The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	1193151	1269885	4795996	protease,terminase,head,holin,integrase,tail,capsid,transposase,tRNA,portal,lysis	Salmonella_phage(37.93%)	93	1185232:1185248	1275732:1275748
1185232:1185248	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997365.1|1193151_1194189_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1194304_1194994_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1195312_1195696_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1195757_1196345_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001670786.1|1196447_1197347_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1197364_1198699_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083342.1|1198828_1199566_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989165.1|1199550_1201173_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1201257_1201437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1201436_1201601_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1201597_1202173_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1202204_1202855_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1202854_1203811_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589050.1|1203807_1204287_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007934.1|1204784_1206014_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|1205991_1206276_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1206316_1206556_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1206598_1207756_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017128.1|1207718_1210646_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|1210772_1211123_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1211144_1211303_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1211759_1212422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1212421_1212808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1212800_1213640_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1213698_1214094_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1214193_1214436_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1214395_1214770_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1214861_1215746_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1215742_1216438_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1216451_1217150_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1217257_1217890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1218132_1218366_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1218482_1218731_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1218765_1219368_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001241017.1|1219367_1219574_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_001096562.1|1219576_1220188_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000801757.1|1220184_1220325_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1220321_1220999_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1220995_1221181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1221271_1221835_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1222341_1222530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1222744_1223431_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1223706_1224036_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1224019_1224472_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1224489_1224942_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1225177_1225579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1225865_1226411_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1226382_1228314_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1228297_1228501_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1228497_1230078_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1230067_1231564_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1231576_1231924_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1231978_1233007_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1233064_1233424_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1233434_1233818_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1233845_1234424_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1234472_1235603_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1235711_1236113_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1236120_1236867_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1236917_1237313_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1237309_1237648_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1237619_1240715_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1240717_1241047_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1241056_1241755_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1241761_1242499_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1242396_1243044_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1243105_1246468_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1246506_1246749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1246802_1249175_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1249171_1249996_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1249985_1250564_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1250660_1250888_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1250994_1251207_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1251269_1251335_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1251914_1252079_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1252791_1252929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1253407_1254901_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1255305_1257105_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1257121_1258096_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1258369_1259050_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1259046_1259952_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1259963_1260692_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1260703_1261435_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986042.1|1261434_1261815_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1261926_1262187_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022472.1|1262224_1263151_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001276364.1|1263266_1264463_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684023.1|1264484_1265402_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995694.1|1265440_1266289_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1266404_1267298_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1267308_1268670_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1268673_1269309_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134572.1|1269333_1269885_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1275732:1275748	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	1713793	1722964	4795996	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1713793_1714741_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1714724_1715456_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1715436_1715544_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1715603_1716335_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1716557_1718243_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1718239_1718959_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1719005_1719473_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1719529_1720060_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1720231_1720690_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1720930_1722964_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	1791055	1801562	4795996		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|1791055_1792459_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|1792636_1793530_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1793906_1794992_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1794991_1795891_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1795938_1796817_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1796817_1797369_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1797374_1798349_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1798364_1799138_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1799142_1800222_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1800248_1801562_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 4
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	1894694	1905344	4795996		Morganella_phage(25.0%)	12	NA	NA
WP_001219019.1|1894694_1895219_-	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
WP_001670523.1|1895865_1896156_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
WP_000598921.1|1896527_1897325_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001529333.1|1897805_1897967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1898093_1898513_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|1898515_1899784_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|1900238_1900451_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1900461_1900650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|1900907_1902104_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|1902753_1903065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|1903144_1903840_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|1903913_1905344_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	2803727	2931963	4795996	protease,terminase,head,holin,integrase,tail,tRNA,portal,lysis	Salmonella_phage(51.89%)	159	2871320:2871339	2943115:2943134
WP_010989012.1|2803727_2804048_-	membrane protein	NA	E5G6P3	Salmonella_phage	76.6	1.2e-08
WP_001123040.1|2804265_2805141_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_000938182.1|2805362_2806043_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
WP_001670820.1|2806431_2806698_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	78.4	7.3e-33
WP_000503667.1|2806754_2807402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|2807444_2807642_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|2807824_2808070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|2808267_2808660_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|2808769_2809378_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|2809440_2809626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|2809874_2810393_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|2810407_2811940_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|2811939_2812620_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|2812616_2813816_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|2813816_2814170_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|2814169_2814922_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|2815040_2815496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|2815579_2815912_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|2815908_2816976_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|2816978_2817281_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|2817280_2817856_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|2817855_2819865_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_024131618.1|2819854_2820031_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
WP_000389049.1|2820042_2820495_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|2820498_2820942_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|2820954_2822100_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|2822103_2822667_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|2822641_2823031_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|2823017_2823572_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|2823568_2823976_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|2823941_2824331_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|2824372_2825314_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|2825325_2825823_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|2825827_2827060_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|2827063_2827810_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|2827694_2829164_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|2829163_2830786_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|2830788_2831418_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|2831918_2832374_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_000951228.1|2832691_2833231_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|2833208_2833511_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|2833713_2833902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|2834294_2834873_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|2834869_2835163_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|2835159_2835756_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|2835824_2836016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|2836199_2836538_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|2836537_2836708_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|2836704_2837307_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|2837299_2837548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|2837551_2838232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|2838269_2839658_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|2839654_2840635_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|2840637_2840862_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|2840884_2841331_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_001526889.1|2841265_2841481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670726.1|2841395_2841629_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	48.6	6.2e-12
WP_000467661.1|2841727_2842192_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
WP_000387662.1|2842876_2843200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|2843207_2843453_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000158391.1|2843482_2845747_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_000205292.1|2845743_2846298_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|2846300_2846483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024131616.1|2846532_2846730_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
WP_000196402.1|2846695_2846920_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|2846920_2847940_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|2848527_2849187_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2849273_2849603_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2849599_2849881_-	acylphosphatase	NA	NA	NA	NA	NA
WP_080154610.1|2849929_2850709_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859429.1|2850734_2851283_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140482.1|2851497_2852709_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2852766_2853084_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2853128_2853545_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2853715_2854378_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2854472_2854931_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420513.1|2854966_2857021_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_001261222.1|2857144_2857591_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2857609_2859763_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2859749_2860355_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2860571_2861081_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2861437_2862490_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2862561_2863014_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2863199_2864960_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2865028_2865547_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2865646_2865814_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2866069_2866633_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2866629_2868270_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2868274_2869528_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2869542_2871450_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2871320:2871339	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2871462_2873571_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2873669_2874779_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001670452.1|2874775_2875318_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2875483_2876494_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|2876701_2879314_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|2879740_2879932_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2880202_2880889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2880873_2881173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2881241_2881868_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2882515_2883484_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2883959_2884541_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2884540_2886979_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2887032_2887275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2887313_2890664_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2890735_2891440_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2891337_2892075_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2892084_2892780_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2892869_2893403_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2893519_2894017_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2894115_2894448_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2894444_2897432_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2897511_2897841_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2897837_2898236_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2898281_2899031_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2899042_2899444_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2899440_2900007_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2899987_2900287_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2900279_2900603_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2900693_2902775_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2902698_2904216_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2904242_2904449_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2904445_2906584_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2906540_2907074_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2907281_2907761_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2907778_2908231_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2908214_2908544_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2908819_2909506_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2909866_2910316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2910451_2910577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2910750_2911068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2911134_2911932_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2911921_2912068_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2912064_2912676_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|2912678_2912885_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2912884_2913487_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2913569_2913791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2913902_2914136_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2914427_2914718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2914795_2915107_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2915103_2915451_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2915461_2916211_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2916213_2917197_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2917281_2917656_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2917621_2917861_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2917980_2918391_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2918440_2918701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2918693_2918852_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2918873_2919173_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2919299_2922185_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2922147_2923305_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2923347_2923587_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2923627_2923876_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2923920_2925213_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191406.1|2925407_2926610_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893197.1|2926690_2928124_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544853.1|2928369_2929584_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2929670_2929904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762343.1|2929900_2930362_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2930562_2931963_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2943115:2943134	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	2996393	3003707	4795996	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001670446.1|2996393_2996771_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
WP_001117984.1|2996932_2997130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2997343_2999620_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2999650_2999971_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3000294_3000516_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3000645_3002592_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201748.1|3002588_3003707_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
>prophage 7
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	4355422	4400198	4795996	plate,tail,tRNA	Burkholderia_phage(40.91%)	48	NA	NA
WP_001182228.1|4355422_4356421_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4356508_4357819_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4358065_4358581_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4358680_4358890_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4358911_4359025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|4359021_4360347_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4360525_4361134_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4361242_4361611_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4361781_4364202_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4364300_4365173_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4365186_4365684_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4365864_4366782_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4366945_4368304_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4368392_4369502_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4369863_4371054_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|4371185_4372730_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4372744_4373635_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4373800_4374211_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750806.1|4374353_4376450_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4376449_4377187_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4377183_4377852_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4377885_4378128_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790036.1|4378571_4380221_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4380565_4381915_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4382045_4382393_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4382970_4383258_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4383260_4383866_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4383878_4384193_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4384352_4384808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4384804_4385002_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|4384991_4386419_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907495.1|4386418_4386943_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4386994_4387312_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185656.1|4387271_4387400_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262484.1|4387496_4389851_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_000271429.1|4389850_4390804_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4390803_4391013_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818152.1|4391000_4392044_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_000679396.1|4392053_4392776_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_012512893.1|4392784_4393024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593184.1|4393099_4393462_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4393458_4394388_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632052.1|4394387_4395935_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_001093501.1|4396098_4396458_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951728.1|4396448_4397564_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_000359503.1|4397556_4398189_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368212.1|4398191_4399673_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_001177098.1|4399682_4400198_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
>prophage 8
NZ_CP041208	Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 chromosome, complete genome	4795996	4518967	4584748	4795996	protease,terminase,head,holin,plate,integrase,tail,capsid,portal,lysis	Salmonella_phage(42.22%)	79	4548823:4548869	4579802:4579848
WP_000208240.1|4518967_4519498_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4519507_4520839_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|4520905_4521835_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4521927_4522413_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4522634_4522874_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4523272_4524118_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4524138_4525647_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4525758_4526769_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|4526865_4527612_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|4527717_4528146_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4528246_4528843_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4528955_4529723_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|4529814_4530579_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4530588_4530879_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4530961_4531837_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4531865_4532888_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4532916_4533918_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4533914_4534958_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4534951_4536487_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4536742_4537702_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4537788_4539381_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4539394_4539745_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621104.1|4539834_4539966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519915.1|4540243_4540966_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|4541028_4542069_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|4542078_4543038_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|4543048_4544383_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|4544645_4545401_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4545501_4546491_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4546694_4547657_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4547841_4548744_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4548823:4548869	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|4549030_4549447_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|4549481_4549700_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|4549777_4550947_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|4550943_4551429_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|4551440_4553882_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|4553874_4554030_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|4554026_4554362_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|4554424_4554943_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|4554958_4556146_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|4556280_4556850_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|4556849_4558592_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|4558602_4559133_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|4559125_4560034_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|4560040_4560388_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|4560384_4561026_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|4561102_4562479_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|4562483_4562951_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|4562943_4563411_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_072209008.1|4563373_4563619_-|holin	holin	holin	S4TNY4	Salmonella_phage	73.1	5.5e-27
WP_000849743.1|4563518_4563932_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|4563928_4564438_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|4564421_4564643_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|4564633_4564837_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|4564836_4565337_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|4565434_4566193_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|4566196_4567357_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|4567388_4568252_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|4568416_4570186_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|4570185_4571223_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|4571743_4571935_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|4571933_4572365_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|4572498_4573539_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|4573535_4573733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|4573911_4576188_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|4576177_4576453_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|4576449_4576674_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|4576975_4577200_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|4577263_4577764_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|4577933_4578206_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|4578342_4578636_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|4578705_4579686_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|4579870_4580371_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4579802:4579848	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4580521_4581220_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4581216_4582590_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|4582637_4582841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|4582961_4583357_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077906285.1|4583368_4584121_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4584127_4584748_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
