434955_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001283144.1|1434966_1435242_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_001097050.1|1435234_1435558_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_135805019.1|1435644_1437672_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_135805020.1|1437649_1439197_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	1.5e-282
WP_001072975.1|1439124_1439337_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_104951093.1|1439333_1441436_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349509.1|1441435_1441927_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_032198009.1|1442606_1442846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088939.1|1442892_1443354_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	66.4	7.6e-46
WP_021535405.1|1443350_1443848_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	97.6	7.1e-90
WP_000839596.1|1443847_1444063_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|1444130_1445183_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|1445333_1445537_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_032198010.1|1445812_1446676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147577598.1|1446682_1446946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137548549.1|1446920_1447352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104021943.1|1447370_1447736_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	3.8e-56
WP_032198014.1|1447750_1448740_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	1.8e-193
WP_104951092.1|1448747_1449557_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.1	1.1e-151
WP_000767103.1|1449576_1449966_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_104951091.1|1449962_1450289_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	3.5e-53
WP_001442792.1|1450285_1450939_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_015674830.1|1450938_1451433_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.1	2.6e-84
WP_023993851.1|1451429_1452386_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	91.5	6.1e-138
WP_001250272.1|1452375_1452555_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032198019.1|1452730_1453282_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_032198020.1|1453274_1453535_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001020632.1|1453632_1454325_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|1455027_1455390_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1455455_1456280_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|1456407_1456944_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242718.1|1456934_1457297_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_021548839.1|1457293_1457509_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001096409.1|1457570_1457780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741304.1|1457782_1458961_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
>prophage 96
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1472299	1472917	4809386		Bacillus_virus(100.0%)	1	NA	NA
WP_001296826.1|1472299_1472917_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 97
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1481684	1487450	4809386		Bacillus_phage(25.0%)	5	NA	NA
WP_000422188.1|1481684_1483328_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884942.1|1483403_1484054_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786385.1|1484053_1485118_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|1485191_1486247_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|1486358_1487450_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
>prophage 98
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1491727	1494577	4809386		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|1491727_1494577_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 99
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1504277	1518266	4809386		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281225.1|1504277_1506905_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990765.1|1507051_1507774_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_024198511.1|1507834_1511569_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.9	6.9e-20
WP_001075177.1|1512264_1514550_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|1514638_1515769_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1515768_1516023_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301045.1|1516076_1516727_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000768973.1|1517189_1518266_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 100
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1524159	1525062	4809386	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|1524159_1525062_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 101
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1528214	1533218	4809386		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|1528214_1528817_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001342601.1|1529124_1530264_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_000461657.1|1530267_1531236_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860301.1|1531235_1533218_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 102
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1567634	1570862	4809386		Salmonella_phage(50.0%)	3	NA	NA
WP_000813848.1|1567634_1568234_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	5.9e-06
WP_001012899.1|1568292_1570125_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|1570211_1570862_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 103
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1581421	1583282	4809386		Sodalis_phage(50.0%)	2	NA	NA
WP_000156140.1|1581421_1582312_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	5.2e-67
WP_001293612.1|1582508_1583282_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 104
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1587493	1589011	4809386		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1587493_1589011_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 105
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1595487	1596624	4809386		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|1595487_1596624_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 106
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1605160	1606246	4809386		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|1605160_1606246_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 107
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1624108	1634104	4809386	integrase	Enterobacteria_phage(40.0%)	12	1622081:1622098	1643392:1643409
1622081:1622098	attL	ATATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368131.1|1624108_1625041_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_024198532.1|1625375_1626650_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.9e-71
WP_001164795.1|1626680_1627562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000173141.1|1627664_1627880_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001118612.1|1628240_1628417_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_001246995.1|1628409_1628769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027159.1|1628800_1629085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075585.1|1629081_1629465_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000155330.1|1629461_1632134_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	3.2e-59
WP_001066218.1|1632534_1633278_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000126949.1|1633274_1633826_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185343.1|1633831_1634104_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	41.1	8.3e-08
1643392:1643409	attR	ATATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 108
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1639494	1640928	4809386		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|1639494_1640928_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 109
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1647581	1655158	4809386		Hokovirus(50.0%)	4	NA	NA
WP_001348569.1|1647581_1651175_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|1651230_1652376_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1652449_1653394_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|1653463_1655158_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 110
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1658849	1659770	4809386		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1658849_1659770_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 111
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1663588	1664323	4809386		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1663588_1664323_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 112
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1685867	1701237	4809386		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|1685867_1687883_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|1687953_1688940_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|1689169_1689931_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1690115_1691087_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1691470_1691728_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|1691772_1693500_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1693540_1694050_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|1694091_1694943_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|1695047_1695416_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|1695418_1696330_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|1696463_1697561_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_032283469.1|1697550_1698426_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|1698425_1699259_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290224.1|1699258_1700275_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517431.1|1700445_1701237_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 113
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1704715	1709653	4809386		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|1704715_1706020_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1706077_1706977_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|1707072_1707648_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001307326.1|1707708_1708158_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1708144_1708570_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102888.1|1708783_1709653_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 114
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1728207	1729158	4809386		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1728207_1729158_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 115
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1747207	1747921	4809386		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1747207_1747921_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 116
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1769000	1773002	4809386		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1769000_1770290_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1770375_1771002_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1771326_1772364_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|1772363_1773002_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 117
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1778843	1787069	4809386	transposase	Escherichia_phage(57.14%)	8	NA	NA
WP_088895425.1|1778843_1780071_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000017552.1|1780584_1780737_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|1780754_1780946_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|1781256_1781775_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755171.1|1781790_1782330_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	93.9	1.7e-44
WP_000138282.1|1782424_1784002_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1784070_1785537_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_103927076.1|1785698_1787069_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 118
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1795898	1796330	4809386		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1795898_1796330_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 119
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1806215	1812672	4809386		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133579.1|1806215_1807499_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|1807676_1807877_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|1807888_1808224_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1808225_1810076_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|1810092_1810608_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1810703_1811027_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1811043_1811430_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1811457_1812672_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 120
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1827836	1829348	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493405.1|1827836_1829348_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 121
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1835106	1846413	4809386		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1835106_1836360_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883124.1|1836687_1837878_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1837922_1838261_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1838321_1839656_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|1839645_1840359_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_024198520.1|1840522_1841950_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970131.1|1842525_1846413_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	2.2e-130
>prophage 122
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1850532	1850793	4809386		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1850532_1850793_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 123
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1854251	1857993	4809386		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1854251_1854932_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1855203_1856178_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1856193_1857993_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 124
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1863764	1869846	4809386	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219196.1|1863764_1865099_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001297408.1|1865131_1866013_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189206.1|1866115_1866703_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1866757_1867141_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|1867445_1868135_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997411.1|1868182_1869220_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1869426_1869846_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 125
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1875139	1876438	4809386		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|1875139_1876438_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 126
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1882218	1884792	4809386		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1882218_1884792_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 127
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1890698	1891769	4809386		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168054.1|1890698_1891769_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 128
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1905515	1909891	4809386	integrase	Escherichia_phage(75.0%)	4	1903303:1903316	1911191:1911204
1903303:1903316	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|1905515_1905998_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|1906740_1907970_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|1908008_1908425_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_010791586.1|1908496_1909891_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	8.8e-271
1911191:1911204	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
>prophage 129
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1919313	1923438	4809386		Klosneuvirus(50.0%)	4	NA	NA
WP_000097665.1|1919313_1920594_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001295173.1|1920904_1922305_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1922325_1922988_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|1922988_1923438_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 130
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1927373	1932669	4809386		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1927373_1927619_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_046464056.1|1927615_1928026_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	2.3e-17
WP_000246508.1|1927998_1930143_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
WP_000777938.1|1930152_1931112_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_001297215.1|1931466_1932669_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 131
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1945619	1951179	4809386	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1945619_1945805_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|1946039_1948670_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|1948797_1949298_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1949540_1950602_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1950681_1951179_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 132
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1956645	1957611	4809386		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287410.1|1956645_1957611_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 133
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1965086	1966097	4809386		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001363554.1|1965086_1966097_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 134
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1983925	1991065	4809386		Escherichia_phage(83.33%)	6	NA	NA
WP_001272900.1|1983925_1986487_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141314.1|1986592_1987249_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001297141.1|1987299_1988067_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|1988262_1989171_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1989167_1990430_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1990426_1991065_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 135
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	1996278	1999994	4809386		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1996278_1997271_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|1997333_1998473_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1998612_1999239_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1999232_1999994_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 136
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2003106	2005139	4809386		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|2003106_2003712_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090347.1|2003711_2005139_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	2.2e-30
>prophage 137
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2024537	2030380	4809386		Vibrio_phage(33.33%)	6	NA	NA
WP_001199982.1|2024537_2025209_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001716880.1|2025381_2025984_+	LemA family protein	NA	NA	NA	NA	NA
WP_000793004.1|2025997_2026903_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000034928.1|2026938_2027301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|2027356_2028655_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2028742_2030380_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 138
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2034412	2038527	4809386		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_046464058.1|2034412_2035714_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|2035770_2038527_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 139
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2043715	2110781	4809386	tRNA,transposase,plate	Bacillus_phage(15.38%)	54	NA	NA
WP_000890008.1|2043715_2044498_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_000206990.1|2044497_2044827_-	YqcC family protein	NA	NA	NA	NA	NA
WP_000342440.1|2045448_2045994_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_000100426.1|2046061_2046910_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.9	1.0e-40
WP_000627993.1|2047021_2048386_+	nucleotide 5'-monophosphate nucleosidase	NA	NA	NA	NA	NA
WP_000450476.1|2048942_2050232_+	HAAAP family serine/threonine permease SdaC	NA	NA	NA	NA	NA
WP_000626410.1|2050289_2051657_+	L-serine ammonia-lyase II	NA	NA	NA	NA	NA
WP_000268232.1|2051768_2052524_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
WP_000013588.1|2052578_2053727_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_000440775.1|2053754_2054402_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000528603.1|2054948_2056265_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000724153.1|2056297_2058073_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_000808376.1|2058181_2059600_+	L-fuculokinase	NA	NA	NA	NA	NA
WP_000920840.1|2059601_2060024_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_000642344.1|2060081_2060813_+	L-fucose operon activator	NA	NA	NA	NA	NA
WP_001045520.1|2060856_2061957_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_000203905.1|2061949_2062345_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_000044401.1|2062363_2063281_-	glycine cleavage system transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_000750398.1|2063631_2063859_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_001297759.1|2064050_2065256_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	7.8e-74
WP_000184251.1|2065255_2065699_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|2065749_2066556_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|2066632_2067730_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001297760.1|2068869_2069370_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001297758.1|2069428_2070967_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000690896.1|2070984_2072322_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000712314.1|2072318_2072984_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001246541.1|2072996_2074649_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000997067.1|2074706_2075198_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000147354.1|2075388_2078034_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.5	1.8e-99
WP_048207402.1|2078045_2080418_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.3	2.9e-16
WP_000522561.1|2081284_2081839_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_000264514.1|2081879_2083829_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_021578709.1|2083885_2084374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021578710.1|2084427_2086941_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.0	1.5e-18
WP_000764083.1|2086962_2087565_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000845158.1|2087635_2088118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348788.1|2088195_2089149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|2089169_2090382_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_072132602.1|2090395_2090653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348777.1|2090776_2091301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2091328_2092491_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000199055.1|2092584_2093007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342493.1|2093566_2095327_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000373311.1|2095290_2096370_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000484008.1|2096350_2096887_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000106970.1|2096890_2097319_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000157828.1|2097318_2098695_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000276887.1|2098759_2099308_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000016907.1|2099653_2100907_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2101138_2102470_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|2102531_2104358_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_001297553.1|2104357_2107900_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138191.1|2107892_2110781_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	3.4e-67
>prophage 140
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2116257	2123030	4809386		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2116257_2117052_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2117058_2117934_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957912.1|2118084_2120331_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2120343_2120874_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|2121558_2122248_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2122316_2123030_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 141
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2132661	2135156	4809386		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2132661_2134080_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603517.1|2134394_2135156_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 142
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2166278	2170416	4809386		environmental_Halophage(50.0%)	3	NA	NA
WP_001280192.1|2166278_2167679_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001336279.1|2167696_2169013_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2169048_2170416_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
>prophage 143
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2173799	2179886	4809386	tRNA	Catovirus(25.0%)	5	NA	NA
WP_000003071.1|2173799_2175317_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2175326_2176425_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813220.1|2176515_2178249_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|2178254_2178965_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2178989_2179886_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 144
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2183691	2189064	4809386		Pandoravirus(50.0%)	3	NA	NA
WP_001344773.1|2183691_2185125_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
WP_000951940.1|2185181_2185925_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195023.1|2186190_2189064_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 145
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2197592	2198825	4809386		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2197592_2198825_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 146
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2216875	2217553	4809386		Bacillus_virus(100.0%)	1	NA	NA
WP_000956865.1|2216875_2217553_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	4.9e-09
>prophage 147
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2238555	2239710	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2238555_2239710_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 148
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2294056	2295229	4809386		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524966.1|2294056_2295229_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.4	2.1e-39
>prophage 149
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2318721	2319606	4809386		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2318721_2319606_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 150
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2325682	2336506	4809386		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|2325682_2326510_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|2326709_2327636_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2327686_2327944_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|2327986_2330206_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|2330316_2331729_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|2331803_2332541_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281842.1|2332774_2335033_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	4.8e-85
WP_000183494.1|2335578_2336061_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2336113_2336506_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 151
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2340333	2351296	4809386		Bacillus_virus(20.0%)	12	NA	NA
WP_000195298.1|2340333_2342226_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
WP_000105733.1|2342254_2342836_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2342835_2343663_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2343687_2344110_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2344110_2344740_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|2344944_2346426_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2346573_2347245_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2347250_2348411_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001299419.1|2348448_2349237_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2349379_2350153_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2350210_2350381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2350642_2351296_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 152
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2360813	2362247	4809386		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2360813_2362247_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 153
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2367384	2368623	4809386	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708500.1|2367384_2368623_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 154
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2375006	2391191	4809386	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|2375006_2376020_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|2376257_2376473_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2376583_2378329_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|2378523_2380365_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2380443_2380950_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|2381203_2381968_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|2382244_2382868_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094682.1|2383021_2384542_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001297164.1|2384959_2386339_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450589.1|2386380_2386713_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|2386931_2387915_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082882.1|2388098_2391191_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
>prophage 155
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2403621	2404587	4809386		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|2403621_2404587_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 156
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2425165	2427460	4809386		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2425165_2427460_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 157
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2435666	2436812	4809386		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|2435666_2436812_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 158
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2460599	2468393	4809386		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|2460599_2461460_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_032234432.1|2461524_2463561_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246855.1|2463518_2463914_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2463933_2464524_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646043.1|2464533_2465109_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147578.1|2465222_2466263_-	permease	NA	NA	NA	NA	NA
WP_001297424.1|2466335_2466971_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2467098_2467617_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|2467596_2468040_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|2468090_2468393_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 159
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2474095	2475985	4809386		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2474095_2475985_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 160
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2481466	2488105	4809386		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2481466_2484139_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_046464153.1|2484163_2485651_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_021580084.1|2485678_2486131_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2486761_2488105_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 161
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2492187	2495060	4809386	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2492187_2493036_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2493125_2495060_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 162
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2501834	2503312	4809386		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2501834_2502806_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445410.1|2503033_2503312_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 163
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2507380	2522175	4809386		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2507380_2508190_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|2508399_2509377_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2509390_2510377_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|2510397_2510964_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2510960_2511536_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2511504_2512062_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2512068_2512794_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|2512841_2514275_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2514297_2514585_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2514702_2515194_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_046464152.1|2515239_2516094_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2516090_2516363_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2516576_2517209_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|2517205_2517934_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2517930_2518584_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2518813_2521150_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|2521245_2522175_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 164
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2531871	2533362	4809386		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|2531871_2533362_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 165
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2537066	2537564	4809386	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2537066_2537564_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 166
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2541530	2544055	4809386	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2541530_2542898_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2542987_2544055_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 167
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2560831	2561875	4809386		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2560831_2561875_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 168
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2572440	2573325	4809386		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|2572440_2573325_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 169
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2579829	2583983	4809386		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|2579829_2580855_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|2580922_2582104_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046464151.1|2582113_2583217_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078338.1|2583224_2583983_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 170
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2594319	2595791	4809386	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114983.1|2594319_2594829_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.0e-19
WP_000004432.1|2594843_2595791_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 171
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2617006	2618959	4809386		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|2617006_2618959_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 172
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2627789	2636348	4809386		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|2627789_2630483_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|2630774_2631959_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2632029_2634144_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2634240_2634711_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2634807_2635182_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|2635307_2635595_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|2635602_2635962_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|2635961_2636348_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 173
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2641918	2651459	4809386		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2641918_2643832_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|2643831_2644854_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2644847_2645066_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2645119_2645989_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2646043_2646448_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242761.1|2646749_2647382_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2647432_2649523_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|2649589_2650810_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|2650895_2651459_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 174
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2675592	2676429	4809386		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2675592_2676429_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 175
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2693333	2697100	4809386		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|2693333_2694956_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|2695031_2696384_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2696380_2697100_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 176
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2703682	2704561	4809386		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|2703682_2704561_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 177
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2711874	2714268	4809386		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|2711874_2714268_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 178
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2718647	2719874	4809386		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|2718647_2719874_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 179
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2725929	2728377	4809386		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2725929_2728377_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 180
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2748388	2750199	4809386		Enterococcus_phage(50.0%)	2	NA	NA
WP_001067209.1|2748388_2749132_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_000907800.1|2749128_2750199_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 181
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2753742	2755225	4809386		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416891.1|2753742_2754456_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|2754457_2755225_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 182
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2760958	2763777	4809386		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2760958_2761813_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2762057_2763116_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2763108_2763777_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 183
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2766780	2770912	4809386		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2766780_2767407_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_046464157.1|2767480_2769679_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	3.8e-119
WP_000130621.1|2769780_2770026_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|2770246_2770912_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 184
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2778805	2784457	4809386		Bacillus_virus(50.0%)	3	NA	NA
WP_000173666.1|2778805_2779612_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|2779617_2780019_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_147577603.1|2780221_2784457_+	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.2e-25
>prophage 185
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2787832	2790568	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_046464147.1|2787832_2790568_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 186
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2803999	2806042	4809386		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|2803999_2806042_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 187
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2809156	2811291	4809386		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|2809156_2809510_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|2809563_2810853_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065756.1|2810865_2811291_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.6e-50
>prophage 188
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2816163	2816811	4809386		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2816163_2816811_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 189
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2863550	2865535	4809386		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|2863550_2864555_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2864551_2865535_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 190
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2875747	2878081	4809386		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|2875747_2878081_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 191
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2881735	2883735	4809386	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2881735_2881948_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|2882134_2882287_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|2882366_2883735_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 192
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2887573	2888569	4809386		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|2887573_2888569_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 193
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2893930	2895472	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2893930_2895472_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 194
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2919745	2929894	4809386	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582468.1|2919745_2921590_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|2921586_2922978_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2923075_2923684_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_065344858.1|2923911_2928045_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
WP_000072850.1|2928065_2928908_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001360212.1|2928955_2929894_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	4.4e-24
>prophage 195
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2945919	2955474	4809386		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2945919_2946171_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2946312_2946744_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|2946988_2948533_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2948542_2949826_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|2949829_2950789_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_135805005.1|2950775_2951810_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	9.8e-09
WP_000645982.1|2952048_2953074_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213802.1|2953083_2954280_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	1.1e-35
WP_000587766.1|2954493_2955474_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.2e-35
>prophage 196
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2970639	2975202	4809386		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|2970639_2971119_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114529.1|2971157_2971967_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2972064_2972232_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2972252_2972489_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001336353.1|2972705_2973374_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|2973545_2974766_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|2974743_2975202_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 197
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2978575	2985326	4809386		Morganella_phage(25.0%)	6	NA	NA
WP_001336364.1|2978575_2979400_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.0	2.5e-95
WP_000924289.1|2979691_2980309_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870048.1|2980305_2981988_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.1e-22
WP_001295237.1|2982245_2982869_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2982923_2983199_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2983217_2985326_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 198
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	2989759	2991151	4809386		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2989759_2991151_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 199
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3004046	3005381	4809386		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|3004046_3005381_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 200
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3012687	3021708	4809386		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168475.1|3012687_3014376_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|3014481_3014580_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001054909.1|3015144_3015234_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3015513_3016698_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|3016705_3017203_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3017199_3017562_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3017551_3017899_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|3018006_3018456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|3018502_3019996_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|3019992_3021708_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 201
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3028060	3029014	4809386		Synechococcus_phage(50.0%)	2	NA	NA
WP_135805006.1|3028060_3028489_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.5	3.5e-13
WP_001243437.1|3028600_3029014_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 202
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3033441	3034590	4809386		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3033441_3034590_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 203
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3039296	3046665	4809386		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3039296_3041711_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3041739_3042813_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3042812_3043913_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3043917_3045321_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3045617_3045698_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3045927_3046068_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3046084_3046444_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3046407_3046665_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 204
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3056863	3062249	4809386	transposase	Stx2-converting_phage(75.0%)	6	NA	NA
WP_000019348.1|3056863_3058201_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
WP_000086486.1|3058365_3059031_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000116777.1|3059097_3059565_+	protein CbrB	NA	NA	NA	NA	NA
WP_001333339.1|3059916_3061452_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|3061500_3061848_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|3061844_3062249_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
>prophage 205
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3072423	3080031	4809386		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|3072423_3073197_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251998.1|3073379_3074270_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3074269_3075229_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3075315_3076356_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|3076669_3078499_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|3078660_3080031_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 206
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3091984	3092977	4809386		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3091984_3092977_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 207
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3096145	3101998	4809386		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102343.1|3096145_3098014_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	4.6e-65
WP_001301979.1|3098180_3098600_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|3098607_3100113_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3100117_3101083_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001333816.1|3101107_3101998_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 208
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3115391	3117038	4809386		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012607.1|3115391_3117038_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 209
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3125510	3130924	4809386		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|3125510_3127532_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001295254.1|3127578_3129063_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3129198_3130464_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3130594_3130924_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 210
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3134966	3141110	4809386		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001340422.1|3134966_3136097_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_000006621.1|3136093_3137356_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226601.1|3137355_3138423_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000676056.1|3138441_3139323_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|3139300_3139975_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|3139979_3141110_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 211
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3149185	3150841	4809386		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395863.1|3149185_3150841_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 212
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3161120	3164979	4809386		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3161120_3162017_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3162016_3162733_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|3162816_3164979_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 213
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3170697	3172527	4809386		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3170697_3172527_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 214
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3185059	3188346	4809386		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|3185059_3186700_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|3186778_3187048_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3187051_3187567_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3187569_3188346_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 215
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3197227	3197842	4809386		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|3197227_3197842_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 216
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3211701	3214488	4809386		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3211701_3214488_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 217
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3218604	3221075	4809386		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3218604_3220014_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3220025_3221075_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 218
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3237410	3240190	4809386		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718893.1|3237410_3238307_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|3238474_3239371_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3239404_3240190_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 219
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3247507	3250558	4809386		Escherichia_phage(100.0%)	1	NA	NA
WP_077248221.1|3247507_3250558_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 220
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3265545	3270406	4809386		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_000122641.1|3265545_3266166_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|3266425_3267409_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|3267557_3268232_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3268337_3269711_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3269707_3270406_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 221
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3281981	3286484	4809386		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3281981_3282827_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3283251_3283497_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3283581_3284067_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3284159_3285086_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|3285152_3286484_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 222
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3305061	3312308	4809386		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424840.1|3305061_3305724_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174079.1|3305735_3308237_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_001004446.1|3308545_3309625_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3309639_3309960_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|3310010_3312308_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 223
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3330933	3332778	4809386		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|3330933_3332778_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 224
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3341285	3344338	4809386		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3341285_3342236_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3343153_3344338_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 225
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3348454	3356783	4809386		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3348454_3352483_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3352559_3356783_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 226
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3365999	3367763	4809386		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3365999_3366671_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|3366713_3367304_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3367490_3367763_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 227
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3373152	3374742	4809386		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|3373152_3374742_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 228
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3391135	3394819	4809386		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|3391135_3394819_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 229
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3414091	3415207	4809386		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3414091_3415207_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 230
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3424422	3425031	4809386		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3424422_3425031_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 231
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3431621	3434169	4809386		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3431621_3433037_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|3433089_3434169_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 232
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3438356	3441969	4809386		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3438356_3441179_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3441432_3441969_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 233
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3445786	3447136	4809386		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3445786_3447136_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 234
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3452719	3454678	4809386		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|3452719_3454678_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 235
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3463962	3466110	4809386		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3463962_3466110_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 236
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3471355	3477724	4809386		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066019.1|3471355_3473341_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
WP_001171687.1|3473613_3474543_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|3474526_3475222_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|3475232_3476213_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235255.1|3476191_3477724_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.8e-20
>prophage 237
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3483958	3485508	4809386		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|3483958_3484639_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|3484749_3485508_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 238
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3491120	3491909	4809386		Cedratvirus(100.0%)	1	NA	NA
WP_001193409.1|3491120_3491909_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 239
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3497245	3498748	4809386		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|3497245_3498748_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 240
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3519944	3523156	4809386	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|3519944_3521462_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|3521698_3523156_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 241
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3537432	3539416	4809386		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3537432_3537726_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3537769_3539416_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 242
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3543933	3544467	4809386		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|3543933_3544467_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 243
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3549387	3550365	4809386		Tupanvirus(100.0%)	1	NA	NA
WP_046464180.1|3549387_3550365_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.5e-27
>prophage 244
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3558348	3558894	4809386		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3558348_3558894_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 245
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3562809	3579483	4809386	tRNA,protease	Vibrio_phage(16.67%)	14	NA	NA
WP_000990333.1|3562809_3564147_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|3564156_3566004_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|3565996_3566947_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3567032_3567341_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3567416_3568697_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3568782_3570042_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3570044_3571049_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3571130_3571328_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3571431_3572730_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3572934_3573360_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|3573398_3575840_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001293282.1|3576019_3576751_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_046464199.1|3577738_3578317_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943964.1|3578319_3579483_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 246
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3621530	3705724	4809386	integrase,protease,transposase,holin,tRNA	Vibrio_phage(13.64%)	66	3655303:3655319	3675401:3675417
WP_000055072.1|3621530_3622061_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|3622370_3623327_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205791.1|3623636_3625139_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_024198507.1|3625152_3626175_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595986.1|3626161_3627157_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3627189_3628188_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|3628363_3629737_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|3629892_3630444_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|3630537_3631890_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|3631944_3632331_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|3632375_3632840_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|3632997_3635136_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001301172.1|3635529_3637185_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|3637234_3638656_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_112860931.1|3638774_3639722_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	8.7e-12
WP_001387276.1|3639906_3639960_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471885.1|3640100_3642797_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.6	8.2e-47
WP_000047539.1|3643002_3643389_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3643461_3643923_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3643935_3644871_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|3644874_3645009_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|3645289_3645685_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500689.1|3645815_3646529_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|3646599_3647193_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001326836.1|3647337_3647790_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000036448.1|3647912_3649508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|3649563_3650568_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|3650729_3651146_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059412.1|3651191_3651695_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046464097.1|3651879_3653076_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416382.1|3653131_3655987_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
3655303:3655319	attL	CCAGCAGGGTTTCCGGA	NA	NA	NA	NA
WP_000786399.1|3655986_3656430_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3656783_3658295_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584107.1|3658561_3659662_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3659661_3660744_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001352285.1|3662536_3663556_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	4.9e-45
WP_000772679.1|3663999_3665265_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	4.8e-74
WP_001254928.1|3669477_3670629_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_001323403.1|3671819_3672599_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|3672598_3673621_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000018562.1|3674654_3676568_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
3675401:3675417	attR	CCAGCAGGGTTTCCGGA	NA	NA	NA	NA
WP_001041752.1|3676804_3678001_+	CoA transferase	NA	NA	NA	NA	NA
WP_000102863.1|3678012_3678930_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_000981734.1|3678950_3680300_+	MFS transporter	NA	NA	NA	NA	NA
WP_000228394.1|3680654_3680999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352291.1|3681208_3681535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375333.1|3682443_3682878_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_000416153.1|3684228_3685260_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916805.1|3685530_3685974_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705931.1|3685989_3686277_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345346.1|3686289_3687546_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001446914.1|3687756_3687996_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_115205477.1|3688381_3689610_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
WP_000107480.1|3689799_3690813_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998347.1|3690824_3692141_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3692168_3693089_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|3693394_3694177_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296706.1|3695375_3695504_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001390362.1|3695522_3695627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145475.1|3695684_3696341_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001375347.1|3696588_3697866_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_032215506.1|3697928_3699926_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	5.7e-21
WP_001254928.1|3700982_3702134_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_000177057.1|3703185_3703443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3703999_3704767_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|3704767_3705724_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 247
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3717316	3717664	4809386		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000612591.1|3717316_3717664_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
>prophage 248
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3729255	3731665	4809386		Yersinia_phage(33.33%)	4	NA	NA
WP_046464190.1|3729255_3730074_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
WP_000855059.1|3730415_3730889_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186774.1|3730904_3731381_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3731443_3731665_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 249
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3738586	3747128	4809386		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000202817.1|3738586_3740143_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	8.4e-105
WP_001192736.1|3740448_3741282_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000249525.1|3741639_3743694_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	31.0	1.4e-27
WP_000842794.1|3743690_3745001_+	McrC family protein	NA	NA	NA	NA	NA
WP_000168555.1|3745063_3745936_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001300013.1|3746017_3746140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991442.1|3746147_3747128_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	1.4e-100
>prophage 250
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3750489	3752165	4809386		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3750489_3751092_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3751568_3752165_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 251
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3762368	3763829	4809386		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|3762368_3763829_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 252
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3770397	3770952	4809386		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|3770397_3770952_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 253
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3783537	3785193	4809386		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919541.1|3783537_3785193_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 254
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3788646	3789669	4809386		Tupanvirus(100.0%)	1	NA	NA
WP_000106030.1|3788646_3789669_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 255
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3792895	3794175	4809386		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3792895_3793633_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3793635_3794175_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 256
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3802104	3804980	4809386		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3802104_3803694_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295410.1|3804086_3804692_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3804818_3804980_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 257
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3811059	3812382	4809386		Geobacillus_virus(100.0%)	1	NA	NA
WP_046464055.1|3811059_3812382_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.2e-78
>prophage 258
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3820145	3825500	4809386		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|3820145_3821378_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3821684_3823352_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409456.1|3823562_3825500_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 259
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3828783	3830897	4809386		Bacillus_phage(50.0%)	2	NA	NA
WP_001188664.1|3828783_3829473_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_001219615.1|3829472_3830897_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	1.4e-08
>prophage 260
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3842664	3853179	4809386	transposase	Cyanophage(16.67%)	10	NA	NA
WP_000130189.1|3842664_3843618_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|3843732_3844320_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3844354_3844921_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|3845069_3845783_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843565.1|3845808_3846213_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3846589_3848506_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118475.1|3848594_3849725_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_001181672.1|3849828_3850038_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_085947770.1|3850080_3851450_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000681360.1|3852012_3853179_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 261
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3862666	3865483	4809386	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286892.1|3862666_3865483_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.0e-76
>prophage 262
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3869909	3871058	4809386		Halovirus(100.0%)	1	NA	NA
WP_001352306.1|3869909_3871058_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 263
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3880693	3882208	4809386		Vibrio_phage(100.0%)	1	NA	NA
WP_000787103.1|3880693_3882208_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 264
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3890099	3891499	4809386		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|3890099_3890579_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|3890656_3891499_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 265
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3900649	3906072	4809386		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3900649_3903556_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035678.1|3903720_3906072_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 266
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3913799	3914498	4809386		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|3913799_3914498_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 267
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3927200	3928925	4809386		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|3927200_3928925_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 268
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3955014	3956058	4809386		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3955014_3956058_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 269
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3960303	3960855	4809386		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|3960303_3960855_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 270
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3969482	3970907	4809386		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3969482_3970907_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 271
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3978653	3985276	4809386		Mamastrovirus(33.33%)	5	NA	NA
WP_001189647.1|3978653_3980204_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|3980405_3982796_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3983001_3983538_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3983578_3984241_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3984349_3985276_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 272
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3988538	3989441	4809386		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|3988538_3989441_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 273
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	3994686	4001492	4809386	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|3994686_3996105_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|3996143_3997070_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3997106_3997562_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|3997739_3998444_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|3998458_3998989_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001360098.1|3999062_4001492_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
>prophage 274
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4006735	4007533	4809386		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|4006735_4007533_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 275
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4013567	4013912	4809386		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4013567_4013912_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 276
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4017841	4019266	4809386	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|4017841_4019266_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 277
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4031863	4106345	4809386	tRNA,transposase,plate,protease	uncultured_Caudovirales_phage(18.18%)	59	NA	NA
WP_001295562.1|4031863_4032622_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|4032634_4033492_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|4033503_4034856_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4034885_4037318_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4037439_4037925_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4037928_4038954_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4039058_4039514_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4039517_4040306_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|4040305_4041454_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569432.1|4041450_4042047_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.3e-26
WP_001294757.1|4042083_4045566_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4045578_4046538_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4046636_4048778_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|4048834_4049224_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|4049288_4050587_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4050635_4050896_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4050882_4051083_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4051248_4051794_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|4051790_4052213_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|4052226_4052937_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|4053136_4053961_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|4054014_4055733_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4055844_4056552_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4056548_4056953_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|4057070_4057886_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4057925_4058579_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|4058571_4059603_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|4059790_4060366_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|4066124_4066928_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|4066924_4067839_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4068079_4068880_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|4069554_4070913_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|4070984_4071740_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|4071773_4072496_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4072492_4072960_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|4073024_4073756_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|4074292_4075078_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236645.1|4075214_4075694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046464087.1|4075703_4076618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4076661_4077144_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_039268232.1|4077167_4078520_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001240525.1|4082073_4083486_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|4083490_4084234_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_048206621.1|4084230_4086996_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	1.5e-80
WP_000343289.1|4087004_4087766_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|4087770_4089102_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4089104_4089629_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|4089625_4090906_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4090930_4092013_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|4091976_4093827_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|4093830_4094244_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_046464090.1|4094250_4095726_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|4095776_4096001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|4096035_4096536_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4097230_4097749_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103354.1|4097958_4100100_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_000508724.1|4100175_4104408_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|4104385_4104778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|4105208_4106345_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 278
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4110509	4211912	4809386	tail,integrase,protease,lysis,transposase,holin,portal,terminase	Enterobacteria_phage(34.55%)	105	4129092:4129147	4175156:4175211
WP_000284050.1|4110509_4111088_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4111293_4112061_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4112031_4112772_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|4112927_4113206_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|4113208_4113469_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|4113678_4114428_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|4114603_4115101_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|4115324_4117064_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|4117008_4117794_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|4117864_4118920_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|4118971_4119265_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|4119267_4119666_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|4119675_4120128_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|4120433_4120700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|4120611_4121169_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|4121225_4122683_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|4122943_4123402_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|4123493_4124738_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|4124795_4125197_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749867.1|4125235_4126291_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_001285288.1|4126578_4127682_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|4127693_4128947_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
4129092:4129147	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAA	NA	NA	NA	NA
WP_000051887.1|4129151_4130315_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|4130541_4130847_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_135805016.1|4130846_4131209_-	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	99.2	2.3e-66
WP_000008200.1|4131199_4131736_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|4131863_4132688_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_135805054.1|4132753_4133116_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.2e-59
WP_000016389.1|4133584_4134019_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549626.1|4133990_4134197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|4134431_4135106_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4135196_4135397_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|4135440_4135998_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|4136173_4136353_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_147577607.1|4136342_4137284_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	4.3e-152
WP_015674830.1|4137280_4137775_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.1	2.6e-84
WP_001442792.1|4137774_4138428_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_104951091.1|4138424_4138751_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	3.5e-53
WP_000767103.1|4138747_4139137_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_104951092.1|4139156_4139966_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.1	1.1e-151
WP_032198014.1|4139973_4140963_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	1.8e-193
WP_104021943.1|4140977_4141343_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	3.8e-56
WP_137548549.1|4141361_4141793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147577598.1|4141767_4142031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032198010.1|4142037_4142901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|4143176_4143380_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_088895425.1|4144299_4145527_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_071992385.1|4145544_4145919_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.2	2.7e-65
WP_000839596.1|4145986_4146202_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_021535405.1|4146201_4146699_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	97.6	7.1e-90
WP_000088939.1|4146695_4147157_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	66.4	7.6e-46
WP_032198009.1|4147203_4147443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349509.1|4148122_4148614_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_104951093.1|4148613_4150716_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001072975.1|4150712_4150925_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_135805020.1|4150852_4152400_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	1.5e-282
WP_135805019.1|4152377_4154405_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|4154491_4154815_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283144.1|4154807_4155083_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677108.1|4155094_4155673_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|4155669_4156071_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|4156082_4156826_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001440689.1|4156886_4157273_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_001161009.1|4157281_4157611_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_147577609.1|4157582_4160648_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447247.1|4160647_4160977_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152388.1|4160986_4161685_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
WP_000194780.1|4161690_4162434_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|4162370_4163003_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_109942543.1|4163063_4166462_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	91.2	0.0e+00
WP_032234696.1|4166528_4167128_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	3.0e-111
WP_147577611.1|4167192_4170264_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	81.4	2.8e-67
WP_039268303.1|4170263_4170848_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_135805009.1|4171480_4174732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111348.1|4175327_4175738_-	hypothetical protein	NA	NA	NA	NA	NA
4175156:4175211	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAA	NA	NA	NA	NA
WP_000121359.1|4175716_4176673_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|4176682_4178881_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|4178877_4179834_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|4179830_4180520_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|4180937_4181552_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|4181799_4182129_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|4182441_4183152_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|4183120_4184764_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|4184753_4187279_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716398.1|4187304_4187973_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|4188030_4188618_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|4188692_4189235_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|4190058_4190286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|4190320_4190461_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|4190460_4190724_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|4191087_4191189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020221.1|4192304_4196561_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000621009.1|4196700_4197552_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4198141_4198735_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|4198746_4198983_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|4199091_4200417_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|4200642_4201497_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102108.1|4202023_4202743_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|4202753_4204181_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|4204173_4204869_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|4205111_4205780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|4205992_4207663_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|4207676_4209149_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|4209162_4209750_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|4209878_4211912_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 279
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4223299	4230753	4809386		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000692754.1|4223299_4224349_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_000177906.1|4226473_4229548_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000805902.1|4229670_4230753_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 280
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4236163	4238124	4809386		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4236163_4237114_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|4237110_4238124_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 281
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4242983	4244093	4809386		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842100.1|4242983_4244093_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 282
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4249392	4250160	4809386		Planktothrix_phage(100.0%)	1	NA	NA
WP_046464094.1|4249392_4250160_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	5.6e-25
>prophage 283
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4257747	4258905	4809386		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|4257747_4258905_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 284
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4266320	4267436	4809386		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4266320_4267436_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 285
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4271725	4281802	4809386		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4271725_4272637_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|4272761_4273670_+	fructokinase	NA	NA	NA	NA	NA
WP_001326926.1|4273914_4275099_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698951.1|4275224_4278371_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|4278367_4279570_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4279759_4280449_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893623.1|4280506_4281802_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 286
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4288754	4297735	4809386	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667320.1|4288754_4289882_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.0	8.0e-89
WP_000007629.1|4289904_4290237_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4290264_4292112_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4292122_4293094_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4293222_4293570_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4293746_4294631_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|4294929_4295469_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4295619_4296069_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|4296072_4297176_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|4297264_4297735_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 287
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4319294	4324341	4809386	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4319294_4319918_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4320043_4321318_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4321505_4323860_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4324068_4324341_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 288
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4327469	4328165	4809386		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|4327469_4328165_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 289
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4331488	4335035	4809386		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|4331488_4333261_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|4333253_4335035_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 290
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4343871	4347021	4809386		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4343871_4347021_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 291
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4354029	4362591	4809386		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4354029_4354581_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4354709_4356641_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4356693_4357023_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4357022_4357628_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4357737_4359612_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4359792_4360437_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|4360672_4361635_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801813.1|4361631_4362591_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 292
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4370835	4373896	4809386		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|4370835_4371177_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|4371391_4373896_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 293
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4378435	4379113	4809386		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4378435_4379113_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 294
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4382249	4390058	4809386		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|4382249_4382936_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561838.1|4382932_4385347_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_048206644.1|4385777_4390058_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.2	2.2e-22
>prophage 295
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4396432	4398214	4809386		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|4396432_4398214_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 296
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4404404	4405550	4809386		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|4404404_4405550_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 297
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4417161	4420292	4809386	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912385.1|4417161_4418547_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|4418582_4419104_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4419211_4419424_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4419425_4420292_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 298
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4430401	4432517	4809386		Hokovirus(50.0%)	2	NA	NA
WP_000253839.1|4430401_4431844_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|4431833_4432517_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 299
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4435787	4438931	4809386		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|4435787_4438931_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 300
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4442135	4446196	4809386	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_001067855.1|4442135_4442840_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000609089.1|4443841_4444735_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
WP_000154260.1|4445179_4446196_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.6	9.1e-84
>prophage 301
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4449228	4449981	4809386		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000018742.1|4449228_4449981_+	O89/0101/0162 family O-antigen ABC transporter ATP-binding protein Wzt	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
>prophage 302
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4454260	4460283	4809386	transposase	Tupanvirus(25.0%)	6	NA	NA
WP_001276168.1|4454260_4456342_+	glycosyltransferase	NA	A0A2K9L4U1	Tupanvirus	27.7	2.5e-19
WP_000654804.1|4456559_4457528_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_001333498.1|4458126_4458384_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_000217395.1|4458554_4459046_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000262446.1|4459131_4459494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4459578_4460283_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 303
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4468371	4474414	4809386		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|4468371_4472253_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096707.1|4472468_4473602_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4473598_4474414_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 304
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4488961	4490784	4809386		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|4488961_4489591_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029825.1|4489563_4490784_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 305
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4493967	4496082	4809386		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4493967_4495533_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|4495653_4496082_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 306
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4511506	4512153	4809386		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4511506_4511716_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|4511769_4512153_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 307
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4516966	4519405	4809386		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4516966_4518178_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|4518316_4519405_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 308
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4526415	4528998	4809386	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|4526415_4528998_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 309
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4535937	4539470	4809386		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|4535937_4537608_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|4537691_4538627_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4538744_4539470_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 310
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4545353	4546394	4809386		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|4545353_4546394_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 311
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4550528	4552193	4809386		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4550528_4552193_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 312
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4558238	4562052	4809386	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023094.1|4558238_4560185_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|4560387_4562052_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 313
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4575120	4581101	4809386		Bacillus_phage(33.33%)	4	NA	NA
WP_000186076.1|4575120_4575798_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|4575794_4578479_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|4578471_4579044_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|4579052_4581101_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
>prophage 314
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4587008	4589556	4809386	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085947771.1|4587008_4588170_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000654804.1|4588587_4589556_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
>prophage 315
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4594027	4597077	4809386		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|4594027_4595446_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|4595595_4597077_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 316
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4600455	4601247	4809386		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|4600455_4601247_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 317
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4637777	4641297	4809386		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|4637777_4638497_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|4638493_4639435_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4639548_4639929_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|4640244_4641297_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 318
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4645650	4652224	4809386		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|4645650_4646667_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|4646927_4648400_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|4648467_4649256_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4649384_4649534_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|4649700_4650474_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|4650473_4651163_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|4651165_4652224_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 319
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4662578	4663868	4809386		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|4662578_4663868_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 320
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4670349	4671258	4809386		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4670349_4671258_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 321
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4681855	4696667	4809386		Anomala_cuprea_entomopoxvirus(14.29%)	12	NA	NA
WP_001333396.1|4681855_4683592_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|4683584_4684580_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4684582_4685254_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|4685482_4686847_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|4687078_4687561_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|4687680_4689831_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|4689858_4690821_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|4690961_4692047_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|4692275_4692536_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|4692800_4693067_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|4693140_4693818_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000710619.1|4696406_4696667_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 322
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4700351	4705576	4809386		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|4700351_4701074_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|4701070_4701730_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4701868_4702615_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4703018_4703522_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4703820_4704708_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4704942_4705008_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4705060_4705576_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 323
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4710573	4718915	4809386		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|4710573_4712166_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|4712406_4713672_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|4713823_4714639_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|4714784_4717217_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|4717222_4718122_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|4718252_4718915_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 324
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4722130	4724002	4809386		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4722130_4724002_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 325
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4735337	4736540	4809386		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|4735337_4736540_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 326
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4745106	4754256	4809386		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|4745106_4745364_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4745523_4745811_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_046464064.1|4745794_4746517_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4746577_4747480_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4747567_4748044_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|4748394_4749507_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|4749601_4750735_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|4750744_4751698_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4751694_4752540_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4752599_4753088_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|4753128_4754256_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
>prophage 327
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4757616	4760354	4809386		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4757616_4758345_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|4758562_4759078_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4759203_4759527_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|4759523_4760354_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 328
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4763941	4765660	4809386		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815337.1|4763941_4765660_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 329
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4774957	4798642	4809386	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188144.1|4774957_4776904_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4776976_4777201_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4777523_4777844_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4777874_4780151_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4780835_4781054_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4781338_4782043_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|4782084_4783806_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043592.1|4783806_4785573_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_000537418.1|4785695_4786661_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4787205_4787700_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|4787834_4791824_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4791982_4792594_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4792604_4793948_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4794038_4795331_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|4795569_4798014_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|4798024_4798642_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 330
NZ_CP042336	Escherichia coli strain GZ04-0086 chromosome, complete genome	4809386	4804950	4809125	4809386	integrase	Escherichia_phage(44.44%)	9	4805416:4805428	4806974:4806986
WP_000067979.1|4804950_4805748_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
4805416:4805428	attL	GAACCAGTCACGA	NA	NA	NA	NA
WP_000023390.1|4805779_4806775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|4806868_4807168_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
4806974:4806986	attR	GAACCAGTCACGA	NA	NA	NA	NA
WP_001389237.1|4807276_4807633_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001752359.1|4807643_4807814_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	1.3e-24
WP_000217670.1|4807810_4808311_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4808374_4808599_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_021541112.1|4808598_4808901_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	97.0	7.2e-45
WP_001390857.1|4808900_4809125_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	1.9e-34
>prophage 1
NZ_CP042337	Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence	159610	1262	65129	159610	integrase,protease,transposase	Escherichia_phage(50.0%)	57	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000343760.1|2108_3329_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001309252.1|3447_3636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|4002_5172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|6018_6291_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001496335.1|7533_9504_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|9510_10302_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001297096.1|11040_11820_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255956.1|11819_12842_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|13921_14296_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|14320_15025_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000108589.1|15741_16299_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000210409.1|16440_17022_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888080.1|17026_17365_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|17394_17724_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000039982.1|17937_19044_+	alkene reductase	NA	NA	NA	NA	NA
WP_001194013.1|19109_19811_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_032152933.1|19876_20650_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000872613.1|20835_22059_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000090196.1|22189_23062_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000734115.1|23303_24056_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021546935.1|24495_25500_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000874189.1|26785_27271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|27295_27781_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|27767_28463_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729219.1|28467_29598_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|29587_30871_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|30873_32253_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|32356_32884_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|32924_34811_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|35157_35973_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|36155_36662_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|36651_36810_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000428546.1|39661_40255_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|40367_41573_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|41654_42278_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|42255_42942_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_135804982.1|42949_43312_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|44194_44899_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000239590.1|44978_45854_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|45900_46233_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|48554_49259_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|50452_50995_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|51007_51868_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_001067855.1|51974_52679_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|53310_54141_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|54271_54826_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|54969_55674_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|56275_56881_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|56975_59873_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|60009_60411_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|60343_60601_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|60693_61347_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032152935.1|62285_63143_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|63135_63210_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083821.1|63444_63702_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000156883.1|64106_65129_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP042339	Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_A, complete sequence	55253	0	51287	55253	transposase	Escherichia_phage(16.67%)	57	NA	NA
WP_032495516.1|393_699_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	7.3e-21
WP_000343760.1|734_1955_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|2043_2706_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|3086_3749_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001185481.1|3848_4133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469598.1|4338_4650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043731.1|4685_4970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877224.1|4990_5344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001074369.1|5531_5975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348704.1|5983_6997_-	replication initiation protein	NA	NA	NA	NA	NA
WP_152913118.1|7937_8096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025390.1|8349_8865_+	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
WP_000792381.1|8923_9160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000662998.1|9219_9771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004208549.1|9836_10049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008707.1|10038_10281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001099725.1|10374_10713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004083.1|10787_10952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199355.1|10948_11206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348698.1|11546_12092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199101.1|12094_13255_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000455437.1|13607_14117_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_001348696.1|14067_14304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953538.1|14349_14994_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000916156.1|14977_15268_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_015060057.1|15292_18046_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_000716326.1|18055_18826_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_000759841.1|18835_19093_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000235886.1|19104_20160_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_004199085.1|20354_21083_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000783386.1|21088_22018_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_001295060.1|22014_23229_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000629109.1|23230_23428_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000650512.1|23424_24459_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_000053822.1|24461_26297_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_000738524.1|26293_26686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000754496.1|26773_27088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004208538.1|27173_27500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001215543.1|27496_27991_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
WP_000517490.1|28073_29336_+	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_004199098.1|29339_31667_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_001293458.1|31678_32134_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000351937.1|32171_32822_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_023408316.1|33094_33274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196235.1|33270_34092_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000510385.1|34201_34456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557557.1|34473_34749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221700.1|34811_35024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221702.1|34981_35167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|37138_37843_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|37964_38870_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|38866_40105_+	MFS transporter	NA	NA	NA	NA	NA
WP_039022048.1|40312_43345_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_039022047.1|43348_43909_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.1	1.7e-47
WP_039026336.1|44335_45907_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.0	1.8e-17
WP_023408311.1|49160_50162_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	2.6e-51
WP_001310555.1|50270_51287_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 1
NZ_CP042338	Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_B, complete sequence	68545	1796	17357	68545	protease,transposase	Escherichia_phage(50.0%)	14	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201169.1|5346_6378_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|6388_7027_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|7031_7397_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|7400_8213_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001310555.1|8411_9428_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_023408311.1|9536_10538_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	2.6e-51
WP_004199413.1|10757_13775_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_001549893.1|14621_15284_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_135804983.1|15372_16602_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|16652_17357_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
