The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	7692	67522	5010511	protease,transposase	Ralstonia_phage(50.0%)	50	NA	NA
WP_011257011.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011257012.1|8715_9522_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11144_11816_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11900_12662_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12708_13131_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13134_13548_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13843_14611_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14621_14891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|14965_16426_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17072_18083_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18354_19557_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19698_21837_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22047_22341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257023.1|22457_23003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23116_24097_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24144_25311_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25457_26024_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_133265061.1|27498_28698_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29325_30348_-	sugar kinase	NA	NA	NA	NA	NA
WP_011257031.1|31170_32139_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_113013888.1|32253_34275_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_133264929.1|34369_35335_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704026.1|35476_35671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443571.1|36273_36936_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_041181895.1|37089_37884_-	EcsC family protein	NA	NA	NA	NA	NA
WP_041181896.1|38051_38525_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_115801897.1|40400_41357_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	8.1e-42
WP_011257041.1|42158_42557_-	host attachment protein	NA	NA	NA	NA	NA
WP_011257042.1|42648_43341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|43510_43981_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257045.1|45447_45759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407232.1|46013_46961_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_133265062.1|47101_48160_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|48298_48580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|48620_48893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|48960_49170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407229.1|49283_50234_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_011257052.1|50940_51828_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011257053.1|52133_52451_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011407227.1|52910_53762_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257055.1|54003_55440_+	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407225.1|55568_55931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|55934_56420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257058.1|56416_56800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265136.1|58209_59838_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_041181898.1|60713_63122_-	serine kinase	NA	NA	NA	NA	NA
WP_011409419.1|63843_64833_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_133264930.1|65021_66341_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|66553_67522_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 2
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	98037	245960	5010511	tRNA,transposase	Ralstonia_phage(20.83%)	91	NA	NA
WP_109181945.1|98037_98800_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|98807_100532_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_075238957.1|100542_100755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257102.1|100772_101714_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|101906_103271_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|103267_104896_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_133265064.1|105369_106953_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_041181900.1|106949_109184_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|109186_110944_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|111000_112890_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257109.1|112886_115490_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|115512_115698_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|115812_117975_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|117991_118624_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011407198.1|118787_119285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443629.1|119425_119587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182294.1|119771_120734_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|121600_122815_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_133264931.1|123029_124349_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_133265065.1|124492_124774_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_011407587.1|124824_125859_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_133265066.1|125880_126849_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|128563_129362_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|129882_131097_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_080256644.1|131456_131915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|131914_132247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|132263_132524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|135593_136025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|136299_136635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257127.1|137074_138364_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407183.1|138371_138623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|138982_139963_+|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_075241628.1|139911_140298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|140428_140752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443643.1|140693_140936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443646.1|143948_145325_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_129215536.1|145926_146634_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_011258529.1|147843_148812_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407913.1|149233_150448_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011257031.1|152251_153220_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182069.1|153369_154689_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801897.1|155373_156330_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	8.1e-42
WP_011407913.1|156701_157916_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_115801897.1|158461_159418_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	8.1e-42
WP_044756192.1|159392_159863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407239.1|162530_163220_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
WP_011257145.1|163232_164390_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|164402_165713_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_133264933.1|166392_167358_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703668.1|167588_167840_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075239626.1|168292_168694_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011407243.1|168717_168948_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011407244.1|169014_169677_-	hemolysin III	NA	NA	NA	NA	NA
WP_133265137.1|169941_172350_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_011257154.1|172346_174173_+	exonuclease	NA	NA	NA	NA	NA
WP_011407248.1|174661_176806_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|176996_178154_-	ROK family protein	NA	NA	NA	NA	NA
WP_044756199.1|178326_180915_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|180925_181711_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_113084391.1|182024_183164_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|184314_184620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256616.1|184907_186071_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	1.6e-39
WP_011257161.1|186217_186598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|186799_191272_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257163.1|191466_192948_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_133264934.1|194185_195151_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257172.1|196771_198148_-|transposase	IS5-like element ISXo9 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.7	3.4e-73
WP_094187711.1|199549_200617_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443678.1|200572_200770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257175.1|200751_200880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181912.1|200822_201350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257177.1|202172_204356_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_069960129.1|204367_207718_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|207714_210831_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407278.1|217976_219296_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257184.1|219452_220973_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|220989_221268_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|221457_221796_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011407279.1|222408_224394_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011257188.1|225313_226126_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|226318_226930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|227346_228204_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_011257191.1|228441_230328_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_011257192.1|230900_232277_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.9e-77
WP_011257193.1|232681_235405_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	4.8e-71
WP_041182356.1|235472_237626_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
WP_011257195.1|237622_239314_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_041181914.1|239310_239574_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
WP_011257196.1|239635_241837_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257197.1|241833_243522_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_133265067.1|244055_245960_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	318899	343041	5010511	transposase	Bacillus_phage(25.0%)	23	NA	NA
WP_011409560.1|318899_319862_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|319966_320729_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|322528_323587_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|323597_323888_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|323877_324540_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|324536_325088_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|325099_325849_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041181923.1|325848_326643_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|327027_327315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|327333_327891_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|327908_328874_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|329718_330675_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|330746_331509_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|331548_332347_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|332478_333693_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|333752_334583_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|334610_335374_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|335561_336797_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|338195_338624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|338643_339084_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011407345.1|338986_339292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257274.1|339599_341129_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.7	3.5e-79
WP_094187715.1|342278_343041_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	358874	408948	5010511	tRNA,transposase,holin	Acidithiobacillus_phage(16.67%)	39	NA	NA
WP_011257284.1|358874_360356_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109181928.1|360548_361514_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257286.1|362340_364503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257287.1|364629_366798_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|367435_368065_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|368067_368499_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012446355.1|368591_369134_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|369229_369982_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|370206_370596_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|370709_372383_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257294.1|372379_373024_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011257295.1|373033_373228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257296.1|373258_374362_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_011407366.1|376708_376993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|377344_378143_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181916.1|378202_378965_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257570.1|379012_380248_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|384238_385204_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_076611322.1|386294_387452_+|transposase	IS5-like element ISXoo14 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|387504_388740_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_012446346.1|388984_389167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446345.1|389166_390105_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_012446344.1|390223_390973_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.3e-54
WP_012446343.1|390975_391767_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|391784_392780_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_011257315.1|392882_393644_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_113084404.1|393728_394724_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|394789_395062_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703502.1|395547_396135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|396131_396332_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703503.1|396392_397994_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041181929.1|398025_398772_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_011257323.1|398768_399962_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257324.1|400371_401394_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|401533_403099_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|403109_404123_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|404112_404814_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|404997_408012_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_133264935.1|408185_408948_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	590465	700471	5010511	integrase,tRNA,transposase	Staphylococcus_phage(11.76%)	97	598613:598629	647184:647200
WP_041182661.1|590465_591431_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407278.1|591898_593218_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|593747_594263_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011257476.1|594665_596888_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257477.1|597353_598379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|598362_598965_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
598613:598629	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_011257479.1|599295_600141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181945.1|600649_602026_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_041181946.1|602110_604012_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|604197_604413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|604519_605296_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|605457_606132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|606128_606902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|607125_607689_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|607699_610192_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|610374_611649_-	RDD family protein	NA	NA	NA	NA	NA
WP_041181947.1|611690_612413_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|612453_612927_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|612969_614112_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|614183_615320_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|615452_615965_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|616358_617282_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|617281_618595_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|618645_620367_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|620531_621809_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|622006_622831_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257499.1|622831_623890_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|624055_625522_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|625518_626022_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|626131_627265_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|627507_628029_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|628228_629143_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|629243_629684_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|629792_631667_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|631859_632180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181948.1|632929_634024_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_025988679.1|634262_634502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257508.1|634498_635350_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	43.8	8.1e-09
WP_017172572.1|635346_635631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959713.1|635982_636702_+	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_011257512.1|636715_637195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181949.1|637191_637452_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_011257514.1|637453_638539_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_041181950.1|638545_638848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257515.1|638844_639003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257516.1|640315_640726_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_041181951.1|640806_642081_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257518.1|642077_642875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|643353_644628_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_087801807.1|644540_644804_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	7.2e-17
WP_011257520.1|644761_644968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|644964_645237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|645233_645479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443979.1|647414_648650_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
647184:647200	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|648718_649108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712752.1|649104_649308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|649430_650396_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|651634_652357_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_041181952.1|652367_653804_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407518.1|653803_655072_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011257529.1|655161_657303_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011257530.1|657387_658053_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|658049_658724_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011407521.1|658720_661378_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_011257533.1|661388_662138_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|662464_662677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168737.1|662769_662949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|663097_663319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239431.1|663328_663643_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_094187728.1|665286_666085_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257541.1|666169_667186_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_041181953.1|667176_668577_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012446194.1|669701_670982_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257545.1|670981_671248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257546.1|671216_671597_-	response regulator	NA	NA	NA	NA	NA
WP_117231619.1|673836_674938_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_133264937.1|675071_676391_-|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_012446188.1|676914_677109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239153.1|677130_677385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257552.1|677417_678632_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012446186.1|679449_680238_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.4	1.2e-19
WP_011257570.1|680958_682194_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041181956.1|683039_684635_+	APC family permease	NA	NA	NA	NA	NA
WP_075238992.1|684966_685653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407537.1|686182_687040_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_041182364.1|687378_689448_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	26.9	8.4e-60
WP_011257561.1|689598_690294_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_033013160.1|690322_690511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407539.1|690534_691530_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011257563.1|691669_692239_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_011407541.1|692354_692633_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_011407542.1|692730_693549_+	dioxygenase	NA	NA	NA	NA	NA
WP_011257567.1|693746_694991_+	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_011407543.1|694997_696446_+	UdgX family uracil-DNA binding protein	NA	NA	NA	NA	NA
WP_082324415.1|697085_697538_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_011257570.1|698010_699246_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|699436_700471_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 6
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	806221	846986	5010511	tRNA,transposase	Enterobacteria_phage(21.43%)	34	NA	NA
WP_133264979.1|806221_807541_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|807856_809041_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|809570_810884_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|810873_811692_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|811914_812856_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|812855_813602_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|813827_814883_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|814938_815826_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011257678.1|815822_816380_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.0e-44
WP_011257679.1|816376_817285_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.4e-27
WP_011257680.1|817401_818805_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|818851_820198_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|820331_821063_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|821062_821692_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|821749_823837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|823833_825483_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|825598_826207_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_080256609.1|826600_826831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257687.1|826757_827402_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|827398_828325_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|828327_829170_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|829255_830368_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|830537_831797_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|831858_832320_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|832462_834157_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|834268_834673_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|834804_835578_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_133265069.1|835588_836056_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011257697.1|836061_836535_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407913.1|837315_838530_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011257031.1|839985_840954_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_133264978.1|841033_842422_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099051332.1|842654_844700_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
WP_011407913.1|845771_846986_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
>prophage 7
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	908999	957963	5010511	protease,transposase	Trichoplusia_ni_ascovirus(11.11%)	43	NA	NA
WP_069963827.1|908999_909965_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_133265070.1|910355_910931_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_041181970.1|911043_911553_+	characterized ACR protein	NA	NA	NA	NA	NA
WP_010368401.1|911651_911846_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|911935_912913_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|913142_913583_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|913860_914805_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|914887_915631_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|915835_916075_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|916216_917452_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011257757.1|917622_918978_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|919038_920112_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|920108_921068_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|921064_921418_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|921941_922415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|923435_923762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|923997_925596_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|925741_926638_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_012446045.1|926713_927868_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|928034_930626_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011257766.1|930948_931086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502271.1|931169_931367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257767.1|931358_932558_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011257768.1|933057_935274_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703871.1|935352_936351_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257770.1|936460_936643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257772.1|937622_940610_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|940784_941732_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_075239760.1|942057_942276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407676.1|942232_942769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407677.1|942839_944159_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|944503_945466_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011257778.1|945599_946160_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|946202_946685_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|946847_947324_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|947734_948634_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|948873_949260_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|949889_951017_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|951016_951880_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011257785.1|952173_952359_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011407681.1|952696_953989_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_011257787.1|954314_956987_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	1.2e-77
WP_011257788.1|957180_957963_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	970807	1123753	5010511	integrase,protease,transposase	Ralstonia_phage(21.43%)	109	1049753:1049771	1119504:1119522
WP_115862292.1|970807_971773_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703665.1|972764_973649_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|973769_975218_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|975285_975933_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|976749_977823_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011257809.1|978153_979716_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.8	7.4e-08
WP_011407691.1|979712_980837_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|980912_981170_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|981153_982875_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|982918_983920_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|985196_987074_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|987497_989849_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_041181977.1|989959_990853_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011257816.1|990898_993868_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.0	1.8e-42
WP_094187799.1|994482_995598_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|995744_996281_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|996477_996960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240516.1|997252_999157_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_041182780.1|999207_1000173_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|1000169_1000343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|1000627_1001119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|1002799_1004056_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|1004215_1004779_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|1005145_1006504_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|1006503_1007100_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|1007246_1008131_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|1010112_1010727_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|1010809_1011796_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|1011911_1012406_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|1012650_1014480_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|1014498_1014969_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|1015891_1017019_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|1017119_1018502_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_125168738.1|1018415_1018610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257842.1|1018749_1020873_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|1021401_1021920_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_116100996.1|1022626_1023728_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|1024243_1025479_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|1026092_1026983_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_011257851.1|1028415_1029381_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1030772_1032008_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|1032990_1034310_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|1035055_1035979_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|1037041_1038007_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1038308_1039886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1039953_1040717_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1043385_1044354_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182090.1|1044356_1044638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407721.1|1044614_1045076_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1045624_1045867_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1045860_1046624_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1046656_1047388_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1049207_1049960_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1049753:1049771	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1049961_1050927_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1051190_1052198_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1052341_1053103_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1056420_1057713_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1057805_1058432_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1058556_1059843_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1059986_1062458_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1062671_1062944_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1063775_1065746_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1066458_1067637_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1067633_1068401_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1068413_1069070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1069097_1069550_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1069558_1070293_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_094187715.1|1070437_1071201_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257891.1|1071544_1072249_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1073074_1073704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1074595_1074796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113081221.1|1075191_1077915_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	5.3e-70
WP_069960070.1|1077982_1080133_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_011257896.1|1080129_1081824_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|1082143_1084348_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_133265072.1|1084344_1086039_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1086035_1086299_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|1086360_1088568_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_133265073.1|1088564_1090244_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1090240_1090504_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1090565_1091123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862289.1|1091205_1092171_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1092269_1092956_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1093066_1093471_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011257903.1|1093681_1094731_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1094751_1095501_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1095500_1096250_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1096249_1097281_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1097298_1097658_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1097682_1098180_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1098176_1098422_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1098418_1098865_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1099426_1101523_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1101529_1101850_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1101947_1102541_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1102642_1102993_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1103112_1103646_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1103642_1105595_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1105587_1106544_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1106549_1107503_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1107541_1109410_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1110925_1111441_+	peptide deformylase	NA	NA	NA	NA	NA
WP_041182379.1|1113188_1113935_+	cellulase	NA	NA	NA	NA	NA
WP_041181991.1|1114551_1116153_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1117141_1118377_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1119205_1120174_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1119504:1119522	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_011407913.1|1120373_1121588_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_075241901.1|1122001_1122352_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1122433_1123753_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	1162483	1204928	5010511	transposase	Leptospira_phage(25.0%)	40	NA	NA
WP_099051330.1|1162483_1163585_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.7	4.5e-44
WP_012445878.1|1165015_1165639_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1165662_1165902_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1165951_1166833_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1166982_1167432_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011257968.1|1167582_1168230_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1168321_1168792_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1168788_1169379_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1169987_1170287_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1170283_1170505_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1170740_1171283_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1171293_1172634_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_094187736.1|1173341_1174105_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1174337_1175663_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1175861_1176209_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1176205_1178614_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1178792_1179950_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1179965_1180565_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1180561_1180957_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1180953_1181679_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1181788_1182649_+	YicC family protein	NA	NA	NA	NA	NA
WP_133265074.1|1182765_1183377_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.3	3.4e-09
WP_099051298.1|1183557_1184355_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_133265075.1|1184503_1184803_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1184931_1187103_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1187182_1187563_+	RidA family protein	NA	NA	NA	NA	NA
WP_011257988.1|1187583_1189737_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1189862_1190801_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1190872_1191115_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1191328_1192618_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1192993_1193644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187795.1|1193953_1196476_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1196598_1197657_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1197656_1198415_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1198411_1199077_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1199073_1199607_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1199626_1201576_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1201646_1202445_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258092.1|1202587_1203823_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_133265076.1|1203893_1204928_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	1244160	1276412	5010511	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
WP_109181945.1|1244160_1244923_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1245012_1245978_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1246087_1247407_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1247869_1248547_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1248626_1249016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1249229_1250117_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_041182001.1|1250550_1251534_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.2e-98
WP_011407838.1|1251707_1253795_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1253946_1254606_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_133265077.1|1254539_1254773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133265078.1|1254720_1255491_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1255513_1255693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1255711_1256116_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1256149_1256509_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1256752_1257625_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1257697_1258924_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1259169_1259787_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258050.1|1262935_1263361_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1263385_1263889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1265331_1265781_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|1269380_1270670_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_112993923.1|1272680_1274135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258055.1|1274631_1275501_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1275522_1276194_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011258057.1|1276190_1276412_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	1491821	1630327	5010511	tRNA,transposase	uncultured_Caudovirales_phage(15.38%)	107	NA	NA
WP_133265083.1|1491821_1492787_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258243.1|1493166_1493844_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_075239020.1|1494162_1494351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005926176.1|1494381_1494606_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1494605_1496678_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1496909_1497767_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|1498802_1501205_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|1501259_1502120_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080493518.1|1502080_1502767_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|1502756_1504169_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_109181898.1|1504178_1506602_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	3.1e-37
WP_011258248.1|1506598_1507546_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_113112352.1|1508539_1509085_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1509479_1510037_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1510086_1512195_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011258250.1|1512216_1514118_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_027704078.1|1514172_1515033_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080493959.1|1514993_1515680_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1516143_1516377_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258255.1|1516373_1518782_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011258256.1|1519126_1519582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258257.1|1519828_1520719_-	pirin family protein	NA	NA	NA	NA	NA
WP_148236287.1|1520896_1521409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258258.1|1521480_1522194_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1522297_1523047_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_103057495.1|1523395_1523650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182030.1|1523982_1526040_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.6	7.3e-80
WP_011258262.1|1527987_1529109_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011258263.1|1529123_1529951_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_041182032.1|1529934_1531218_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011258265.1|1531244_1531760_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258266.1|1531770_1533939_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.6	2.9e-10
WP_012444365.1|1533850_1534033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258267.1|1534007_1536029_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1536047_1536377_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_133265084.1|1536416_1536623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258092.1|1536667_1537903_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258269.1|1538186_1541651_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1542054_1542597_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1543008_1543917_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1544262_1545061_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1545204_1545924_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_133265085.1|1546079_1547114_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1547134_1547947_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1548682_1549066_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1549188_1550358_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1550352_1551411_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011258280.1|1551471_1552284_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1552799_1553183_+	membrane protein	NA	NA	NA	NA	NA
WP_133265086.1|1553359_1554529_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1554559_1555372_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011258188.1|1555539_1556508_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408021.1|1556762_1557350_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1557648_1558605_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1558678_1559410_+	nitrilase	NA	NA	NA	NA	NA
WP_011258289.1|1560599_1562003_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1562016_1562523_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1562928_1563387_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1564164_1564368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1565929_1566415_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1566642_1566858_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1567108_1567588_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1567719_1568148_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1568220_1569051_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011258298.1|1569112_1569880_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1569879_1570095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1570240_1571032_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041182398.1|1571189_1572353_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027704133.1|1574586_1575225_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1575400_1577341_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1577557_1578112_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1578333_1579764_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258308.1|1579830_1581285_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_113062055.1|1581470_1581692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258309.1|1581701_1582427_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011258310.1|1582525_1582936_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1582987_1583944_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_041182035.1|1584187_1586569_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1589196_1589607_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1589906_1590089_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1590221_1591262_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1591334_1592780_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258319.1|1594469_1595015_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011258320.1|1595011_1596475_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1597924_1598179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1598581_1599115_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1599140_1599542_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1599510_1599891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1599887_1600130_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258327.1|1600158_1600818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|1601494_1603399_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|1603662_1606059_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258331.1|1606208_1606931_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1609850_1610351_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1610292_1611969_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1612115_1613381_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|1613439_1614633_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|1614629_1615319_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_033013597.1|1615424_1616894_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1616913_1617750_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1617775_1618879_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|1618875_1621932_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1621997_1622588_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1622719_1624552_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_011407587.1|1625237_1626272_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_044756703.1|1627609_1628845_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|1629112_1630327_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
>prophage 12
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	1698804	1802389	5010511	portal,terminase,tRNA,plate,transposase,tail,capsid,head,integrase,holin	Stenotrophomonas_phage(45.45%)	91	1746596:1746616	1797914:1797934
WP_011258399.1|1698804_1701636_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|1701950_1702451_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|1702537_1703488_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1704001_1704937_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1704936_1706937_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011408098.1|1706939_1707566_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1707565_1707901_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_011258405.1|1708250_1709948_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012444470.1|1710172_1712419_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_041182048.1|1712442_1714062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408101.1|1714205_1718789_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
WP_125168749.1|1718778_1719378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181970.1|1722193_1723159_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_113013987.1|1723381_1723918_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.1	3.5e-10
WP_113013989.1|1723920_1724433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756353.1|1725991_1727794_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408105.1|1730684_1733240_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
WP_012445369.1|1736210_1737605_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011258422.1|1738992_1740549_+	membrane protein	NA	NA	NA	NA	NA
WP_011408111.1|1743132_1744371_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1744811_1745105_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|1745602_1746379_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|1746536_1748303_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
1746596:1746616	attL	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_125168750.1|1748326_1748611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258428.1|1748814_1749342_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703718.1|1749441_1750119_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011258430.1|1750208_1750937_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|1751051_1751576_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|1751733_1752318_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|1752517_1754425_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|1754553_1755591_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|1755643_1756102_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258435.1|1756113_1756893_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|1757049_1757499_+	protein TolR	NA	NA	NA	NA	NA
WP_133265090.1|1757488_1758529_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_041182054.1|1758788_1760108_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|1760165_1760684_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011258440.1|1760690_1761509_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|1761551_1762235_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_011258442.1|1762354_1763590_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258443.1|1763671_1764907_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1764957_1765721_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_133265091.1|1765787_1767164_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	1.2e-59
WP_008578058.1|1767542_1768217_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011258445.1|1768461_1769646_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.2	2.0e-122
WP_011258446.1|1769645_1769906_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.9e-18
WP_011408130.1|1769863_1770070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408131.1|1770066_1770339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182407.1|1770335_1770581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258447.1|1770577_1770853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010364106.1|1771014_1771425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|1771650_1771929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|1771925_1772144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113084422.1|1772452_1775125_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|1775158_1775371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|1775367_1775646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408136.1|1775656_1775977_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
WP_053503015.1|1775979_1776237_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|1776308_1776746_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|1777406_1778393_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|1778389_1778791_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_011258455.1|1778803_1781674_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.2	6.4e-207
WP_011258456.1|1781706_1781820_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|1781828_1782131_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|1782176_1782686_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|1782716_1783883_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_011258460.1|1783894_1784254_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	1.2e-35
WP_011258461.1|1784250_1784814_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	2.4e-25
WP_133265092.1|1784874_1785459_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011258463.1|1785466_1786972_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.8	8.6e-54
WP_011408141.1|1786981_1787527_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	2.1e-50
WP_011408142.1|1787519_1788410_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	6.8e-83
WP_011258467.1|1790199_1790646_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	1.8e-36
WP_011408144.1|1790633_1791053_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	1.4e-38
WP_011258469.1|1791049_1791538_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	3.2e-26
WP_011258470.1|1791537_1792179_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_041182057.1|1792175_1792451_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.9e-21
WP_011258472.1|1792443_1792800_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_011258473.1|1792804_1793014_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
WP_041182058.1|1793013_1793481_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|1793580_1794300_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_011258476.1|1794303_1795320_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	5.5e-137
WP_011258477.1|1795366_1796209_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	1.5e-68
WP_011258478.1|1796330_1798115_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.5	1.2e-267
1797914:1797934	attR	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011408154.1|1798114_1799137_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	2.6e-139
WP_053503138.1|1799162_1799408_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_011258480.1|1799325_1800027_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.6	1.4e-104
WP_011408156.1|1800093_1800840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113114255.1|1800836_1801544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408158.1|1801557_1801899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182060.1|1801879_1802389_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
>prophage 13
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	1955116	2022548	5010511	protease,transposase	Tupanvirus(15.38%)	55	NA	NA
WP_011258529.1|1955116_1956085_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_133265094.1|1956335_1959260_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.9	8.3e-45
WP_011258581.1|1959284_1959458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258585.1|1960790_1962722_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_011408237.1|1962888_1963242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408239.1|1964262_1965069_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_011258588.1|1967101_1968487_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011258589.1|1968625_1970131_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041182076.1|1970141_1971323_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258591.1|1971319_1972117_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011258592.1|1972116_1973289_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_027703337.1|1973448_1974351_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_011408247.1|1974589_1975555_+	cation transporter	NA	NA	NA	NA	NA
WP_011258595.1|1975771_1977853_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_041182077.1|1978089_1978710_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_011258597.1|1978706_1979606_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_011408249.1|1979715_1981302_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_011258599.1|1981467_1983273_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	6.1e-22
WP_011258600.1|1983379_1984180_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1984210_1984588_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1984577_1985258_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1985254_1986154_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1986377_1987100_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011258605.1|1987248_1987971_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_041182079.1|1988129_1989464_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.8	1.3e-29
WP_011258607.1|1989638_1990136_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1990231_1991467_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1991695_1993072_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1993191_1993875_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1993891_1994926_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011258611.1|1995106_1996684_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_041182417.1|1996800_1997805_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011258613.1|1997804_1998359_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041182080.1|1998444_1999197_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1999283_1999490_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_011258616.1|2001024_2001669_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011258617.1|2001658_2004160_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011258618.1|2004156_2005761_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	6.4e-15
WP_011258619.1|2005757_2005991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|2005987_2007010_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|2007346_2007712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|2007708_2008299_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011258623.1|2008396_2010106_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|2010214_2010541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|2010770_2011115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258625.1|2011237_2012413_-	thiolase family protein	NA	NA	NA	NA	NA
WP_011258626.1|2012568_2015397_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|2015457_2016558_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_113014290.1|2016858_2017089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182081.1|2017025_2017553_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|2017954_2018128_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|2018288_2018543_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|2018717_2018984_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|2019174_2019741_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|2021228_2022548_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2052996	2112135	5010511	tRNA,protease,coat,transposase	Acidithiobacillus_phage(25.0%)	46	NA	NA
WP_011258663.1|2052996_2055081_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|2055305_2055755_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011258665.1|2056518_2057577_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258666.1|2057847_2059245_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011258667.1|2059241_2060219_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258668.1|2060400_2062338_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|2062758_2063535_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|2063539_2064214_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_117231565.1|2065853_2067230_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011408311.1|2067269_2067665_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_044756912.1|2067707_2069183_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.8	3.7e-102
WP_109181920.1|2069397_2069613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408313.1|2069980_2070397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2070410_2070581_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|2074275_2074839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258677.1|2075311_2076628_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|2076795_2077398_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|2077471_2077918_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|2077995_2078262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258680.1|2079083_2080427_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258681.1|2080363_2081776_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|2081772_2082510_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_113014035.1|2082509_2084660_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2085529_2086489_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011258686.1|2086664_2090255_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	2.0e-181
WP_041182085.1|2090712_2091453_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.2e-24
WP_027703356.1|2091449_2092706_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2092744_2093536_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2093559_2094021_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258691.1|2094017_2095031_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258692.1|2095430_2097884_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2097880_2099227_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2099253_2100444_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2100446_2101274_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2101270_2102032_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2102049_2102607_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2102787_2103510_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2103566_2103944_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2104071_2104950_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2105119_2105923_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2106298_2107024_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2107026_2107359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2107405_2108440_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2108436_2110788_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2110804_2111575_-	molecular chaperone	NA	NA	NA	NA	NA
WP_099051284.1|2111583_2112135_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 15
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2163273	2302580	5010511	tRNA,transposase	Ralstonia_phage(15.38%)	101	NA	NA
WP_129593104.1|2163273_2164593_-|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2164927_2165854_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2165983_2166589_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2166927_2168697_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_011258750.1|2168693_2169287_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2169554_2170148_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2170346_2171783_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2172024_2173227_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2173269_2176098_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011258755.1|2176278_2177211_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012445147.1|2177207_2178704_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2179042_2179306_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2179585_2180086_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2180332_2181700_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_094187715.1|2184722_2185485_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2186937_2188341_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_027703710.1|2188463_2188886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445136.1|2188971_2189205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2189518_2190355_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_011258771.1|2190364_2191351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258772.1|2191347_2192223_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_014502778.1|2192219_2192582_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2192584_2192833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2192968_2193526_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2193617_2194583_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011258776.1|2194608_2195958_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	1.4e-79
WP_011258777.1|2195950_2196187_+	protein SlyX	NA	NA	NA	NA	NA
WP_011258778.1|2196187_2196940_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_041182093.1|2197273_2198119_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2198259_2199435_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258781.1|2199448_2200759_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011258782.1|2200683_2201742_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258783.1|2201738_2202944_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011258784.1|2203330_2206084_-	methionine synthase	NA	NA	NA	NA	NA
WP_011258785.1|2206226_2207366_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2207362_2208358_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057529.1|2208479_2209628_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258788.1|2209627_2209768_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_075239354.1|2209961_2210186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182095.1|2210139_2211585_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2212151_2214680_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2214890_2215689_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2216759_2217527_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2217528_2217876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|2218034_2219003_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181928.1|2220355_2221321_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2221765_2222950_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011258798.1|2223004_2224480_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.0e-99
WP_011258799.1|2224801_2224984_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2225132_2226332_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258802.1|2227192_2228161_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258803.1|2228352_2229321_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_094187758.1|2229600_2230399_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|2230624_2231590_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|2233819_2234785_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|2234891_2235926_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_133265095.1|2237917_2239020_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2239206_2239674_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258821.1|2240034_2240799_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2240805_2242155_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2242304_2243103_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|2245071_2246040_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258824.1|2246103_2246688_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2246787_2247801_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109182103.1|2249001_2249097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182099.1|2249170_2252686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408408.1|2252909_2253209_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_041182100.1|2253212_2253407_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_041182101.1|2253675_2257398_-	avirulence protein	NA	NA	NA	NA	NA
WP_133265096.1|2260665_2264793_-	avirulence protein	NA	NA	NA	NA	NA
WP_133264963.1|2265081_2266401_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_133265097.1|2268232_2269318_-	peptidase C13	NA	NA	NA	NA	NA
WP_011258836.1|2269643_2270342_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2270344_2270911_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011258838.1|2270922_2271600_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_012445020.1|2271688_2273119_-	amino acid permease	NA	NA	NA	NA	NA
WP_011408420.1|2273195_2274677_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2274813_2275401_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2275556_2276798_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2277006_2278425_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011258845.1|2278755_2280627_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011258847.1|2280916_2281936_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094187828.1|2281929_2282340_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2282357_2282960_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2282952_2284890_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2285058_2285529_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2285525_2285696_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2285692_2286445_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2286539_2287235_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2287231_2287876_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2288102_2289251_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_113014005.1|2289390_2290194_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2290214_2291180_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258858.1|2291342_2292161_-	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_011258859.1|2292276_2292714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408433.1|2292923_2294564_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258861.1|2294556_2295831_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	1.9e-22
WP_010372932.1|2295769_2296675_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_027703552.1|2297026_2297326_+	YciI family protein	NA	NA	NA	NA	NA
WP_133265098.1|2297322_2297646_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182104.1|2301623_2302580_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	8.1e-42
>prophage 16
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2355188	2494284	5010511	tRNA,transposase	Xanthomonas_phage(50.0%)	118	NA	NA
WP_109181915.1|2355188_2356508_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258910.1|2357049_2357808_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_094187826.1|2357958_2358555_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444981.1|2358610_2359837_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE	NA	NA	NA	NA	NA
WP_011258913.1|2359833_2360910_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC	NA	NA	NA	NA	NA
WP_011258914.1|2361024_2361222_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_011408470.1|2361362_2361707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258915.1|2361664_2362876_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408471.1|2363062_2363290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258917.1|2363392_2365753_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_011258918.1|2365964_2367023_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258919.1|2367074_2367641_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_094187745.1|2367637_2368867_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011258921.1|2368984_2370250_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011258922.1|2370230_2370968_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011258923.1|2371108_2372272_-	MFS transporter	NA	NA	NA	NA	NA
WP_041182113.1|2372434_2373391_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	2.4e-41
WP_012444969.1|2373950_2374085_-	aspartate racemase	NA	NA	NA	NA	NA
WP_012444968.1|2374081_2374240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187825.1|2374275_2375145_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011408479.1|2375180_2376233_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011258927.1|2376229_2377285_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011258928.1|2377290_2378064_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408481.1|2378060_2378345_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_011258930.1|2378933_2380466_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408482.1|2381769_2384277_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_011258933.1|2384273_2385242_+	homoserine kinase	NA	NA	NA	NA	NA
WP_024710669.1|2388177_2388492_-	EthD family reductase	NA	NA	NA	NA	NA
WP_011258935.1|2388653_2389958_+	threonine synthase	NA	NA	NA	NA	NA
WP_041182115.1|2390060_2390804_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_113224536.1|2391802_2392027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444952.1|2392068_2393481_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187758.1|2393986_2394785_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2395098_2395425_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2395434_2396349_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2396345_2397641_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2397637_2398729_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2398725_2399853_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2399849_2400452_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2400448_2401183_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2401176_2401953_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2401942_2402563_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_133265099.1|2403148_2407003_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2407226_2407526_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_041182100.1|2407529_2407724_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_137455828.1|2407992_2411376_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2411834_2412614_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2412655_2412754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2413507_2413693_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_041182118.1|2413692_2413896_+	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	79.3	4.0e-15
WP_011258952.1|2414031_2415105_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2415209_2415509_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2415872_2416112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2416218_2417703_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_109181931.1|2417834_2418800_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_075240566.1|2418812_2419091_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_133265100.1|2419087_2420296_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	2.9e-52
WP_011258529.1|2420306_2421275_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_080493496.1|2421486_2421657_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240058.1|2421720_2422122_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
WP_075240059.1|2422765_2423026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239628.1|2423151_2423388_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	95.5	2.6e-18
WP_011408511.1|2423512_2423695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2423816_2424128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2424197_2424960_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|2425464_2425788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242367.1|2426184_2426427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2426401_2426914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264935.1|2427044_2427807_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182124.1|2429112_2433537_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2433805_2434000_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2434003_2434303_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_133265140.1|2434442_2438039_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182100.1|2438307_2438502_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2438505_2438805_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_133265101.1|2439028_2442784_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2442873_2443636_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182100.1|2443867_2444062_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_041182126.1|2444065_2444365_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	3.2e-45
WP_041182127.1|2444589_2448606_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|2448779_2449001_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2448997_2449669_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2450693_2450939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2450922_2451879_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|2452293_2453262_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181987.1|2453406_2454372_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2454349_2458450_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_041182131.1|2459982_2460882_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011257031.1|2461051_2462020_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408524.1|2462208_2462715_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2463189_2463822_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2463821_2465678_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011408525.1|2465674_2467174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2467116_2467581_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_069960087.1|2467577_2468378_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2468647_2469688_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2469684_2471454_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2471450_2471915_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2471918_2472581_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2472609_2475018_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181928.1|2475271_2476237_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2477630_2478365_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2478357_2479599_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2479622_2480075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2480025_2480274_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_007963513.1|2480384_2481167_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_080493582.1|2481183_2481393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2481396_2483187_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2483221_2483608_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2483604_2484000_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011408533.1|2484268_2485141_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2485269_2486367_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_041182133.1|2486802_2488233_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.3	2.2e-67
WP_011258988.1|2488229_2489237_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2489233_2489953_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_133265102.1|2490055_2491972_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_012444902.1|2492027_2492687_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_133265103.1|2492907_2494284_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.3e-77
>prophage 17
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2500190	2577838	5010511	protease,transposase	Bacillus_phage(33.33%)	50	NA	NA
WP_133264960.1|2500190_2501222_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_133264959.1|2501306_2502069_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258999.1|2503974_2504208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2504374_2505349_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_041182433.1|2506112_2506994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408549.1|2508694_2509828_+	phospholipase A	NA	NA	NA	NA	NA
WP_011408550.1|2510256_2510709_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_125168754.1|2510396_2510891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259006.1|2511027_2512545_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_011259007.1|2512878_2514759_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011408551.1|2514947_2515727_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2515877_2516363_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_012444868.1|2516340_2516589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703343.1|2518819_2519059_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259011.1|2519310_2520024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2521558_2522059_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757420.1|2522220_2522799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259015.1|2522890_2523391_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259016.1|2523457_2524291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2524341_2524656_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|2524839_2525028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444859.1|2525444_2526053_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011259021.1|2527254_2529033_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_041182436.1|2529161_2531351_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_011259023.1|2532677_2534534_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011408561.1|2534778_2536341_-	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
WP_075240030.1|2536350_2536608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259025.1|2536600_2539213_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_133265105.1|2539646_2541602_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011408564.1|2541836_2542460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259028.1|2542463_2542808_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011259029.1|2542965_2544480_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011259030.1|2544476_2544857_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_011259031.1|2545035_2545878_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011259032.1|2545874_2546690_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	2.1e-30
WP_011259033.1|2546725_2547211_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011259034.1|2547214_2548582_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.9	9.9e-25
WP_011408568.1|2549197_2550118_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011408569.1|2550155_2551334_-	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
WP_075247044.1|2553168_2553348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259038.1|2553894_2555271_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.6e-62
WP_011259039.1|2556102_2558838_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_041182136.1|2559327_2560443_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408576.1|2560435_2563528_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011408577.1|2563524_2565009_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_027703759.1|2565127_2566150_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011259043.1|2566146_2566758_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_133265106.1|2567034_2575176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181915.1|2575337_2576657_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259046.1|2576869_2577838_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
>prophage 18
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2617730	2664220	5010511	tRNA,transposase	Moumouvirus(20.0%)	46	NA	NA
WP_011259079.1|2617730_2619125_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	4.5e-81
WP_011259080.1|2619126_2619384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2619380_2619686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259081.1|2619682_2620009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2620734_2621397_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2621485_2622016_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011259085.1|2622028_2622676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259087.1|2624216_2625488_+	kynureninase	NA	NA	NA	NA	NA
WP_011259088.1|2625659_2627027_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2627330_2628776_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2628772_2629459_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2629431_2630451_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2630492_2631053_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2631073_2632030_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2632197_2632974_-	NAD kinase	NA	NA	NA	NA	NA
WP_133264958.1|2632970_2633270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115892996.1|2633219_2634017_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259095.1|2634309_2636445_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2636441_2636633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2638407_2638914_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2638954_2639482_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2639478_2639970_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011259100.1|2639993_2640569_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2640645_2641599_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2641687_2642560_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_041182142.1|2642556_2643390_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2643502_2644201_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259105.1|2644364_2645147_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011259106.1|2645155_2645527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2645523_2646234_+	endonuclease III	NA	NA	NA	NA	NA
WP_011259108.1|2647543_2648092_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_133264957.1|2648218_2648982_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2649155_2649476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2649815_2651066_+	porin	NA	NA	NA	NA	NA
WP_099051278.1|2651183_2652275_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.1e-48
WP_012444785.1|2652460_2653552_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_011259112.1|2653664_2654639_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011259113.1|2654638_2655508_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2655530_2656361_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2656489_2657200_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2657332_2657740_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2658017_2658659_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2658729_2660049_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2660285_2661347_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_133264972.1|2661397_2662582_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_133264956.1|2662831_2664220_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2670869	2743426	5010511	tRNA,protease,transposase	uncultured_Mediterranean_phage(35.71%)	53	NA	NA
WP_011259125.1|2670869_2672015_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2672084_2673155_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2673320_2673752_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2673875_2675372_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011408639.1|2675331_2675646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|2675716_2676424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182069.1|2678590_2679910_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2680059_2681028_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011259140.1|2682376_2683498_-	phytase	NA	NA	NA	NA	NA
WP_103057211.1|2685764_2686190_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2686382_2687015_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2687411_2688174_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2688454_2689486_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2689492_2691286_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2691282_2691567_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703975.1|2691557_2691740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408650.1|2691798_2692284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2692342_2692849_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2692845_2693466_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2693706_2695611_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2695698_2696756_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_133265107.1|2696853_2698173_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2698406_2699564_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2699840_2700806_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2700783_2702259_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011259163.1|2706988_2708209_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2708523_2709921_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|2709931_2711152_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2711148_2711787_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2711857_2712718_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2712714_2713503_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2713513_2714719_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2714737_2715163_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2715382_2716015_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2716039_2718412_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2718569_2719775_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2720095_2721427_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2721423_2721774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2721805_2722213_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2722209_2722536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2722567_2723944_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2724180_2728347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259178.1|2728459_2729089_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2729195_2731124_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2731286_2733647_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2733930_2734899_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2734956_2736078_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2737505_2738258_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2738338_2738557_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2738837_2741120_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2741263_2741584_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2741834_2742293_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2742289_2743426_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2823721	2846764	5010511	transposase	Ralstonia_phage(40.0%)	14	NA	NA
WP_109181915.1|2823721_2825041_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_125168757.1|2825147_2825627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2833760_2834153_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2834161_2834623_+	cytochrome c	NA	NA	NA	NA	NA
WP_041182155.1|2835127_2835388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239029.1|2835463_2835706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264955.1|2835918_2836173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181963.1|2837145_2838111_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_133265108.1|2838117_2839263_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959881.1|2839387_2840356_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
WP_011408708.1|2840744_2842430_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239109.1|2842426_2844163_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-15
WP_011407237.1|2844679_2845636_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|2845795_2846764_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 22
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	2930534	3014215	5010511	tRNA,protease,transposase	Bacillus_phage(16.67%)	55	NA	NA
WP_011259346.1|2930534_2930669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015463309.1|2930891_2931071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2931672_2931963_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2931950_2932229_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2932713_2932902_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408397.1|2933674_2934859_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|2935303_2936269_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408763.1|2940761_2941178_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011259351.1|2941388_2941718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2941750_2942191_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2942269_2942905_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_103057267.1|2943297_2944041_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2944048_2945308_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2945307_2945952_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2946481_2947468_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011259360.1|2949403_2950858_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011259361.1|2951281_2952268_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	48.1	2.8e-45
WP_011259362.1|2952679_2953342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2953396_2953882_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2953881_2954400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2954494_2955373_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2955369_2956650_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2956665_2957667_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2957818_2959183_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041182453.1|2959437_2959848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259369.1|2960003_2960834_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2961153_2962401_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259371.1|2962546_2964058_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011259372.1|2964044_2965637_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2965633_2966836_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_133265111.1|2967342_2968734_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259375.1|2968964_2970350_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2971258_2972638_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_041182167.1|2972637_2973954_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012444665.1|2974090_2975335_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
WP_041182168.1|2975642_2976923_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_094187755.1|2977228_2977537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2977496_2979845_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_133265112.1|2979841_2980687_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_069964545.1|2980693_2982403_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011259384.1|2982932_2984285_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011258579.1|2986504_2987473_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259386.1|2988809_2989664_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011259387.1|2989834_2991139_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_041182170.1|2991280_2995375_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_011259389.1|2995408_2996395_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_041182171.1|2997179_2998607_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407237.1|2998969_2999926_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_112998507.1|2999959_3000496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|3000599_3001568_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011259392.1|3001819_3006844_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011259393.1|3007121_3007781_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259394.1|3007795_3009100_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|3009112_3012283_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_115892988.1|3013258_3014215_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3023569	3088631	5010511	transposase	uncultured_Caudovirales_phage(57.14%)	47	NA	NA
WP_011258802.1|3023569_3024538_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075251900.1|3024832_3027178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182173.1|3027202_3027940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115892990.1|3027965_3030800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259405.1|3030796_3031726_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011408809.1|3031734_3034497_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	6.6e-44
WP_011407175.1|3037141_3038110_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408812.1|3038647_3039037_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408813.1|3039191_3040151_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3040083_3040398_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|3040625_3041945_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_133265113.1|3043049_3043466_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_103057251.1|3043462_3043771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182107.1|3043712_3044090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|3044151_3044787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082336054.1|3044885_3045509_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_011258351.1|3045673_3046642_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.9e-99
WP_125168758.1|3046911_3047412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113014015.1|3047720_3050762_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182176.1|3051811_3052264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182177.1|3052518_3054324_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|3054325_3054673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408824.1|3054748_3055456_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.1e-51
WP_011259416.1|3055607_3056000_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075239855.1|3056022_3056538_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|3056534_3056888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|3056976_3057717_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011259418.1|3057723_3058584_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|3058699_3059482_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011259420.1|3059478_3060501_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3060601_3060910_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3060906_3061272_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259422.1|3061305_3063315_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_113343217.1|3063542_3063737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103073514.1|3065418_3066105_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408833.1|3066420_3067182_+	transporter	NA	NA	NA	NA	NA
WP_033013495.1|3067195_3069538_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_115840174.1|3070034_3071000_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259427.1|3071240_3073499_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	4.9e-13
WP_041182458.1|3074229_3076341_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_011259430.1|3077028_3079104_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|3079695_3081957_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011259432.1|3082350_3084612_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_075239040.1|3085290_3085500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259433.1|3085569_3086367_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3086502_3086985_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3087833_3088631_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3170013	3181787	5010511	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3170013_3170313_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3170355_3170586_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3170829_3171579_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3171583_3172279_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_109181974.1|3172214_3172442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3172464_3172764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3173151_3173556_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3174280_3174493_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3174632_3177281_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3177382_3177871_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3178173_3179208_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3179380_3180022_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3180110_3181787_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 25
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3264354	3311524	5010511	plate,transposase	Acidithiobacillus_phage(25.0%)	29	NA	NA
WP_133265118.1|3264354_3265830_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	4.5e-100
WP_011259579.1|3265912_3268501_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3268557_3269670_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3269794_3270373_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259582.1|3271858_3273946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264948.1|3274331_3275429_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_113055222.1|3275845_3278926_+	histidine kinase	NA	NA	NA	NA	NA
WP_033013236.1|3281961_3282669_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3282665_3283658_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3283654_3286114_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3286227_3287208_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182188.1|3287216_3288245_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012444504.1|3288417_3288744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703483.1|3288740_3291644_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|3291640_3292363_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041182189.1|3292359_3293007_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011259595.1|3293003_3296462_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_133265119.1|3296465_3297782_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3297783_3299121_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_113084429.1|3299117_3300590_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3300586_3301126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3301134_3303072_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3303336_3303795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3304181_3304676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3304741_3305239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182190.1|3305427_3308133_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_011408954.1|3308165_3309176_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3309139_3311017_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3311020_3311524_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 26
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3316355	3369029	5010511	transposase	Ralstonia_phage(100.0%)	41	NA	NA
WP_011257031.1|3316355_3317324_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011260830.1|3317472_3318708_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_133264946.1|3318711_3320670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113262626.1|3320694_3320877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|3320965_3321934_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011408961.1|3322622_3324965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3324982_3325729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264945.1|3325757_3328592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133265120.1|3329179_3330148_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_041182192.1|3330409_3332233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408965.1|3332246_3332846_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_011408966.1|3332934_3333291_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011259617.1|3333287_3333710_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3333725_3333959_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011408968.1|3333985_3334246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182194.1|3334594_3336385_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011259619.1|3336417_3337404_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_069964823.1|3337814_3341534_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3342059_3342823_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3342926_3343574_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3343795_3344557_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408974.1|3344656_3345022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3345080_3345512_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3345523_3346786_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011259626.1|3346769_3348062_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3348431_3349202_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3349958_3351194_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3352493_3352751_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3353190_3354174_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011257031.1|3354489_3355458_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408981.1|3355586_3356549_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|3356988_3357168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182196.1|3357532_3358498_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259636.1|3359705_3360683_+	siroheme synthase	NA	NA	NA	NA	NA
WP_012445407.1|3361491_3361686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3363079_3363442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3363425_3363995_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3364032_3365286_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3365491_3365869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102607467.1|3366426_3367392_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187766.1|3368231_3369029_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3510503	3642873	5010511	tRNA,protease,transposase	Ralstonia_phage(15.38%)	107	NA	NA
WP_094187736.1|3510503_3511267_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|3512099_3512345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|3512290_3514657_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3514653_3515328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3515537_3516476_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3516598_3517948_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3517944_3518832_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3519149_3519956_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3520401_3521619_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3521724_3522693_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3523049_3523718_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3523714_3524488_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_094187839.1|3525061_3527128_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3527694_3528720_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3528804_3529878_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3529870_3530974_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3530984_3531911_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3531991_3532642_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3532638_3533487_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3534037_3535621_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_012445550.1|3535540_3535726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756359.1|3537043_3538219_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_103057775.1|3538221_3538458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3538619_3539126_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3539247_3540648_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3540910_3541486_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3541482_3541917_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3541944_3542112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265121.1|3542112_3542532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3542777_3542963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3542997_3543567_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3543659_3544511_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3545898_3547914_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3548184_3548883_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3548923_3549331_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011259790.1|3549768_3550731_-|transposase	IS1595-like element ISXo16 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3552015_3553266_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3553273_3554518_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3554745_3555225_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3555335_3555872_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3555981_3556731_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3556938_3557430_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_125168763.1|3557442_3557670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182214.1|3558543_3559863_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011259800.1|3560007_3561714_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011259801.1|3561747_3563052_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3563083_3563344_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011259803.1|3563345_3564221_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3566055_3566520_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3566571_3566760_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069959944.1|3566732_3567053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445571.1|3567049_3568417_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011259807.1|3568562_3569144_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3569400_3570846_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_094187728.1|3572166_3572964_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075241074.1|3574021_3577942_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011259814.1|3578089_3579589_-	ribonuclease G	NA	NA	NA	NA	NA
WP_011409098.1|3579588_3580161_-	Maf-like protein	NA	NA	NA	NA	NA
WP_011259816.1|3580299_3581034_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_094187731.1|3581260_3582058_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182215.1|3582357_3585471_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_103073422.1|3585781_3586597_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011409102.1|3586886_3587357_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_011259820.1|3587911_3588121_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3588446_3589562_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3589573_3589990_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027703805.1|3590046_3590946_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3590942_3591971_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_041182216.1|3591993_3592629_-	lipoprotein	NA	NA	NA	NA	NA
WP_011259825.1|3593142_3595785_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3595857_3596469_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|3596673_3597531_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_027703806.1|3597786_3598236_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3599625_3600388_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3600998_3601292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3601765_3601999_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3602032_3603046_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3603013_3603205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181986.1|3603295_3604615_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3604702_3605917_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3606062_3606590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181987.1|3606586_3607552_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3607792_3608555_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|3609687_3610644_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011407175.1|3612598_3613567_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011258803.1|3613727_3614696_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_115840192.1|3614840_3615806_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082356972.1|3615771_3616185_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3616181_3616945_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3617816_3618614_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3618647_3619040_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3619130_3619523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239565.1|3623503_3623728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445601.1|3623992_3625777_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3625967_3626168_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3626703_3627498_+	thiazole synthase	NA	NA	NA	NA	NA
WP_075239634.1|3627490_3627784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259853.1|3627799_3628558_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3628633_3630496_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3630553_3630895_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3631154_3631430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259859.1|3634483_3635197_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|3635257_3635680_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3635811_3636575_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3639648_3640560_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_033013519.1|3641075_3641213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801902.1|3641907_3642873_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3712885	3788300	5010511	plate,transposase	Liberibacter_phage(20.0%)	55	NA	NA
WP_094187731.1|3712885_3713683_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3714760_3715540_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3715754_3716384_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3716444_3717200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3717528_3718305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182228.1|3718277_3718544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3718713_3720288_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3720536_3720803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113014228.1|3721081_3724261_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.4	1.6e-73
WP_041182230.1|3724260_3724935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057539.1|3724934_3725681_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_041182231.1|3725677_3727252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409179.1|3727244_3727679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|3727689_3729219_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3729521_3730514_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_011259923.1|3730566_3730875_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011409182.1|3730881_3731145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113014232.1|3731454_3734928_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_041182233.1|3735067_3736066_+	Abi family protein	NA	NA	NA	NA	NA
WP_011259927.1|3736112_3737657_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	24.2	3.4e-13
WP_113014234.1|3737634_3739029_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011259929.1|3739062_3739371_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3739377_3739641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182477.1|3740458_3741124_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011259932.1|3741417_3742440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113084426.1|3742449_3744465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133265122.1|3744949_3745639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133265123.1|3745990_3748852_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_049756342.1|3748870_3749776_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_133264943.1|3749717_3751724_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.3	1.0e-25
WP_113013972.1|3751728_3753732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113013975.1|3753737_3754190_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_113013977.1|3754940_3755711_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_133264942.1|3755825_3758588_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	1.2e-42
WP_011259938.1|3758680_3759034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3759064_3761794_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3761879_3762971_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259941.1|3762934_3764770_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259942.1|3764772_3765261_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3765408_3765906_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259943.1|3766047_3767544_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011259944.1|3767547_3768048_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012445672.1|3768094_3768583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409206.1|3768969_3769578_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011259947.1|3769729_3771064_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_041182479.1|3771063_3771852_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259949.1|3771862_3774400_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011259950.1|3774424_3777319_+	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.5	7.5e-06
WP_128415339.1|3777315_3778131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259951.1|3778153_3779587_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_129215583.1|3782040_3782586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082331607.1|3782627_3784886_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_080493944.1|3784945_3786430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323407.1|3786892_3787087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182240.1|3787085_3788300_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	2.4e-54
>prophage 29
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3862773	3873604	5010511	transposase	Burkholderia_virus(28.57%)	9	NA	NA
WP_133265127.1|3862773_3863577_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	1.5e-25
WP_027703308.1|3864007_3864190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182486.1|3864661_3867616_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	5.3e-257
WP_012444306.1|3867675_3867858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260010.1|3867945_3868395_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_011260011.1|3868391_3869087_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_011409251.1|3869094_3870165_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_011409252.1|3870161_3871247_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_069960108.1|3872647_3873604_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
>prophage 30
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	3918013	3978986	5010511	tRNA,transposase	Ralstonia_phage(33.33%)	59	NA	NA
WP_011260048.1|3918013_3919312_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_011260049.1|3919289_3920375_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	43.3	2.5e-07
WP_011260050.1|3920371_3922078_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011260051.1|3922543_3923062_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_011260052.1|3923094_3923877_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_011260053.1|3923858_3925088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409264.1|3925173_3925440_-	acylphosphatase	NA	NA	NA	NA	NA
WP_011260055.1|3925439_3926042_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_011260056.1|3926038_3927316_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005925984.1|3927427_3928024_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_041182600.1|3928020_3928368_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_011409266.1|3928576_3929797_-	xylanase	NA	NA	NA	NA	NA
WP_011260060.1|3930310_3930796_+	asparaginase	NA	NA	NA	NA	NA
WP_011260061.1|3930800_3931214_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_011260065.1|3932952_3934038_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_011260066.1|3934102_3934657_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_011409271.1|3934843_3935263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703428.1|3935377_3935602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239073.1|3935537_3935717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187763.1|3935805_3936603_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260068.1|3936517_3938005_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_011409274.1|3938001_3938307_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_041182254.1|3938430_3939006_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011260071.1|3939002_3939353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703741.1|3939358_3939844_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_041182487.1|3940241_3941339_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_109181915.1|3941531_3942851_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_133265128.1|3943086_3944019_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.6e-97
WP_011260076.1|3944121_3946461_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011409277.1|3946828_3947404_+	nitroreductase	NA	NA	NA	NA	NA
WP_011260078.1|3947400_3948387_+	exodeoxyribonuclease IX	NA	A0A2H4IAS6	Erwinia_phage	27.0	2.8e-13
WP_011260079.1|3948383_3948935_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011260080.1|3948915_3949713_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_011260081.1|3949913_3950855_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_027703739.1|3951362_3951740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260082.1|3951750_3952077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260083.1|3952120_3952519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260084.1|3952756_3953602_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010381556.1|3953803_3954367_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011409282.1|3954562_3956155_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
WP_011260086.1|3956246_3957188_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057554.1|3957381_3957618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260087.1|3957614_3958046_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_011260088.1|3958108_3959077_+	transaldolase	NA	NA	NA	NA	NA
WP_109181970.1|3959740_3960706_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|3962076_3963045_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260080.1|3967195_3967993_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_011260081.1|3968193_3969135_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_027703739.1|3969642_3970020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260082.1|3970030_3970357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260083.1|3970400_3970799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260084.1|3971036_3971882_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010381556.1|3972083_3972647_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011409282.1|3972842_3974435_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
WP_011260086.1|3974526_3975468_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057554.1|3975661_3975898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260087.1|3975894_3976326_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_011260088.1|3976388_3977357_+	transaldolase	NA	NA	NA	NA	NA
WP_109181970.1|3978020_3978986_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4032124	4079756	5010511	tRNA,transposase	Tupanvirus(22.22%)	48	NA	NA
WP_094187801.1|4032124_4032922_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260134.1|4032919_4033750_+	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_011409313.1|4033746_4034211_+	response regulator	NA	NA	NA	NA	NA
WP_012444257.1|4034325_4034562_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011260137.1|4034563_4035205_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033013479.1|4035259_4035466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260138.1|4035609_4037349_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_041182259.1|4037541_4037727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|4038438_4039202_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070807999.1|4039406_4039616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_133264939.1|4039775_4040574_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756346.1|4041056_4041797_+	DMT family transporter	NA	NA	NA	NA	NA
WP_041182260.1|4042150_4042561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260143.1|4042560_4043121_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011260144.1|4043157_4044201_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_041182261.1|4044522_4045632_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011260147.1|4046815_4047538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409323.1|4047737_4048145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260149.1|4048272_4048746_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011260150.1|4048791_4049619_+	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_011260151.1|4049702_4051172_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_027703837.1|4051374_4052853_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.8e-40
WP_011409327.1|4053037_4054039_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260154.1|4054475_4055372_-	gallate dioxygenase	NA	NA	NA	NA	NA
WP_109182027.1|4056455_4057421_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4057556_4058591_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011260159.1|4059173_4059986_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011409333.1|4060113_4061295_-	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_011409334.1|4061291_4062500_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_011260162.1|4062798_4063377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260163.1|4063380_4063938_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_027704107.1|4063975_4064884_+	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	30.8	3.4e-37
WP_012444236.1|4065011_4067453_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_011260166.1|4067449_4068841_+	chaperone SurA	NA	NA	NA	NA	NA
WP_103057432.1|4068864_4069833_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011260168.1|4070089_4070878_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011260169.1|4070914_4071298_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_011260170.1|4071326_4072283_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	S4TNS0	Salmonella_phage	25.3	1.3e-07
WP_011260171.1|4072336_4072831_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.9	3.0e-24
WP_027704106.1|4072827_4073115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260172.1|4073181_4073976_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.8	3.0e-106
WP_011260173.1|4073972_4074863_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011260174.1|4074917_4075409_-	membrane protein	NA	NA	NA	NA	NA
WP_027704105.1|4075408_4076299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182264.1|4076636_4077275_-	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	25.4	3.3e-07
WP_011409344.1|4077370_4077751_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_011260178.1|4077933_4078437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117231603.1|4078958_4079756_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4203680	4314851	5010511	transposase	Ralstonia_phage(20.0%)	75	NA	NA
WP_115840193.1|4203680_4205288_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4205449_4205713_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4205717_4206377_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4206563_4207928_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4208143_4208839_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4209785_4210409_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409414.1|4210610_4211351_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4211444_4212095_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4212186_4213002_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4213051_4213789_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4215717_4216707_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011407913.1|4217626_4218841_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011258802.1|4221185_4222154_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409552.1|4222352_4223315_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011409421.1|4223967_4224234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4225165_4225964_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4227610_4228843_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4228882_4229845_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4230020_4230977_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|4231188_4232157_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182027.1|4235849_4236815_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4237288_4237519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4238142_4240185_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4240186_4242085_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4242086_4243340_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4243336_4243942_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4244361_4245516_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4245518_4246547_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4246543_4247620_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4247660_4248938_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4248982_4249750_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4249964_4251131_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4253674_4256572_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011260307.1|4256722_4259413_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4259694_4260651_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_082325343.1|4260684_4260897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409439.1|4261141_4262377_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260311.1|4263812_4264997_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011260312.1|4265064_4265802_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4265970_4266486_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4266577_4268080_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4268083_4268524_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4268520_4270332_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|4270617_4270980_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4271139_4272192_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4272531_4273473_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4273493_4274831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4275002_4275383_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4275507_4276269_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4278517_4279921_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4280043_4281099_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_113084381.1|4281370_4282126_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4282417_4284601_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_041182498.1|4285099_4286095_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_041182275.1|4286190_4288002_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260331.1|4288246_4289260_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4289274_4289973_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4289960_4290239_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4291304_4292510_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4293010_4294426_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4294422_4295562_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4296787_4297330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4297301_4298576_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4298575_4298794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409552.1|4298870_4299833_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115862310.1|4299712_4301848_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_041182276.1|4301844_4302924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444101.1|4304463_4305450_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011260340.1|4306207_4307326_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_011260341.1|4307322_4309383_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011260342.1|4309386_4309872_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_027703470.1|4309868_4311215_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012444096.1|4311387_4312434_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_011260344.1|4312709_4313642_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_011257031.1|4313882_4314851_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 33
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4327815	4409954	5010511	protease,transposase	Erwinia_phage(18.18%)	57	NA	NA
WP_011260359.1|4327815_4329183_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4329293_4329845_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012444084.1|4330360_4331278_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	1.3e-12
WP_011260362.1|4331477_4332158_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4332145_4333000_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4332989_4333226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4333283_4333682_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4334054_4336190_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4336313_4337498_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_103073476.1|4337823_4338264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133265131.1|4338337_4340431_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4340498_4340810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4341197_4341767_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4341875_4342841_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4343399_4344200_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011260373.1|4344750_4345665_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4345695_4346433_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4346463_4347516_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4347520_4348189_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4348340_4350278_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4351004_4351767_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240244.1|4351893_4352154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260378.1|4352081_4353731_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4355121_4356609_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_011409490.1|4356816_4358277_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|4359511_4362136_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4362390_4365261_+	insulinase family protein	NA	NA	NA	NA	NA
WP_041182280.1|4365808_4366738_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4366776_4367781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|4368023_4368787_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4369834_4370620_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_012444057.1|4370642_4370849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260388.1|4370873_4372547_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4373090_4373537_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4373867_4374152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4374746_4375658_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|4375903_4376899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4376992_4378369_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_011260393.1|4379535_4381236_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011260394.1|4381644_4383417_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_099051318.1|4383692_4384577_-	DMT family transporter	NA	NA	NA	NA	NA
WP_027703846.1|4384765_4385644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4387683_4388775_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|4390677_4393002_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260402.1|4393197_4395144_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4395518_4395710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4396100_4397684_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4398031_4398628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|4399976_4400825_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4400859_4402335_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4403002_4403932_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4404166_4404658_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4404654_4405326_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_024711902.1|4405720_4406050_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_011260412.1|4406252_4407185_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_094187763.1|4407973_4408772_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4408919_4409954_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 34
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4430821	4468509	5010511	tRNA,transposase	Moraxella_phage(100.0%)	37	NA	NA
WP_041182581.1|4430821_4431787_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4432319_4432700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103073472.1|4432902_4433808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260437.1|4433876_4435172_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_041182291.1|4435287_4435812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4436237_4437503_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4437499_4438477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260441.1|4438580_4439384_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4439559_4440369_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_113084389.1|4441217_4441865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182293.1|4441959_4442535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260446.1|4442672_4443425_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4443462_4443903_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_103057307.1|4443817_4444042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|4444109_4444451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4444676_4445054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4445264_4445462_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260451.1|4445768_4446515_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260452.1|4446607_4447414_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4447637_4449050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4449046_4450144_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187731.1|4450298_4451097_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182294.1|4451316_4452279_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109181916.1|4452726_4453489_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4453770_4454547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704068.1|4454543_4455860_+	amino acid permease	NA	NA	NA	NA	NA
WP_133264980.1|4455918_4456682_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4456885_4457167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4457727_4458162_-	membrane protein	NA	NA	NA	NA	NA
WP_041182296.1|4458336_4459515_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_125168767.1|4459511_4459877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182297.1|4460510_4461473_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4462212_4462975_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4462982_4463948_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4464610_4466782_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4467009_4467366_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4467444_4468509_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 35
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4491459	4549993	5010511	tRNA,transposase	Acinetobacter_phage(30.0%)	46	NA	NA
WP_094187805.1|4491459_4492438_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_003483093.1|4493495_4493966_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4494308_4494524_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4494604_4495222_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4495770_4496163_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4496166_4496595_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4496780_4497434_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4497739_4498054_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4498213_4499008_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4499145_4499838_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4500158_4500875_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4500867_4501665_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4501801_4502839_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4502956_4503586_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_041182300.1|4503582_4503741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409581.1|4503737_4504319_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4505746_4506848_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4507452_4509684_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_027704002.1|4509873_4511586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265132.1|4511734_4513111_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187777.1|4515318_4516117_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|4517101_4518070_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_041182302.1|4518236_4519208_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.2e-37
WP_082322968.1|4519400_4520585_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_011260517.1|4521052_4521868_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4522626_4523943_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4524202_4525447_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4525539_4528788_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4528921_4532062_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4532351_4533719_-	VOC family protein	NA	NA	NA	NA	NA
WP_012443929.1|4533728_4533938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182775.1|4534463_4535429_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|4535847_4536813_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4537275_4537746_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4537774_4538197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4538272_4538707_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4538816_4539332_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4539347_4540373_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4540695_4541292_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4541649_4543377_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4543426_4544869_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4544853_4546200_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443920.1|4546390_4547134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4547235_4547847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4547951_4549175_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4549516_4549993_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 36
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4562860	4625796	5010511	integrase,transposase	Acidithiobacillus_phage(22.22%)	37	4562744:4562763	4576804:4576823
4562744:4562763	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260549.1|4562860_4564237_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4564247_4564781_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4565209_4566469_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4566607_4567915_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4569999_4571034_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4571384_4571930_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4571955_4572222_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4572396_4574235_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4574465_4575341_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_103057293.1|4577164_4577428_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4576804:4576823	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_041182307.1|4577621_4578602_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	5.3e-97
WP_011260560.1|4579716_4580616_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4581562_4584364_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4584440_4584731_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_041182308.1|4585609_4585909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264982.1|4586648_4588025_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	3.2e-79
WP_133264983.1|4589080_4590295_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.4e-54
WP_011260567.1|4590947_4592402_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_011409622.1|4592411_4595099_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011258579.1|4598159_4599128_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_148236288.1|4599580_4603519_+	avirulence protein	NA	NA	NA	NA	NA
WP_033013372.1|4606236_4606584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260578.1|4606801_4608808_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4608804_4609236_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4609232_4609652_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011260580.1|4610137_4610872_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011260581.1|4611082_4611673_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011260582.1|4611806_4612754_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_027703830.1|4613649_4614150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4617237_4617798_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011260588.1|4617893_4620719_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4620880_4621399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4621398_4622319_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4622747_4623371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182313.1|4623380_4623566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242264.1|4623668_4624250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113114264.1|4625238_4625796_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4744066	4846934	5010511	tail,tRNA,transposase	Arthrobacter_phage(20.0%)	74	NA	NA
WP_011260687.1|4744066_4746304_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012443796.1|4746593_4747502_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260689.1|4747591_4749406_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_113084352.1|4749791_4758251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264987.1|4758715_4759513_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_112998614.1|4759427_4759658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256607.1|4759685_4759922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|4760057_4760810_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4760869_4761769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4761920_4762676_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_044756277.1|4762672_4763314_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4763329_4763557_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4763629_4764532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4764686_4765652_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075239583.1|4765749_4766505_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011260699.1|4766585_4767044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4767314_4768100_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260701.1|4768726_4769632_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011260702.1|4769695_4770613_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_012443788.1|4770703_4771213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259480.1|4771216_4772554_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4772779_4773847_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4774022_4776218_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4776214_4778179_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4778190_4779450_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4779449_4781150_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4781152_4783867_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4784089_4785562_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4786539_4787595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4787822_4789241_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011260713.1|4789281_4790259_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_113084359.1|4791676_4793158_-	MFS transporter	NA	NA	NA	NA	NA
WP_099051314.1|4793499_4796373_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703497.1|4796471_4797959_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4797990_4799025_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_133264989.1|4799441_4800239_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|4801115_4801253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4801545_4802511_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4803238_4804001_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4804018_4805119_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4805184_4806306_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011260726.1|4806315_4807410_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4807484_4808165_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_094187716.1|4808197_4808996_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182069.1|4809124_4810444_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182331.1|4810546_4811503_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4812969_4813428_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4813529_4813958_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011260735.1|4814206_4815070_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_041182240.1|4816699_4817914_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	2.4e-54
WP_042465346.1|4818246_4818513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4818674_4818923_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033013299.1|4819131_4819890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182524.1|4819886_4820582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260740.1|4820680_4821013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260741.1|4821005_4821482_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011260742.1|4821484_4821919_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044751358.1|4822056_4822281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712139.1|4822281_4822476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4822616_4822949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260744.1|4823197_4823296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260745.1|4823398_4824793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133265134.1|4825730_4826021_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	3.3e-15
WP_011260747.1|4826038_4826320_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_041182333.1|4826414_4828673_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	2.5e-09
WP_041182334.1|4828860_4832934_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_041182335.1|4832930_4836344_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_125168771.1|4836391_4836682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260751.1|4836749_4839404_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.7	1.1e-48
WP_133262012.1|4843616_4844129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4844144_4844690_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4844758_4845286_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4845344_4845881_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4845968_4846934_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP033193	Xanthomonas oryzae pv. oryzae strain JW11089 chromosome, complete genome	5010511	4928316	4998645	5010511	protease,transposase	Ralstonia_virus(18.18%)	56	NA	NA
WP_011260830.1|4928316_4929552_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057311.1|4930191_4930365_-	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
WP_011260831.1|4930423_4931479_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260832.1|4931471_4932143_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260833.1|4932240_4933548_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260834.1|4933564_4934983_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011260837.1|4935554_4936949_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_113001964.1|4936996_4937287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260838.1|4937296_4939483_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_012446438.1|4939658_4939883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182775.1|4940463_4941429_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260840.1|4941604_4943020_-	amino acid permease	NA	NA	NA	NA	NA
WP_076659590.1|4943236_4943446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260841.1|4943510_4945835_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_027704004.1|4946192_4946603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757577.1|4946980_4947526_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_011260844.1|4947621_4948998_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.0e-77
WP_011260845.1|4950034_4951162_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4952017_4953358_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4953574_4954267_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4954383_4954704_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4954703_4955696_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4956002_4957526_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|4957630_4958866_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4959026_4959683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260854.1|4959833_4961645_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4961792_4962143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840389.1|4962321_4963641_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027703798.1|4965053_4966235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240680.1|4966332_4969764_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260861.1|4969911_4970610_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011260862.1|4970593_4972066_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_041182343.1|4972062_4972650_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011260863.1|4972649_4973846_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011260864.1|4973919_4974549_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	1.2e-46
WP_103057218.1|4975229_4975757_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4975753_4976320_+	FUSC family protein	NA	NA	NA	NA	NA
WP_041182344.1|4976595_4977957_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_075244601.1|4978070_4978391_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_011409842.1|4980206_4980413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260869.1|4980393_4981512_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_049756351.1|4983863_4984616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|4984612_4985320_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_041182345.1|4985333_4985675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|4985655_4986165_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_011409850.1|4986161_4986563_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_115862309.1|4987496_4987784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074038671.1|4987908_4988166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131824912.1|4988214_4988646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260878.1|4989023_4989230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260879.1|4990241_4991411_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	4.5e-42
WP_041182532.1|4991436_4992747_-	MFS transporter	NA	NA	NA	NA	NA
WP_010364861.1|4994659_4994980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704146.1|4995098_4996265_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|4996528_4997485_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|4997859_4998645_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
