The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041213	Listeria monocytogenes strain LMP18-H8393 chromosome, complete genome	3034018	128677	135204	3034018	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|128677_129130_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|129135_129471_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003724946.1|129687_130116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|130127_130544_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|130823_131213_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|131225_131738_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|131785_132088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|132129_132534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731178.1|132520_134389_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003731179.1|134385_135204_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	5.5e-39
>prophage 2
NZ_CP041213	Listeria monocytogenes strain LMP18-H8393 chromosome, complete genome	3034018	1120362	1127784	3034018		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1120362_1120746_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1120767_1121751_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_003727001.1|1121765_1122779_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1122987_1124478_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1124489_1125314_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003724634.1|1125326_1125635_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003724635.1|1125694_1126099_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012681222.1|1126227_1127784_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 3
NZ_CP041213	Listeria monocytogenes strain LMP18-H8393 chromosome, complete genome	3034018	1247903	1334536	3034018	terminase,capsid,protease,integrase,tRNA,tail,portal,holin	Listeria_phage(78.69%)	102	1247863:1247886	1292478:1292501
1247863:1247886	attL	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_023553862.1|1247903_1249058_-|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	95.3	3.0e-208
WP_014930257.1|1249187_1250051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601388.1|1250102_1250555_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	86.0	1.0e-74
WP_014601389.1|1250571_1250895_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	73.8	6.3e-39
WP_003730994.1|1251295_1251499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|1251565_1251757_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730996.1|1251778_1252021_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_023553860.1|1252023_1252209_+	hypothetical protein	NA	A8ATD3	Listeria_phage	93.4	5.4e-27
WP_031644438.1|1252783_1253314_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	98.3	8.9e-99
WP_023553856.1|1253322_1253778_+	class I SAM-dependent methyltransferase	NA	A8ATY8	Listeria_phage	92.1	1.5e-81
WP_014601511.1|1253782_1254343_+	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	100.0	9.4e-107
WP_014601510.1|1254563_1254965_+	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014601509.1|1254961_1255171_+	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_003731704.1|1255171_1255501_+	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
WP_003731705.1|1255497_1255770_+	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
WP_003731672.1|1256224_1256458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731671.1|1256454_1256685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731670.1|1256674_1256941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553845.1|1257444_1257822_+	hypothetical protein	NA	A8ATE8	Listeria_phage	66.9	2.7e-41
WP_003731665.1|1257825_1258305_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_023553843.1|1258324_1259014_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	98.3	4.8e-129
WP_031659492.1|1259077_1260334_+	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	94.5	6.0e-218
WP_023553839.1|1260358_1260844_+	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	98.8	1.1e-87
WP_023553837.1|1260866_1263140_+	primase	NA	R4IBW2	Listeria_phage	95.5	0.0e+00
WP_012951539.1|1263478_1263796_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_003731659.1|1263797_1264010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553835.1|1264456_1264996_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	76.0	8.6e-73
WP_003731657.1|1264992_1265262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731655.1|1265506_1265734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731654.1|1265746_1266172_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	99.3	1.8e-73
WP_072234633.1|1266534_1266717_+	hypothetical protein	NA	A8ATF7	Listeria_phage	98.3	5.7e-29
WP_003731652.1|1266761_1267076_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	3.2e-56
WP_031668694.1|1267124_1267481_+	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	96.0	1.0e-45
WP_023553831.1|1267477_1269121_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.2	0.0e+00
WP_009928006.1|1269130_1269520_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	4.8e-17
WP_009928005.1|1269570_1270701_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	95.5	4.6e-209
WP_009928004.1|1270697_1271414_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.4	5.5e-67
WP_023553829.1|1271440_1272592_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.2	1.8e-213
WP_023553826.1|1272778_1273078_+	hypothetical protein	NA	A0A059T7R0	Listeria_phage	99.0	1.2e-47
WP_009929554.1|1273061_1273427_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	98.3	7.1e-63
WP_009929555.1|1273423_1273825_+	hypothetical protein	NA	A8ATA2	Listeria_phage	94.7	4.9e-65
WP_009929557.1|1273821_1274205_+	hypothetical protein	NA	A0A059T681	Listeria_phage	97.6	9.4e-66
WP_014929552.1|1274225_1274813_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	98.5	2.9e-106
WP_014929553.1|1274883_1275216_+	hypothetical protein	NA	A0A059T7R2	Listeria_phage	96.4	2.5e-51
WP_023553824.1|1275431_1280351_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	94.6	0.0e+00
WP_023553822.1|1280343_1281993_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_023553820.1|1282008_1284303_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	98.8	0.0e+00
WP_023553818.1|1284292_1285384_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	91.2	7.3e-188
WP_003733957.1|1285434_1285740_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_003723294.1|1285739_1286021_+|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
WP_023553816.1|1286020_1286728_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	98.7	1.2e-130
WP_012951560.1|1286830_1287829_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_012581438.1|1288048_1288498_-	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	97.3	3.8e-74
WP_023553814.1|1288502_1288853_-	AcrIIA2 family anti-CRISPR protein	NA	Q9T195	Listeria_phage	96.6	1.8e-55
WP_023553812.1|1288884_1289262_-	anti-CRISPR protein AcrIIA3	NA	A0A059T686	Listeria_phage	90.4	1.2e-60
WP_023553810.1|1289591_1289801_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	100.0	1.9e-28
WP_023553808.1|1290242_1290476_+	hypothetical protein	NA	A8ATC5	Listeria_phage	97.4	2.8e-36
WP_009915668.1|1290472_1290664_+	hypothetical protein	NA	A8ATC6	Listeria_phage	87.3	8.9e-25
WP_003726035.1|1290858_1290960_-	hypothetical protein	NA	A0A059T688	Listeria_phage	66.7	2.4e-05
WP_003726037.1|1291356_1291830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726038.1|1291935_1292298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553806.1|1292965_1297096_+	LapB repeat-containing protein	NA	NA	NA	NA	NA
1292478:1292501	attR	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_003727539.1|1297218_1298577_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003726043.1|1298619_1299213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726044.1|1299349_1299757_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003731295.1|1299921_1300521_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.0e-29
WP_003723543.1|1300552_1300813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726047.1|1300936_1302349_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1302373_1302637_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003727535.1|1302804_1303281_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1303318_1303564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731296.1|1303560_1304766_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726058.1|1304786_1304972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726052.1|1304970_1305630_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1305669_1305864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1305930_1306779_-	YitT family protein	NA	NA	NA	NA	NA
WP_003726055.1|1307396_1308110_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_003726056.1|1308140_1309787_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1309805_1311290_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003731297.1|1311407_1311869_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1311907_1312372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731298.1|1312560_1313475_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003731299.1|1313499_1314747_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.0	2.7e-106
WP_003726720.1|1314730_1315561_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003727526.1|1315707_1316847_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1316926_1317322_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1317472_1317688_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1317811_1318345_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003727521.1|1319287_1320226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1320340_1321624_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1321808_1323068_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1323186_1323753_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003731301.1|1323787_1324357_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1324458_1325001_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1325010_1325874_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1325870_1326656_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1326789_1327650_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1327922_1330001_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003731302.1|1330063_1331368_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003731303.1|1331650_1332553_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003724001.1|1332573_1333113_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003727514.1|1333126_1334536_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
>prophage 4
NZ_CP041213	Listeria monocytogenes strain LMP18-H8393 chromosome, complete genome	3034018	1865134	1873420	3034018		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_003731569.1|1865134_1865701_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.5	2.8e-26
WP_003726210.1|1865697_1866747_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1866765_1868193_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003731570.1|1868177_1870397_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|1870389_1871073_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1871076_1871322_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003731571.1|1871333_1872047_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	3.9e-41
WP_003729814.1|1872127_1873420_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP041213	Listeria monocytogenes strain LMP18-H8393 chromosome, complete genome	3034018	2403007	2442864	3034018	tail,terminase,holin	Listeria_phage(89.13%)	54	NA	NA
WP_003733517.1|2403007_2403439_+	hypothetical protein	NA	A8ATJ2	Listeria_phage	81.7	4.1e-25
WP_003733518.1|2403435_2403936_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	71.8	1.4e-64
WP_012951560.1|2404141_2405140_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_003733520.1|2405242_2406088_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	92.6	1.9e-135
WP_003733521.1|2406087_2406354_-|holin	phage holin	holin	A0A059T684	Listeria_phage	93.1	9.8e-38
WP_003733522.1|2406353_2406656_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	92.1	7.7e-39
WP_014601493.1|2406706_2408872_-	hypothetical protein	NA	A8ATW1	Listeria_phage	94.5	0.0e+00
WP_003733727.1|2408884_2410453_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.2	3.1e-304
WP_023553906.1|2410449_2415249_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	90.2	0.0e+00
WP_077286899.1|2415253_2415565_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	97.8	3.4e-42
WP_003733698.1|2415561_2415993_-	hypothetical protein	NA	A8ATV7	Listeria_phage	97.9	4.0e-73
WP_003733697.1|2416048_2416738_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	85.6	2.8e-100
WP_003725064.1|2416742_2417114_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_003733696.1|2417110_2417428_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	96.2	4.6e-50
WP_003733695.1|2417417_2417783_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_003723785.1|2417782_2418136_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003723787.1|2418305_2419178_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	93.8	2.3e-152
WP_003733694.1|2419200_2419755_-	hypothetical protein	NA	A8ATU9	Listeria_phage	88.6	3.8e-84
WP_003733692.1|2420898_2422458_-	hypothetical protein	NA	A8ATU7	Listeria_phage	96.9	9.2e-293
WP_023553758.1|2422472_2423792_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	94.1	4.6e-253
WP_003733717.1|2423784_2424510_-	helix-turn-helix domain-containing protein	NA	A0A0B5CTX0	Listeria_phage	68.5	4.4e-80
WP_003733718.1|2424553_2424781_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	2.4e-32
WP_003733719.1|2425056_2425491_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	76.4	1.8e-57
WP_003733720.1|2425555_2426053_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	49.3	1.8e-32
WP_003733721.1|2426042_2426225_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	1.1e-16
WP_003733722.1|2426243_2426726_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	73.1	8.5e-56
WP_003733723.1|2426726_2426981_-	hypothetical protein	NA	A0A059T5G2	Listeria_phage	92.8	3.4e-40
WP_003731837.1|2427126_2427735_-	hypothetical protein	NA	A8ATU1	Listeria_phage	49.5	1.4e-55
WP_009932913.1|2427718_2427820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117125109.1|2428124_2428367_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003731843.1|2428504_2428720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023553762.1|2428911_2429442_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	85.2	2.5e-85
WP_003733626.1|2429438_2430359_-	hypothetical protein	NA	U5Q085	Bacillus_phage	59.7	2.3e-33
WP_003733627.1|2430369_2431281_-	recombinase RecT	NA	NA	NA	NA	NA
WP_023553765.1|2431273_2432785_-	ATPase	NA	A0A2I7SC81	Paenibacillus_phage	36.2	1.7e-73
WP_003733629.1|2433017_2433206_-	hypothetical protein	NA	Q9T175	Listeria_phage	80.6	1.2e-21
WP_003733630.1|2433313_2433529_-	hypothetical protein	NA	Q9T176	Listeria_phage	67.6	9.7e-20
WP_003733631.1|2433525_2434059_-	hypothetical protein	NA	Q9T177	Listeria_phage	87.6	5.5e-80
WP_003733633.1|2434181_2434961_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	98.1	2.1e-141
WP_003727749.1|2435024_2435267_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	100.0	1.8e-38
WP_003727747.1|2435452_2435734_-	hypothetical protein	NA	A0A0B5CTX3	Listeria_phage	100.0	1.0e-40
WP_003733634.1|2435730_2435967_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_003733635.1|2435978_2436173_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	93.8	6.9e-25
WP_003733636.1|2436176_2436428_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	97.6	1.9e-38
WP_003733637.1|2436576_2437059_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	78.0	1.9e-31
WP_003733638.1|2437214_2437382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009930458.1|2437437_2437656_+	hypothetical protein	NA	A0A059T6E3	Listeria_phage	81.9	1.9e-26
WP_003733640.1|2437671_2438394_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	97.9	2.8e-103
WP_003733641.1|2438416_2439022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003749252.1|2439034_2439457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003733643.1|2439672_2440560_+	hypothetical protein	NA	A0A0B5CYL8	Listeria_phage	100.0	5.6e-162
WP_003733644.1|2440636_2441995_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.5	2.5e-254
WP_003733645.1|2441985_2442462_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2442516_2442864_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 6
NZ_CP041213	Listeria monocytogenes strain LMP18-H8393 chromosome, complete genome	3034018	2586205	2594047	3034018		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2586205_2587177_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2587184_2588153_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2588154_2589030_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003731211.1|2589137_2590868_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.0	2.8e-173
WP_003741152.1|2590909_2591971_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003731209.1|2591987_2592971_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	1.5e-51
WP_003722610.1|2593087_2594047_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP041213	Listeria monocytogenes strain LMP18-H8393 chromosome, complete genome	3034018	2708211	2746848	3034018	tail,terminase,integrase,holin	Listeria_phage(91.49%)	55	2707738:2707787	2746936:2746985
2707738:2707787	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_003731277.1|2708211_2708445_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_003731276.1|2708476_2708728_+	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003722518.1|2708728_2709178_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_003733661.1|2709202_2709700_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	100.0	3.8e-91
WP_003722520.1|2709974_2710748_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_003733663.1|2710788_2711634_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	94.7	2.7e-137
WP_003722522.1|2711633_2711915_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2711927_2712293_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_023553771.1|2712331_2714497_-	hypothetical protein	NA	A8ATW1	Listeria_phage	94.3	0.0e+00
WP_003733727.1|2714509_2716078_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.2	3.1e-304
WP_023553773.1|2716074_2720865_-|tail	phage tail tape measure protein	tail	A0A0B5CTS6	Listeria_phage	88.4	0.0e+00
WP_077286899.1|2720869_2721181_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	97.8	3.4e-42
WP_003733698.1|2721177_2721609_-	hypothetical protein	NA	A8ATV7	Listeria_phage	97.9	4.0e-73
WP_003733697.1|2721664_2722354_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	85.6	2.8e-100
WP_003725064.1|2722358_2722730_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_003733696.1|2722726_2723044_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	96.2	4.6e-50
WP_003733695.1|2723033_2723399_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_003723785.1|2723398_2723752_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003723787.1|2723921_2724794_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	93.8	2.3e-152
WP_003733694.1|2724816_2725371_-	hypothetical protein	NA	A8ATU9	Listeria_phage	88.6	3.8e-84
WP_003733693.1|2725465_2726509_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	97.4	1.0e-194
WP_003733692.1|2726513_2728073_-	hypothetical protein	NA	A8ATU7	Listeria_phage	96.9	9.2e-293
WP_010991159.1|2728087_2729407_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	94.3	7.1e-254
WP_003733714.1|2729399_2730140_-	hypothetical protein	NA	A8ATU5	Listeria_phage	98.8	7.0e-134
WP_003725074.1|2730179_2730407_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	1.8e-32
WP_097529926.1|2730691_2731111_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	42.5	8.8e-17
WP_003733712.1|2731399_2731816_-	hypothetical protein	NA	A0A2H4JEJ9	uncultured_Caudovirales_phage	38.9	1.2e-10
WP_003733711.1|2731930_2732329_-	hypothetical protein	NA	A8AU00	Listeria_phage	78.8	1.0e-54
WP_110109835.1|2732294_2732435_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	50.0	5.7e-05
WP_003733709.1|2732460_2732943_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	76.2	1.7e-59
WP_003733708.1|2732943_2733156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003733707.1|2733160_2733655_-	hypothetical protein	NA	A0A1S5SDR7	Streptococcus_phage	47.6	6.1e-33
WP_023553777.1|2733677_2733890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031674202.1|2733995_2734310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003733704.1|2734579_2734846_-	hypothetical protein	NA	R4IBL5	Listeria_phage	88.4	1.3e-34
WP_023553779.1|2734842_2735469_-	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	45.4	3.1e-34
WP_003731843.1|2735465_2735681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023553782.1|2735872_2736403_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	86.4	3.5e-87
WP_003733679.1|2736399_2737314_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	84.9	8.4e-129
WP_003723965.1|2737351_2738263_-	recombinase RecT	NA	NA	NA	NA	NA
WP_003723967.1|2738255_2739767_-	hypothetical protein	NA	A0A2I7SC81	Paenibacillus_phage	36.2	6.1e-76
WP_003722564.1|2739999_2740188_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003733681.1|2740290_2740497_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003733682.1|2740486_2741017_-	hypothetical protein	NA	A0A0B5D173	Listeria_phage	89.6	2.7e-79
WP_003733683.1|2741140_2741917_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	97.7	6.9e-140
WP_003733685.1|2741898_2742174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003722567.1|2742179_2742461_-	hypothetical protein	NA	A8ATX8	Listeria_phage	95.7	1.8e-37
WP_003733686.1|2742486_2742771_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	4.5e-41
WP_003733687.1|2742782_2742977_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003733688.1|2742997_2743207_-	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	95.6	3.5e-30
WP_003724014.1|2743372_2743795_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	98.6	7.7e-69
WP_003724015.1|2743810_2744236_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	100.0	2.2e-76
WP_003724016.1|2744250_2744958_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	100.0	2.8e-124
WP_003724017.1|2745016_2745622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724018.1|2745684_2746848_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.2	4.4e-50
2746936:2746985	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
>prophage 1
NZ_CP041214	Listeria monocytogenes strain LMP18-H8393 plasmid pCFSAN074382, complete sequence	57553	314	54877	57553	protease,transposase	Streptococcus_phage(19.23%)	57	NA	NA
WP_003728521.1|314_698_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	53.4	2.2e-14
WP_003731676.1|710_1373_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_003728462.1|1372_1699_-	hypothetical protein	NA	A0A2K9V3N4	Faecalibacterium_phage	40.8	3.2e-06
WP_003728463.1|1829_2081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728464.1|2141_2384_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003728465.1|2377_2719_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003728466.1|2911_5047_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_003728467.1|5046_5406_-	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728468.1|5685_6240_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728469.1|6243_9159_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
WP_031644889.1|10341_12498_-	copper-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	31.0	1.1e-70
WP_003728472.1|12713_13277_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	2.0e-40
WP_003728473.1|13527_14739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728474.1|14731_16585_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_043993356.1|17069_17711_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.0e-101
WP_003728476.1|17830_19714_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	5.6e-87
WP_077295908.1|20176_20968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003750113.1|21131_21452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728479.1|21451_21691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728480.1|21811_22681_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003728481.1|22926_24291_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.9e-07
WP_002389568.1|24914_25595_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
WP_076994969.1|26160_26568_-	hypothetical protein	NA	H2DE57	Erwinia_phage	46.0	1.4e-11
WP_012952173.1|26609_26954_-	TnpV protein	NA	NA	NA	NA	NA
WP_003728485.1|27666_28065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728486.1|28238_28574_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
WP_003728487.1|28610_29141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728488.1|29254_30019_-	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
WP_003728489.1|30038_30410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728490.1|30420_31761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728491.1|31753_32194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728492.1|32205_32445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728493.1|32842_33760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731844.1|33762_34152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728495.1|34114_34351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013315183.1|34366_34483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728496.1|34694_35921_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	4.7e-135
WP_003755398.1|35889_36687_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	63.2	3.3e-81
WP_003728498.1|36763_37366_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	2.0e-33
WP_003728499.1|37399_38155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728500.1|38429_40064_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_003728501.1|40803_41778_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.0	2.4e-33
WP_003728502.1|41755_42052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728503.1|42102_43383_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.9	5.2e-92
WP_003728504.1|43370_43715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728505.1|43919_44654_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013315188.1|44828_46169_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	38.6	1.1e-31
WP_003728507.1|46444_48559_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.1	3.4e-117
WP_003728509.1|48986_49223_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
WP_003731679.1|49185_49464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728510.1|49583_49811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728511.1|49800_50409_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
WP_003728512.1|50696_51437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728513.1|51448_53215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085616471.1|53504_53723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728514.1|53738_53993_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	46.4	1.6e-13
WP_115914824.1|53989_54877_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	51.1	7.3e-69
