The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	0	31731	2744393	integrase	Escherichia_phage(12.5%)	29	18670:18699	29783:29812
WP_128104677.1|2898_4320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128104678.1|4639_7666_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_128106160.1|8078_10112_+	NAD(+) synthase	NA	NA	NA	NA	NA
WP_050818896.1|10187_10784_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_128104679.1|10930_11587_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_128104680.1|11586_12912_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_128104681.1|12911_13688_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_050818903.1|13696_14131_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_087651651.1|14137_14512_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_128104682.1|14545_15142_+	nitroreductase	NA	NA	NA	NA	NA
WP_128104683.1|15138_16323_+	5-demethoxyubiquinol-8 5-hydroxylase UbiM	NA	NA	NA	NA	NA
WP_050818912.1|16343_16760_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_050818913.1|16810_17362_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_128104684.1|17470_18157_-	glutathione S-transferase	NA	NA	NA	NA	NA
18670:18699	attL	TTTCAAATGACTCCGGATTGACTCCGGAAA	NA	NA	NA	NA
WP_128104685.1|18896_20231_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	27.0	2.9e-21
WP_128104686.1|20234_21272_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.5	2.4e-63
WP_128104687.1|21393_21633_-	helix-turn-helix transcriptional regulator	NA	B0VK64	Azospirillum_phage	47.4	3.3e-08
WP_128104688.1|21760_22006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128104689.1|22002_22446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128104690.1|22442_22883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775841.1|22940_23615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128104691.1|23654_23912_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_128104692.1|23908_24658_+	phage antirepressor KilAC domain-containing protein	NA	A0A0N9SJU0	Paenibacillus_phage	39.3	1.7e-34
WP_128104693.1|24654_25233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106161.1|25252_26281_+	hypothetical protein	NA	A0A0U4B0G9	Pseudomonas_phage	38.2	2.2e-16
WP_128106162.1|26285_28181_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_128104694.1|28429_28999_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	42.5	6.4e-26
WP_128104695.1|30013_30937_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	36.2	1.5e-13
29783:29812	attR	TTTCAAATGACTCCGGATTGACTCCGGAAA	NA	NA	NA	NA
WP_128104696.1|30933_31731_-	ParA family protein	NA	Q8JL10	Natrialba_phage	29.4	1.1e-20
>prophage 2
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	35687	36152	2744393		Streptococcus_phage(100.0%)	1	NA	NA
WP_128104700.1|35687_36152_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.4	2.0e-22
>prophage 3
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	40862	41564	2744393		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_128104705.1|40862_41564_-	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.5	1.8e-06
>prophage 4
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	45235	51912	2744393		Salmonella_phage(33.33%)	6	NA	NA
WP_128104709.1|45235_46477_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	24.9	1.8e-25
WP_128104710.1|46501_46888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003623252.1|46918_47104_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_050818944.1|47130_47835_-	peptidase	NA	NA	NA	NA	NA
WP_128104711.1|47849_48809_-	tetratricopeptide repeat protein	NA	A0A1J0GW78	Streptomyces_phage	37.6	3.5e-08
WP_128104712.1|49047_51912_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.8	0.0e+00
>prophage 5
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	59469	60924	2744393		Gordonia_phage(100.0%)	1	NA	NA
WP_128104719.1|59469_60924_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	34.5	5.2e-32
>prophage 6
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	64227	65256	2744393		Tupanvirus(100.0%)	1	NA	NA
WP_050818959.1|64227_65256_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	29.4	2.2e-32
>prophage 7
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	84204	85239	2744393		Bacillus_phage(100.0%)	1	NA	NA
WP_050818973.1|84204_85239_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.3	8.6e-122
>prophage 8
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	93144	95142	2744393		Streptococcus_virus(100.0%)	1	NA	NA
WP_128104735.1|93144_95142_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.4	1.4e-43
>prophage 9
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	103561	104161	2744393		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_128104738.1|103561_104161_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	29.7	5.9e-06
>prophage 10
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	109007	110138	2744393		Pseudomonas_phage(100.0%)	1	NA	NA
WP_124296306.1|109007_110138_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	36.2	7.2e-05
>prophage 11
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	120563	128757	2744393		Micromonas_sp._RCC1109_virus(33.33%)	6	NA	NA
WP_128104746.1|120563_122153_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	37.5	9.8e-08
WP_128104747.1|122448_123528_-	heme A synthase	NA	NA	NA	NA	NA
WP_128104748.1|123512_124292_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_128104749.1|124452_125715_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	1.8e-25
WP_128104750.1|125818_128062_+	response regulator	NA	NA	NA	NA	NA
WP_050818994.1|128223_128757_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.1	2.0e-21
>prophage 12
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	143973	160496	2744393		Salicola_phage(33.33%)	13	NA	NA
WP_128104755.1|143973_146556_-	DEAD/DEAH box helicase	NA	A0A248SJQ0	Salicola_phage	34.0	4.8e-28
WP_128104756.1|146517_148104_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	33.2	4.4e-32
WP_035353907.1|148259_148676_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003629818.1|148818_149265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106167.1|149273_150371_-	UDP-phosphate alpha-N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_128104757.1|150364_152395_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	25.7	3.5e-18
WP_128104758.1|152391_153528_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	23.6	3.2e-21
WP_003629813.1|153544_154009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128104759.1|154103_155468_-	dihydroorotase	NA	NA	NA	NA	NA
WP_128104760.1|155474_156872_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	4.2e-47
WP_050819007.1|156932_157829_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_080986735.1|157939_158149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128104761.1|158147_160496_+	RNA helicase	NA	A0A248SJQ0	Salicola_phage	33.2	4.5e-49
>prophage 13
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	166134	166665	2744393		Rhizobium_phage(100.0%)	1	NA	NA
WP_003629802.1|166134_166665_-	transcription termination/antitermination protein NusG	NA	A0A068C9G5	Rhizobium_phage	29.2	2.2e-12
>prophage 14
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	172734	173205	2744393		Pneumococcus_phage(100.0%)	1	NA	NA
WP_035362188.1|172734_173205_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	54.3	1.8e-26
>prophage 15
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	178956	179994	2744393		Planktothrix_phage(100.0%)	1	NA	NA
WP_128104770.1|178956_179994_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	7.0e-31
>prophage 16
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	196579	196786	2744393		Morganella_phage(100.0%)	1	NA	NA
WP_003623691.1|196579_196786_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	48.3	1.8e-10
>prophage 17
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	230898	233416	2744393		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003625653.1|230898_231426_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	51.7	2.1e-44
WP_128104798.1|231736_233416_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	25.2	3.3e-38
>prophage 18
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	238074	239235	2744393	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_128104801.1|238074_239235_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	50.6	8.5e-94
>prophage 19
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	244168	248467	2744393		Enterococcus_phage(33.33%)	4	NA	NA
WP_050819071.1|244168_245083_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.0	8.4e-28
WP_128104806.1|245201_246350_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_035352790.1|246369_246831_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	47.4	1.3e-29
WP_128104807.1|246910_248467_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	42.0	8.4e-20
>prophage 20
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	256356	256818	2744393		Streptomyces_phage(100.0%)	1	NA	NA
WP_128106173.1|256356_256818_-	NUDIX hydrolase	NA	A0A222YV78	Streptomyces_phage	31.2	3.1e-07
>prophage 21
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	273790	277871	2744393		Pandoravirus(50.0%)	5	NA	NA
WP_128104823.1|273790_274549_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	35.4	2.1e-24
WP_050819094.1|274713_275331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128104824.1|275506_276580_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_128104825.1|276576_277455_+	TIGR01459 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_128104826.1|277451_277871_+	NUDIX domain-containing protein	NA	A0A1B0V161	Roseobacter_phage	36.4	4.5e-05
>prophage 22
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	290786	293676	2744393	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_128104834.1|290786_291164_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	40.0	1.5e-15
WP_050819109.1|291330_293676_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	2.1e-176
>prophage 23
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	299417	308924	2744393	tRNA	Bacillus_phage(20.0%)	8	NA	NA
WP_003623821.1|299417_300131_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	3.9e-33
WP_050819115.1|300324_300921_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_050819116.1|301126_303031_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	52.1	1.6e-150
WP_128104839.1|303186_304329_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.4	8.3e-25
WP_128104840.1|304335_305115_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_128104841.1|305304_306492_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.8	8.4e-97
WP_128104842.1|306510_307248_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003629724.1|307346_308924_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.0	1.0e-65
>prophage 24
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	315360	315855	2744393		Caulobacter_phage(100.0%)	1	NA	NA
WP_080986739.1|315360_315855_-	helix-turn-helix domain-containing protein	NA	K4K6E9	Caulobacter_phage	60.0	1.8e-16
>prophage 25
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	329240	333877	2744393		Megavirus(33.33%)	4	NA	NA
WP_128104853.1|329240_330530_+	adenylosuccinate synthase	NA	K7YXK1	Megavirus	33.7	5.2e-60
WP_019088766.1|330752_331442_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	33.8	1.9e-32
WP_128104854.1|331461_332769_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_035362206.1|332854_333877_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A2R8FEI2	Cedratvirus	26.9	5.5e-12
>prophage 26
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	341217	343374	2744393		Bacillus_phage(100.0%)	1	NA	NA
WP_128104859.1|341217_343374_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	1.0e-31
>prophage 27
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	350416	354708	2744393	integrase	uncultured_Mediterranean_phage(50.0%)	3	342967:342980	356018:356031
342967:342980	attL	AATACCCGTGAACT	NA	NA	NA	NA
WP_128104866.1|350416_352294_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.3	4.4e-100
WP_128104867.1|352399_353326_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_128104868.1|353598_354708_-|integrase	site-specific integrase	integrase	K4PAZ9	Burkholderia_phage	26.5	8.6e-19
356018:356031	attR	AATACCCGTGAACT	NA	NA	NA	NA
>prophage 28
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	370880	376209	2744393		Staphylococcus_phage(50.0%)	4	NA	NA
WP_128104884.1|370880_372869_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	33.5	1.2e-66
WP_128104885.1|373094_374357_+	MFS transporter	NA	NA	NA	NA	NA
WP_128106175.1|374427_375546_+	thylakoid lumen protein	NA	NA	NA	NA	NA
WP_128104886.1|375642_376209_+	DUF1643 domain-containing protein	NA	K4JQR8	Caulobacter_virus	41.0	9.1e-25
>prophage 29
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	384985	390049	2744393		Streptococcus_phage(50.0%)	6	NA	NA
WP_050819186.1|384985_386311_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.9	1.5e-89
WP_128104891.1|386351_387044_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_042787045.1|387178_387601_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_128104892.1|387656_388112_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_128104893.1|388223_389102_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_035365910.1|389107_390049_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.5	1.2e-08
>prophage 30
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	400042	400597	2744393		Pseudomonas_phage(100.0%)	1	NA	NA
WP_012812446.1|400042_400597_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	67.1	2.8e-63
>prophage 31
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	412798	414760	2744393		Geobacillus_virus(100.0%)	1	NA	NA
WP_128104901.1|412798_414760_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	29.1	4.6e-07
>prophage 32
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	421169	421379	2744393		Escherichia_phage(100.0%)	1	NA	NA
WP_003625103.1|421169_421379_-	hypothetical protein	NA	A0A0A0YUA2	Escherichia_phage	50.0	4.0e-10
>prophage 33
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	424978	425911	2744393		Tupanvirus(100.0%)	1	NA	NA
WP_050819205.1|424978_425911_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.1	2.5e-43
>prophage 34
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	441479	442241	2744393		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_128104913.1|441479_442241_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	4.4e-14
>prophage 35
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	451576	452998	2744393		Hokovirus(100.0%)	1	NA	NA
WP_128106178.1|451576_452998_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	26.7	8.1e-46
>prophage 36
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	494651	495326	2744393		Sulfitobacter_phage(100.0%)	1	NA	NA
WP_128104943.1|494651_495326_+	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	50.0	8.1e-12
>prophage 37
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	510066	510918	2744393		Pseudomonas_virus(100.0%)	1	NA	NA
WP_050819310.1|510066_510918_-	LexA family transcriptional regulator	NA	H1ZZB6	Pseudomonas_virus	30.6	2.4e-08
>prophage 38
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	519985	527032	2744393	terminase	Salmonella_phage(33.33%)	7	NA	NA
WP_128104958.1|519985_522082_+	acyltransferase	NA	C6ZR20	Salmonella_phage	35.7	8.5e-60
WP_087651480.1|522078_522726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128104959.1|522889_523432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819318.1|523418_523598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651479.1|523632_525087_+|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	45.6	7.9e-105
WP_128104960.1|525083_526136_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_128104961.1|526294_527032_+	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	35.9	1.6e-08
>prophage 39
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	531251	532514	2744393		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_050819337.1|531251_532514_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.3	2.5e-30
>prophage 40
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	538166	541763	2744393		Synechococcus_phage(50.0%)	5	NA	NA
WP_003627019.1|538166_539072_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.6	5.4e-11
WP_128104967.1|539435_539810_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_167506884.1|539927_540401_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_128104969.1|540541_541318_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003627014.1|541328_541763_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	38.6	2.8e-05
>prophage 41
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	547294	549532	2744393		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_128106183.1|547294_549532_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.0	3.2e-81
>prophage 42
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	560287	561454	2744393		Mycobacterium_phage(100.0%)	1	NA	NA
WP_128104976.1|560287_561454_+	acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit	NA	G1BRG0	Mycobacterium_phage	26.9	3.8e-09
>prophage 43
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	571886	572684	2744393		Mycobacterium_phage(100.0%)	1	NA	NA
WP_128104982.1|571886_572684_-	alpha/beta fold hydrolase	NA	A0A1J0GNR5	Mycobacterium_phage	32.2	5.1e-05
>prophage 44
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	582279	583092	2744393		Pandoravirus(100.0%)	1	NA	NA
WP_128104987.1|582279_583092_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	35.8	2.7e-09
>prophage 45
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	589113	594280	2744393		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_050820348.1|589113_590931_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	43.3	1.1e-23
WP_128104990.1|591285_591597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128104991.1|591781_593038_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_003622489.1|593263_594280_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	27.5	6.5e-13
>prophage 46
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	606754	612264	2744393		Streptococcus_phage(50.0%)	4	NA	NA
WP_050819382.1|606754_608560_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	1.8e-21
WP_087651454.1|608686_609862_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_019089810.1|609861_610467_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_128104998.1|610923_612264_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	1.4e-52
>prophage 47
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	615912	623477	2744393		Tupanvirus(33.33%)	8	NA	NA
WP_128105001.1|615912_618216_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	35.1	4.0e-10
WP_003622537.1|618212_618620_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_128105002.1|618708_619515_+	signal peptidase I	NA	NA	NA	NA	NA
WP_128105003.1|619529_620246_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	32.6	5.7e-16
WP_128105004.1|620252_621155_+	GTPase Era	NA	NA	NA	NA	NA
WP_050819392.1|621268_622006_+	UMP kinase	NA	NA	NA	NA	NA
WP_003622549.1|622110_622674_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_128105005.1|622736_623477_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.5	1.1e-22
>prophage 48
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	642254	651391	2744393	tRNA	Synechococcus_phage(33.33%)	13	NA	NA
WP_128105017.1|642254_643193_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.5	1.9e-06
WP_042788625.1|643212_643773_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.4	8.4e-23
WP_003622597.1|643841_644036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035362006.1|644011_644521_+	Hsp20 family protein	NA	A0A222YXB4	Synechococcus_phage	34.3	4.7e-12
WP_003622604.1|644539_644806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105018.1|644898_645519_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_050819407.1|645865_646168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105019.1|646200_647040_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_128105020.1|647036_647858_-	LPS export ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	4.6e-17
WP_128105021.1|647860_648940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105022.1|648941_649679_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_128105023.1|649675_650689_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E5E465	Acinetobacter_phage	32.3	1.5e-17
WP_128105024.1|650737_651391_-	ribonuclease D	NA	K7XYU9	uncultured_Mediterranean_phage	35.5	4.2e-13
>prophage 49
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	654697	659546	2744393		Liberibacter_phage(33.33%)	4	NA	NA
WP_050819413.1|654697_655351_+	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	29.7	6.0e-12
WP_128105028.1|655356_656790_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	30.8	1.3e-35
WP_128105029.1|656786_657971_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_128105030.1|658043_659546_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.3	5.3e-72
>prophage 50
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	677871	679794	2744393		Staphylococcus_phage(100.0%)	1	NA	NA
WP_128105035.1|677871_679794_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	34.4	9.2e-69
>prophage 51
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	686752	700351	2744393		Pandoravirus(20.0%)	12	NA	NA
WP_128105042.1|686752_687754_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	36.1	7.0e-36
WP_050820364.1|687843_688626_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_128105043.1|688757_690242_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.2	2.6e-47
WP_050819434.1|690303_690750_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_050819435.1|690856_691711_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_128105044.1|691727_692846_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_128105045.1|692984_695552_-	ATP-dependent helicase HrpB	NA	A0A2K9L0J3	Tupanvirus	25.4	9.9e-26
WP_128105046.1|695652_696612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105047.1|696747_697698_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_050819440.1|697822_698140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820365.1|698144_699131_-	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	26.1	1.2e-19
WP_128105048.1|699142_700351_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.1e-22
>prophage 52
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	705128	731468	2744393	tRNA	Klosneuvirus(11.11%)	20	NA	NA
WP_128105052.1|705128_708044_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.6	3.1e-68
WP_050819449.1|708040_708556_+	signal peptidase II	NA	NA	NA	NA	NA
WP_050819450.1|708602_709133_+	DUF3035 domain-containing protein	NA	NA	NA	NA	NA
WP_128105053.1|709150_711085_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.2	5.1e-91
WP_128105054.1|711203_712721_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_128105055.1|712745_713672_-	EamA family transporter	NA	NA	NA	NA	NA
WP_128105056.1|713741_715781_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	37.7	1.4e-107
WP_050819454.1|715886_716414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105057.1|716803_717331_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_050819456.1|717454_717904_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_050819457.1|718057_719044_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.4	4.1e-73
WP_050819458.1|719145_720309_-	OmpA family protein	NA	NA	NA	NA	NA
WP_128105058.1|720510_720852_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_050819460.1|720862_722578_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	24.3	3.0e-10
WP_128105059.1|722567_724598_-	VacB/RNase II family 3'-5' exoribonuclease	NA	Q0GXV6	Lactococcus_phage	28.4	9.5e-24
WP_128105060.1|724604_727298_-	type I DNA topoisomerase	NA	A0A0G2Y4W4	Acanthamoeba_polyphaga_mimivirus	31.8	8.6e-89
WP_128105061.1|727327_728566_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.4	5.3e-25
WP_050819464.1|728596_729238_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_128105062.1|729237_730530_-	dihydroorotase	NA	NA	NA	NA	NA
WP_128105063.1|730526_731468_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	31.5	2.5e-27
>prophage 53
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	741338	746255	2744393		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_128106186.1|741338_743063_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	4.7e-40
WP_050819472.1|743128_744163_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_050820369.1|744305_744701_-	DUF3597 domain-containing protein	NA	NA	NA	NA	NA
WP_128105067.1|744965_746255_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	34.3	2.8e-53
>prophage 54
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	758355	761001	2744393	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_128106187.1|758355_761001_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.0	4.7e-71
>prophage 55
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	765389	766310	2744393		Brevibacillus_phage(100.0%)	1	NA	NA
WP_128105078.1|765389_766310_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.5	9.9e-29
>prophage 56
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	773672	774779	2744393	tRNA	Moraxella_phage(100.0%)	1	NA	NA
WP_128105082.1|773672_774779_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.7	2.0e-63
>prophage 57
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	778777	779635	2744393		Synechococcus_phage(100.0%)	1	NA	NA
WP_128105085.1|778777_779635_+	site-specific DNA-methyltransferase	NA	A0A0E3HGT7	Synechococcus_phage	44.2	6.8e-64
>prophage 58
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	795031	800279	2744393	protease	Ostreococcus_lucimarinus_virus(33.33%)	6	NA	NA
WP_012812736.1|795031_795850_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	33.5	2.4e-34
WP_128105097.1|795909_797001_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_128105098.1|797097_797430_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_128105099.1|797445_798429_-	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.3	7.6e-19
WP_128105100.1|798541_799303_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_128105101.1|799292_800279_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.4	1.7e-50
>prophage 59
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	809125	811614	2744393		Bradyrhizobium_phage(50.0%)	3	NA	NA
WP_128105108.1|809125_809800_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	47.1	6.6e-46
WP_003625153.1|809980_810478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105109.1|810504_811614_-	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	24.6	1.5e-07
>prophage 60
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	816249	817332	2744393		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_128105112.1|816249_817332_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.1e-53
>prophage 61
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	845276	846251	2744393		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_128105122.1|845276_846251_-	D-glycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	27.9	4.7e-21
>prophage 62
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	856823	858092	2744393		Burkholderia_virus(100.0%)	1	NA	NA
WP_087651402.1|856823_858092_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.7	5.0e-47
>prophage 63
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	861810	864984	2744393		Leptospira_phage(100.0%)	1	NA	NA
WP_128105128.1|861810_864984_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	1.9e-50
>prophage 64
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	870670	881594	2744393		Phaeocystis_globosa_virus(33.33%)	5	NA	NA
WP_050819559.1|870670_874843_+	DNA-directed RNA polymerase subunit beta	NA	R4TQG3	Phaeocystis_globosa_virus	30.7	5.5e-26
WP_128105130.1|874936_879112_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.6e-63
WP_003622698.1|879450_879822_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_006116053.1|879836_880313_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_042786750.1|880403_881594_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.1	5.8e-13
>prophage 65
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	892585	893254	2744393		Tenacibaculum_phage(100.0%)	1	NA	NA
WP_087651398.1|892585_893254_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	28.2	5.2e-11
>prophage 66
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	897787	898597	2744393		Bacillus_virus(100.0%)	1	NA	NA
WP_167506848.1|897787_898597_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.4	6.1e-30
>prophage 67
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	910646	912379	2744393		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_035351584.1|910646_911279_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	36.0	5.1e-16
WP_003622780.1|911275_912379_+	site-specific DNA-methyltransferase	NA	S5Y7I7	Mycobacterium_phage	26.3	6.8e-16
>prophage 68
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	920776	923821	2744393	tRNA	Caulobacter_phage(50.0%)	2	NA	NA
WP_128105144.1|920776_921970_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	K4JS34	Caulobacter_phage	35.6	7.8e-42
WP_050819582.1|922027_923821_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	5.1e-53
>prophage 69
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	928469	929915	2744393		Moraxella_phage(100.0%)	1	NA	NA
WP_128105145.1|928469_929915_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.6	2.8e-30
>prophage 70
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	940539	947928	2744393		Caulobacter_phage(33.33%)	7	NA	NA
WP_128105149.1|940539_942381_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.2	2.0e-84
WP_128105150.1|942526_944518_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	6.3e-36
WP_128105151.1|944507_945089_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050819597.1|945255_945717_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003622836.1|945723_945999_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_128105152.1|946010_946616_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_128105153.1|946716_947928_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	35.2	5.3e-46
>prophage 71
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	957241	959092	2744393		Bacillus_phage(100.0%)	1	NA	NA
WP_128105156.1|957241_959092_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	3.0e-24
>prophage 72
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	966393	967998	2744393		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_128105159.1|966393_967998_-	tetratricopeptide repeat protein	NA	F2Y1J7	Organic_Lake_phycodnavirus	23.5	5.6e-11
>prophage 73
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	972257	972938	2744393		Planktothrix_phage(100.0%)	1	NA	NA
WP_035365432.1|972257_972938_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.4	1.7e-25
>prophage 74
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	976801	980761	2744393	protease	Feldmannia_irregularis_virus(50.0%)	3	NA	NA
WP_050819618.1|976801_978802_+	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	30.3	7.0e-11
WP_128105164.1|978848_979448_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_128105165.1|979447_980761_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.8	2.0e-43
>prophage 75
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	985876	1025818	2744393	tRNA	Caulobacter_phage(14.29%)	37	NA	NA
WP_128105168.1|985876_987349_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.3	3.5e-52
WP_042786675.1|987571_987772_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003622900.1|987786_988146_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_128105169.1|988310_989381_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.7	1.5e-28
WP_128105170.1|989384_991844_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_080986779.1|991864_992911_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SY86	Cyanophage	35.4	6.8e-42
WP_128105171.1|993008_994712_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050819627.1|994834_995227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819628.1|995342_997943_+	cyclic nucleotide-binding domain-containing protein	NA	A0A2H4J178	uncultured_Caudovirales_phage	26.6	3.0e-06
WP_128105172.1|998021_998663_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_003622919.1|998845_999463_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_128105173.1|999562_1001110_+	peptide chain release factor 3	NA	E4ZFJ7	Streptococcus_phage	29.0	6.6e-33
WP_128105174.1|1001128_1001866_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_019090131.1|1001964_1002996_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_128105175.1|1003093_1004875_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	35.4	5.3e-95
WP_128105176.1|1004915_1005836_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_167506889.1|1005835_1007998_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.0	3.3e-107
WP_128105178.1|1008112_1008937_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_128105179.1|1008897_1009698_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_128105180.1|1009732_1010902_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_128105181.1|1010898_1011447_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.0	1.2e-16
WP_003622940.1|1011491_1011698_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_080986859.1|1011937_1012102_+	YdcH family protein	NA	NA	NA	NA	NA
WP_050819637.1|1012171_1012762_-	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_012812820.1|1013005_1013512_-	Hsp20 family protein	NA	A0A218MMV3	uncultured_virus	37.6	9.3e-21
WP_050819638.1|1013694_1013925_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_012812821.1|1014214_1014694_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_128105182.1|1014762_1015185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105183.1|1015258_1016209_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.5	3.0e-28
WP_128105184.1|1016221_1017781_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_128105185.1|1018022_1019003_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_050819643.1|1019202_1021134_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	62.4	3.9e-216
WP_128105186.1|1021206_1022226_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	54.9	6.3e-101
WP_128105187.1|1022231_1022987_-	methyltransferase	NA	NA	NA	NA	NA
WP_050819645.1|1023104_1024175_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.1	6.8e-05
WP_128105188.1|1024188_1025058_-	glutamate racemase	NA	NA	NA	NA	NA
WP_012812827.1|1025062_1025818_-	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	30.1	1.1e-12
>prophage 76
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1028858	1029590	2744393		Agrobacterium_phage(100.0%)	1	NA	NA
WP_128105191.1|1028858_1029590_-	phosphatase	NA	A0A2L0UZN4	Agrobacterium_phage	31.1	1.3e-23
>prophage 77
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1038996	1040052	2744393		Erwinia_phage(100.0%)	1	NA	NA
WP_128106193.1|1038996_1040052_-	PhoH family protein	NA	W8D063	Erwinia_phage	44.6	3.9e-45
>prophage 78
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1055578	1056862	2744393		Klosneuvirus(100.0%)	1	NA	NA
WP_128105201.1|1055578_1056862_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	9.6e-14
>prophage 79
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1060232	1064374	2744393		Lactococcus_phage(50.0%)	5	NA	NA
WP_128105205.1|1060232_1060883_-	transcriptional repressor LexA	NA	Q38327	Lactococcus_phage	27.3	9.9e-07
WP_128105206.1|1060968_1062243_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003623017.1|1062312_1062480_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_006115173.1|1062593_1062923_-	septation inhibitor protein	NA	NA	NA	NA	NA
WP_128105207.1|1063093_1064374_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	61.2	6.0e-141
>prophage 80
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1075873	1085436	2744393		Pandoravirus(20.0%)	9	NA	NA
WP_128106194.1|1075873_1077319_+	cytochrome D ubiquinol oxidase subunit I	NA	S4W1T5	Pandoravirus	24.8	7.5e-15
WP_128105213.1|1077349_1079266_-	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	29.2	2.4e-16
WP_128105214.1|1079279_1080287_-	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	31.0	3.5e-35
WP_080986783.1|1080375_1080996_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_128105215.1|1081047_1081386_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_087651361.1|1081385_1081958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819678.1|1081938_1082640_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003623457.1|1083136_1084027_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	9.5e-69
WP_128105216.1|1084026_1085436_+	phosphomannomutase/phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.6	3.0e-08
>prophage 81
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1107591	1112817	2744393	tRNA	Synechococcus_phage(25.0%)	5	NA	NA
WP_128105234.1|1107591_1108458_+	SPOR domain-containing protein	NA	H2BCY4	Synechococcus_phage	44.8	4.2e-05
WP_050819699.1|1108464_1109685_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	35.0	4.2e-51
WP_128105235.1|1109688_1110333_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	36.8	1.6e-25
WP_050820392.1|1110337_1111282_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_128105236.1|1111278_1112817_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	40.3	2.0e-98
>prophage 82
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1117114	1122411	2744393		Pandoravirus(33.33%)	6	NA	NA
WP_003623525.1|1117114_1118185_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	2.0e-81
WP_128105239.1|1118205_1118640_-	OsmC family protein	NA	NA	NA	NA	NA
WP_128105240.1|1118927_1120427_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_128105241.1|1120476_1121025_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_128105242.1|1121017_1121758_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	48.6	3.4e-56
WP_128105243.1|1121760_1122411_-	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	31.5	2.6e-07
>prophage 83
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1125845	1127726	2744393		Brazilian_marseillevirus(100.0%)	1	NA	NA
WP_128105245.1|1125845_1127726_+	adenylyl-sulfate kinase	NA	A0A142CJQ8	Brazilian_marseillevirus	29.5	1.7e-38
>prophage 84
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1146004	1147226	2744393		Morganella_phage(50.0%)	2	NA	NA
WP_003628822.1|1146004_1146616_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	49.3	9.6e-12
WP_003628823.1|1146719_1147226_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.7	9.0e-24
>prophage 85
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1151289	1152549	2744393		Catovirus(100.0%)	1	NA	NA
WP_050819730.1|1151289_1152549_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	45.2	3.5e-101
>prophage 86
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1161023	1170659	2744393		Pseudomonas_phage(33.33%)	10	NA	NA
WP_087651346.1|1161023_1163228_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.2	2.5e-163
WP_128105265.1|1163224_1163926_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003630617.1|1163922_1164294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105266.1|1164290_1164533_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003630621.1|1164561_1165329_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	41.7	1.7e-45
WP_012812894.1|1165483_1166833_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.5	1.8e-18
WP_128105267.1|1167004_1167616_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	35.0	4.1e-15
WP_128105268.1|1167674_1169648_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	9.3e-08
WP_128105269.1|1169652_1170129_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_128105270.1|1170146_1170659_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	49.3	4.4e-26
>prophage 87
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1178562	1182755	2744393		Acinetobacter_phage(75.0%)	4	NA	NA
WP_128105278.1|1178562_1179429_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	47.1	1.3e-54
WP_128105279.1|1179446_1180559_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.6	1.1e-42
WP_128105280.1|1180558_1181155_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.6	2.0e-59
WP_128105281.1|1181213_1182755_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	30.7	7.7e-34
>prophage 88
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1186136	1205700	2744393	tRNA	Bacillus_virus(33.33%)	15	NA	NA
WP_128105285.1|1186136_1187771_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.0	1.5e-152
WP_128105286.1|1187767_1188601_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	45.0	7.6e-52
WP_128105287.1|1188711_1191150_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	36.0	7.0e-114
WP_128105288.1|1191240_1192389_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_087651339.1|1192434_1193559_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	43.3	6.6e-67
WP_128105289.1|1193674_1195108_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_012812907.1|1195447_1195717_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_128105290.1|1195854_1196694_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	31.4	3.2e-26
WP_128105291.1|1196723_1197506_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_128105292.1|1197517_1198747_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.4	4.9e-39
WP_050819761.1|1198782_1199262_+	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	59.3	1.4e-37
WP_128105293.1|1199258_1201007_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_128105294.1|1201022_1202378_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	5.9e-30
WP_128105295.1|1202390_1202927_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_128105296.1|1203006_1205700_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.7	6.3e-140
>prophage 89
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1219783	1225543	2744393		Bacillus_phage(66.67%)	4	NA	NA
WP_128105304.1|1219783_1221664_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.6	1.4e-77
WP_050819776.1|1221668_1222046_-	OmpA family protein	NA	NA	NA	NA	NA
WP_128105305.1|1222124_1223819_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.0	4.2e-17
WP_128105306.1|1223821_1225543_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.6	1.2e-24
>prophage 90
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1229839	1234899	2744393		Tupanvirus(50.0%)	3	NA	NA
WP_128105309.1|1229839_1231651_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	23.4	1.7e-27
WP_128105310.1|1231716_1233768_+	alpha,alpha-trehalase TreF	NA	NA	NA	NA	NA
WP_128105311.1|1233783_1234899_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.9	7.8e-36
>prophage 91
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1241974	1242766	2744393		Bacillus_virus(100.0%)	1	NA	NA
WP_050819791.1|1241974_1242766_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	2.3e-26
>prophage 92
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1254284	1259601	2744393		Acinetobacter_phage(66.67%)	3	NA	NA
WP_128105325.1|1254284_1256630_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	51.4	7.0e-212
WP_128105326.1|1256622_1258104_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	43.5	4.7e-97
WP_128105327.1|1258140_1259601_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.6	3.6e-25
>prophage 93
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1271756	1274492	2744393		Staphylococcus_phage(100.0%)	1	NA	NA
WP_128105333.1|1271756_1274492_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	1.3e-20
>prophage 94
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1284897	1286130	2744393		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_128105338.1|1284897_1286130_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	44.1	2.5e-67
>prophage 95
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1289240	1291358	2744393		Tupanvirus(100.0%)	1	NA	NA
WP_128105341.1|1289240_1291358_-	catalase	NA	A0A2K9L572	Tupanvirus	49.7	1.1e-136
>prophage 96
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1306973	1308677	2744393		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_167506850.1|1306973_1308677_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.4	3.3e-09
>prophage 97
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1324515	1325460	2744393		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_128105358.1|1324515_1325460_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	29.2	3.1e-25
>prophage 98
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1334771	1337411	2744393		Acinetobacter_phage(100.0%)	1	NA	NA
WP_050819847.1|1334771_1337411_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.1	1.7e-12
>prophage 99
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1362449	1363412	2744393		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_128105381.1|1362449_1363412_-	hydroxyacid dehydrogenase	NA	M1GWB3	Acanthocystis_turfacea_Chlorella_virus	24.9	4.7e-13
>prophage 100
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1374476	1376189	2744393		Pithovirus(100.0%)	1	NA	NA
WP_167506893.1|1374476_1376189_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	28.2	1.8e-07
>prophage 101
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1418190	1420704	2744393		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_128105425.1|1418190_1420704_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.4	1.3e-155
>prophage 102
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1492291	1493770	2744393		Klosneuvirus(100.0%)	1	NA	NA
WP_050819985.1|1492291_1493770_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	1.6e-97
>prophage 103
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1497649	1499658	2744393		Planktothrix_phage(50.0%)	2	NA	NA
WP_128105473.1|1497649_1498681_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	9.5e-12
WP_128105474.1|1498677_1499658_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.8	6.9e-12
>prophage 104
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1534272	1538777	2744393		Cedratvirus(33.33%)	3	NA	NA
WP_128105494.1|1534272_1535964_-	thiol reductant ABC exporter subunit CydC	NA	A0A1M7XV31	Cedratvirus	32.0	1.3e-13
WP_167506855.1|1535960_1537640_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	33.2	4.9e-26
WP_128106214.1|1538087_1538777_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	30.2	2.2e-20
>prophage 105
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1553106	1554729	2744393		Tupanvirus(100.0%)	1	NA	NA
WP_128105504.1|1553106_1554729_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.3e-60
>prophage 106
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1559469	1563142	2744393		Acinetobacter_phage(50.0%)	2	NA	NA
WP_128106218.1|1559469_1561983_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	40.6	1.7e-17
WP_128105507.1|1562071_1563142_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.2	1.6e-75
>prophage 107
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1570273	1571566	2744393		Acinetobacter_phage(100.0%)	1	NA	NA
WP_128105514.1|1570273_1571566_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	30.8	4.6e-40
>prophage 108
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1601468	1604025	2744393	integrase	Brevibacillus_phage(50.0%)	5	1597739:1597752	1605571:1605584
1597739:1597752	attL	TTCAGTATCAGTTC	NA	NA	NA	NA
WP_128105532.1|1601468_1601906_+	hypothetical protein	NA	S5M633	Brevibacillus_phage	31.9	1.7e-07
WP_167506856.1|1602148_1602475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105533.1|1602660_1603044_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_128105534.1|1603040_1603337_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_128105535.1|1603386_1604025_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	26.8	1.1e-07
1605571:1605584	attR	GAACTGATACTGAA	NA	NA	NA	NA
>prophage 109
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1611222	1614309	2744393		Gordonia_phage(100.0%)	1	NA	NA
WP_128105540.1|1611222_1614309_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	26.6	8.5e-24
>prophage 110
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1623242	1625957	2744393		Clostridioides_phage(100.0%)	1	NA	NA
WP_128105546.1|1623242_1625957_-	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	23.2	1.6e-05
>prophage 111
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1631637	1633311	2744393		Rhizobium_phage(100.0%)	1	NA	NA
WP_128106222.1|1631637_1633311_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	34.4	1.1e-81
>prophage 112
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1642430	1643645	2744393		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_128105552.1|1642430_1643645_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	D2TEZ5	Emiliania_huxleyi_virus	29.6	6.7e-33
>prophage 113
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1652697	1657707	2744393		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_128105560.1|1652697_1654521_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HMK6	Paramecium_bursaria_Chlorella_virus	38.4	4.6e-102
WP_128105561.1|1654564_1655398_-	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_050820052.1|1655419_1656217_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167506860.1|1656498_1656981_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_128105563.1|1656984_1657707_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	1.9e-11
>prophage 114
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1677342	1682535	2744393	protease	Burkholderia_phage(25.0%)	4	NA	NA
WP_003624117.1|1677342_1677630_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.6	3.2e-18
WP_128105573.1|1677775_1680298_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.5	2.0e-204
WP_050820069.1|1680495_1681761_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.8	5.6e-131
WP_035362286.1|1681881_1682535_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	2.7e-57
>prophage 115
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1686535	1694326	2744393		Diachasmimorpha_longicaudata_entomopoxvirus(25.0%)	8	NA	NA
WP_128105575.1|1686535_1688449_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	4.3e-50
WP_128105576.1|1688457_1689756_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_050820075.1|1689709_1690078_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	35.8	6.8e-13
WP_003624097.1|1690104_1690593_-	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_128105577.1|1690579_1691032_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_128105578.1|1691028_1692276_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.3	1.5e-99
WP_128105579.1|1692275_1693559_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003624093.1|1693555_1694326_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.4	8.6e-10
>prophage 116
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1701910	1706942	2744393		Streptococcus_phage(50.0%)	5	NA	NA
WP_128105583.1|1701910_1703998_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	1.5e-61
WP_128105584.1|1703884_1704139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820084.1|1704227_1704533_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_050820085.1|1704650_1704944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105585.1|1705040_1706942_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.7	1.6e-44
>prophage 117
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1710846	1713501	2744393		Indivirus(100.0%)	1	NA	NA
WP_128105588.1|1710846_1713501_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	34.7	3.8e-28
>prophage 118
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1719838	1721104	2744393		Bacillus_virus(100.0%)	1	NA	NA
WP_050820093.1|1719838_1721104_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.9	2.9e-47
>prophage 119
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1731731	1736360	2744393		Orpheovirus(33.33%)	5	NA	NA
WP_128105601.1|1731731_1732679_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.4	2.5e-67
WP_020944155.1|1732795_1733677_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050820105.1|1734178_1734643_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.0	2.3e-21
WP_050820106.1|1734791_1735106_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_128105602.1|1735097_1736360_-	UdgX family uracil-DNA binding protein	NA	A0A2I6PIA1	Pseudomonas_phage	30.2	1.2e-08
>prophage 120
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1740329	1740650	2744393		Bacillus_phage(100.0%)	1	NA	NA
WP_003623929.1|1740329_1740650_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	33.7	6.1e-10
>prophage 121
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1746094	1748962	2744393		Bacillus_phage(33.33%)	5	NA	NA
WP_003623943.1|1746094_1746817_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	5.6e-27
WP_050820114.1|1746806_1747328_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128105609.1|1747356_1748016_-	rpsU-divergently transcribed protein	NA	NA	NA	NA	NA
WP_128105610.1|1748019_1748544_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.8	2.3e-14
WP_019088333.1|1748758_1748962_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	49.2	5.8e-06
>prophage 122
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1760653	1762015	2744393		Bacillus_virus(100.0%)	1	NA	NA
WP_128105616.1|1760653_1762015_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.4	1.7e-72
>prophage 123
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1774000	1786238	2744393		Organic_Lake_phycodnavirus(25.0%)	10	NA	NA
WP_128105625.1|1774000_1775761_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	24.4	1.4e-15
WP_128105626.1|1775845_1776721_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003623988.1|1776717_1777137_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_128105627.1|1777143_1778331_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_128105628.1|1778515_1779973_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	51.7	2.2e-123
WP_088364930.1|1780038_1780659_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
WP_050820139.1|1780883_1781759_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167506896.1|1781707_1782499_-	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_003629595.1|1782757_1783366_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	4.2e-36
WP_050820141.1|1783622_1786238_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.7	2.9e-118
>prophage 124
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1790062	1801581	2744393	tRNA	Bacillus_phage(40.0%)	8	NA	NA
WP_128105630.1|1790062_1792327_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	21.6	1.5e-06
WP_128105631.1|1792336_1793779_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_128105632.1|1793834_1794944_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	3.9e-11
WP_128105633.1|1794940_1796011_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_087652155.1|1796095_1797250_-	bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_050820434.1|1797311_1798286_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	49.8	1.3e-74
WP_128105635.1|1798890_1800378_-	hypothetical protein	NA	F1C5A9	Cronobacter_phage	26.5	4.5e-31
WP_128105636.1|1800429_1801581_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	42.1	3.4e-79
>prophage 125
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1807774	1812547	2744393		Cellulophaga_phage(50.0%)	6	NA	NA
WP_003629580.1|1807774_1808260_-	xanthine phosphoribosyltransferase	NA	M4T1R9	Cellulophaga_phage	26.4	8.7e-08
WP_128105641.1|1808318_1809704_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_080986824.1|1809788_1810457_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_087651920.1|1810496_1810748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105642.1|1810850_1811096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167506897.1|1811233_1812547_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	36.2	1.5e-70
>prophage 126
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1818652	1824842	2744393		uncultured_virus(75.0%)	5	NA	NA
WP_128106228.1|1818652_1821610_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	32.6	3.3e-09
WP_003625755.1|1821628_1821832_-	cold-shock protein	NA	A0A218MMZ6	uncultured_virus	51.5	1.3e-13
WP_128105646.1|1821975_1822644_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_050820441.1|1822854_1823148_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	57.0	1.9e-21
WP_003625762.1|1823201_1824842_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.0	2.8e-175
>prophage 127
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1840598	1842098	2744393		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_128105654.1|1840598_1842098_-	N-acetylglucosaminyltransferase	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	29.9	6.6e-22
>prophage 128
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1847365	1848313	2744393		Brevibacillus_phage(100.0%)	1	NA	NA
WP_087651900.1|1847365_1848313_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	26.4	2.3e-20
>prophage 129
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1854344	1858580	2744393		Hokovirus(50.0%)	4	NA	NA
WP_128105660.1|1854344_1855844_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.3	4.7e-52
WP_050818257.1|1856128_1857337_+	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_050818258.1|1857457_1857928_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003624543.1|1857968_1858580_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	48.9	2.3e-45
>prophage 130
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1875255	1878742	2744393		Staphylococcus_phage(75.0%)	4	NA	NA
WP_128105666.1|1875255_1875741_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	38.3	1.2e-22
WP_167506863.1|1875777_1877121_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.7	2.4e-79
WP_128105667.1|1877105_1877708_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.7	5.0e-21
WP_128105668.1|1877689_1878742_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.7	6.9e-18
>prophage 131
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1884926	1886285	2744393		Moraxella_phage(100.0%)	1	NA	NA
WP_128105673.1|1884926_1886285_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.1	8.0e-35
>prophage 132
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1898634	1899219	2744393		Catovirus(100.0%)	1	NA	NA
WP_128105680.1|1898634_1899219_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	27.5	7.2e-09
>prophage 133
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1904316	1909644	2744393		Streptococcus_phage(25.0%)	6	NA	NA
WP_050818285.1|1904316_1905444_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	1.1e-56
WP_128105682.1|1905447_1906101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003623048.1|1906124_1906397_-	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	61.0	2.1e-19
WP_128105683.1|1906492_1908127_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.1	2.5e-67
WP_050818287.1|1908123_1908570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105684.1|1908585_1909644_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	33.9	4.5e-25
>prophage 134
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1934077	1941220	2744393		Sphingobium_phage(33.33%)	6	NA	NA
WP_128105699.1|1934077_1936165_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	40.3	2.2e-116
WP_128105700.1|1936388_1939064_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	43.1	6.3e-92
WP_050818308.1|1939114_1939939_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_087651874.1|1939989_1940448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986697.1|1940396_1940576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105701.1|1940620_1941220_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.6	5.3e-23
>prophage 135
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1948406	1950779	2744393		uncultured_virus(100.0%)	1	NA	NA
WP_128105705.1|1948406_1950779_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.4	2.5e-124
>prophage 136
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1955851	1957666	2744393		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_128105708.1|1955851_1957666_-	biosynthetic-type acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.3	3.9e-53
>prophage 137
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1961066	1962269	2744393		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_128105712.1|1961066_1962269_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	28.8	6.9e-38
>prophage 138
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1965816	1967109	2744393		Aeromonas_phage(100.0%)	1	NA	NA
WP_128105716.1|1965816_1967109_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.9	1.6e-101
>prophage 139
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1970751	1972956	2744393		Bacillus_virus(100.0%)	1	NA	NA
WP_128105719.1|1970751_1972956_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.7	8.3e-90
>prophage 140
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1978555	1983363	2744393		Pandoravirus(50.0%)	2	NA	NA
WP_128105723.1|1978555_1979941_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	39.2	5.5e-39
WP_128105724.1|1979943_1983363_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	36.9	1.6e-188
>prophage 141
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1989884	1990448	2744393		Virus_Rctr197k(100.0%)	1	NA	NA
WP_050818347.1|1989884_1990448_+	HNH endonuclease	NA	A0A1P8DIY8	Virus_Rctr197k	39.0	1.7e-23
>prophage 142
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	1993788	1996236	2744393		Moumouvirus(50.0%)	2	NA	NA
WP_035362113.1|1993788_1994211_-	nucleoside-diphosphate kinase	NA	A0A2P1ELL9	Moumouvirus	36.6	4.6e-13
WP_128105732.1|1994346_1996236_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.0e-72
>prophage 143
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2000227	2002852	2744393	tRNA	Agrobacterium_phage(50.0%)	2	NA	NA
WP_035351884.1|2000227_2000764_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.6	1.1e-14
WP_050818353.1|2000920_2002852_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.7	1.1e-114
>prophage 144
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2009473	2009968	2744393		Vibrio_phage(100.0%)	1	NA	NA
WP_050818359.1|2009473_2009968_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	55.2	2.0e-36
>prophage 145
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2024650	2025550	2744393		Thermus_virus(100.0%)	1	NA	NA
WP_128105744.1|2024650_2025550_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	49.0	6.8e-14
>prophage 146
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2034848	2046168	2744393	terminase,portal,capsid,protease,head	uncultured_Caudovirales_phage(16.67%)	13	NA	NA
WP_128105750.1|2034848_2035973_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	31.9	8.9e-48
WP_050818374.1|2035972_2036506_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1PA08	Enterococcus_phage	44.4	9.5e-16
WP_128105751.1|2036502_2037795_-|capsid	phage major capsid protein	capsid	M1Q1R5	Streptococcus_phage	29.2	1.2e-16
WP_167506866.1|2037795_2037948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105752.1|2038083_2038980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105753.1|2038982_2039441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050818378.1|2039685_2041320_-|terminase	terminase large subunit	terminase	K7P7T5	Enterobacteria_phage	39.3	1.1e-83
WP_124297189.1|2041396_2041726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050818380.1|2041722_2041995_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_167506898.1|2042152_2043319_-	virulence-associated E family protein	NA	A0A2D1GN57	Marinobacter_phage	40.7	1.0e-70
WP_087651857.1|2044599_2045070_+	cytochrome c	NA	NA	NA	NA	NA
WP_128105754.1|2045139_2045358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820249.1|2045406_2046168_-	glucose 1-dehydrogenase	NA	M1NMS3	Moumouvirus	33.3	9.4e-09
>prophage 147
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2063425	2063998	2744393		Lactobacillus_phage(100.0%)	1	NA	NA
WP_128105768.1|2063425_2063998_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.2	2.1e-16
>prophage 148
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2069309	2071781	2744393		Acinetobacter_phage(100.0%)	1	NA	NA
WP_087651853.1|2069309_2071781_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.8	3.5e-12
>prophage 149
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2096440	2097295	2744393		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_128105785.1|2096440_2097295_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	2.8e-62
>prophage 150
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2119526	2120000	2744393		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_128105800.1|2119526_2120000_-	hypothetical protein	NA	A0A1B2ANT4	Pseudoalteromonas_phage	38.0	4.6e-14
>prophage 151
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2126170	2156364	2744393	plate,tail,head	Aeromonas_phage(25.0%)	41	NA	NA
WP_128105806.1|2126170_2127154_-	DUF2612 domain-containing protein	NA	Q6UIZ7	Burkholderia_virus	29.7	1.2e-11
WP_128105807.1|2127153_2128371_-	hypothetical protein	NA	A0A2R3UAL9	Myoviridae_environmental_samples	37.1	1.6e-55
WP_167506899.1|2128832_2129300_-|plate	baseplate assembly protein	plate	H9C0X6	Aeromonas_phage	53.4	6.4e-24
WP_088364703.1|2129466_2130420_-	hypothetical protein	NA	A0A2R3UAK8	Myoviridae_environmental_samples	30.1	1.7e-31
WP_128105809.1|2130721_2131462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105810.1|2131683_2131875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105811.1|2131925_2132750_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	52.6	4.4e-20
WP_147748152.1|2132746_2133034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105813.1|2133379_2133835_+	hypothetical protein	NA	A0A141GEX7	Brucella_phage	36.4	1.3e-10
WP_128105814.1|2133971_2134151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105815.1|2134415_2134976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105816.1|2134975_2135467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105817.1|2135470_2137567_-|tail	phage tail protein	tail	A0A1D8KS53	Synechococcus_phage	38.4	3.3e-19
WP_088364719.1|2137712_2138177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105818.1|2138176_2138614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105819.1|2138616_2139774_-	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	34.7	9.9e-34
WP_128105820.1|2139770_2140334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128106243.1|2140270_2140669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105821.1|2140668_2141247_-	hypothetical protein	NA	A0A2H4P6T2	Pseudomonas_phage	42.1	3.8e-26
WP_128105822.1|2141237_2141654_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	41.4	8.2e-15
WP_128105823.1|2141663_2142002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105824.1|2142005_2143046_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	46.0	3.1e-79
WP_128105825.1|2143045_2143546_-	hypothetical protein	NA	A0A220NQI9	Acinetobacter_phage	46.3	1.4e-29
WP_128105826.1|2144988_2145819_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	36.9	8.1e-46
WP_128105827.1|2145815_2147306_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.1	1.3e-102
WP_128105828.1|2147305_2148790_-	hypothetical protein	NA	A0A1Y0T3N1	Sinorhizobium_phage	39.8	9.3e-77
WP_128106244.1|2148770_2149205_-	hypothetical protein	NA	Q716H4	Shigella_phage	42.9	3.6e-21
WP_128105829.1|2149244_2149868_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_147748153.1|2150004_2150319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105831.1|2150445_2151009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167506867.1|2151005_2151689_-	hypothetical protein	NA	A0A1V0CNY2	Kaumoebavirus	32.7	7.9e-07
WP_167506868.1|2151739_2151913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105833.1|2151909_2152389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105834.1|2152527_2152722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105835.1|2152885_2153068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105836.1|2153133_2153877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105837.1|2153873_2154812_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	43.0	4.6e-21
WP_128106245.1|2154933_2155272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105838.1|2155352_2155556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128105839.1|2155549_2156092_-	HNH endonuclease	NA	A0A0N9BAQ5	Vibrio_phage	30.1	1.0e-12
WP_128105840.1|2156088_2156364_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	36.0	4.0e-10
>prophage 152
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2162154	2166035	2744393		Bacillus_phage(33.33%)	7	NA	NA
WP_128105851.1|2162154_2163039_+	polymer-forming cytoskeletal protein	NA	L0LC68	Bacillus_phage	44.3	6.7e-06
WP_128105852.1|2163038_2163329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105853.1|2163328_2163565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105854.1|2163643_2163964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128105855.1|2164154_2164613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167506869.1|2164614_2165448_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	33.5	1.5e-28
WP_128105857.1|2165444_2166035_+	3'-5' exonuclease	NA	A0A1W6DWR2	Sphingobium_phage	39.9	2.2e-29
>prophage 153
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2173075	2177690	2744393	tRNA	uncultured_Mediterranean_phage(100.0%)	5	NA	NA
WP_128105866.1|2173075_2174344_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.3	1.3e-84
WP_050818430.1|2174347_2175178_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	47.5	8.1e-54
WP_167506870.1|2175174_2175843_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_128105868.1|2175915_2176782_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	39.8	8.5e-30
WP_128105869.1|2176778_2177690_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	28.6	8.6e-25
>prophage 154
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2192349	2192997	2744393	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_044582826.1|2192349_2192997_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	36.7	2.0e-31
>prophage 155
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2197996	2212966	2744393		Bacillus_phage(16.67%)	11	NA	NA
WP_128105884.1|2197996_2199829_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	2.3e-53
WP_003624419.1|2199915_2200806_-	RNA polymerase sigma factor RpoH	NA	G8CLC7	Synechococcus_phage	28.8	1.6e-15
WP_128106247.1|2201124_2202129_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_167506872.1|2202185_2203304_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_128105886.1|2203300_2204113_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	4.1e-10
WP_128105887.1|2204133_2205597_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	1.9e-50
WP_050818455.1|2205877_2206978_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_128105889.1|2207166_2209968_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	1.1e-59
WP_128105890.1|2209972_2210593_+	SCO family protein	NA	NA	NA	NA	NA
WP_128105891.1|2210688_2211435_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_050818458.1|2211505_2212966_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.8	3.4e-55
>prophage 156
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2225029	2226382	2744393		Mycobacterium_phage(100.0%)	1	NA	NA
WP_128105898.1|2225029_2226382_-	aspartate aminotransferase family protein	NA	A0A1C9EHH3	Mycobacterium_phage	28.7	2.1e-11
>prophage 157
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2234651	2235662	2744393		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_128105903.1|2234651_2235662_+	2OG-Fe(II) oxygenase	NA	A0A142EZV0	Stenotrophomonas_phage	35.6	2.9e-05
>prophage 158
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2249692	2254593	2744393		Mycobacterium_virus(50.0%)	5	NA	NA
WP_128105919.1|2249692_2250853_+	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	28.0	1.0e-09
WP_003626381.1|2250956_2251325_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_128105920.1|2251687_2252902_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_128105921.1|2252954_2253629_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_050818488.1|2253609_2254593_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.4	3.5e-24
>prophage 159
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2290148	2291267	2744393		Faustovirus(100.0%)	1	NA	NA
WP_128105945.1|2290148_2291267_-	threonine-phosphate decarboxylase	NA	A0A142C026	Faustovirus	24.9	1.0e-06
>prophage 160
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2307340	2309646	2744393		Enterobacteria_phage(50.0%)	3	NA	NA
WP_050818530.1|2307340_2307844_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	52.7	9.3e-21
WP_014457408.1|2308045_2308840_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_128105957.1|2308839_2309646_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.5e-15
>prophage 161
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2316005	2325771	2744393		Streptococcus_phage(25.0%)	8	NA	NA
WP_003623602.1|2316005_2317046_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	40.9	1.0e-45
WP_050818538.1|2317118_2318720_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.1	2.7e-13
WP_050818539.1|2318939_2319392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651540.1|2319655_2321056_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_128105963.1|2321135_2322392_-	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	38.0	2.0e-11
WP_050818542.1|2322658_2324251_+	L-lactate permease	NA	NA	NA	NA	NA
WP_003623595.1|2324338_2324641_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_128105964.1|2324790_2325771_+	ADP-glyceromanno-heptose 6-epimerase	NA	Q58M42	Prochlorococcus_phage	30.6	3.5e-24
>prophage 162
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2329524	2333147	2744393		Bacillus_phage(33.33%)	4	NA	NA
WP_128105968.1|2329524_2330889_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	40.8	6.9e-10
WP_128105969.1|2331078_2331942_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_128105970.1|2331938_2332796_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	8.1e-09
WP_070322603.1|2332799_2333147_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	47.0	1.3e-21
>prophage 163
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2341964	2342963	2744393		Synechococcus_phage(100.0%)	1	NA	NA
WP_128106254.1|2341964_2342963_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	46.9	2.3e-79
>prophage 164
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2351516	2353499	2744393		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_128105982.1|2351516_2353499_+	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	31.4	1.8e-75
>prophage 165
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2363945	2364671	2744393		Planktothrix_phage(100.0%)	1	NA	NA
WP_128106255.1|2363945_2364671_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.9e-28
>prophage 166
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2389276	2390542	2744393	integrase	Ralstonia_phage(100.0%)	1	2383914:2383928	2396746:2396760
2383914:2383928	attL	TCGGATGATCCCTGC	NA	NA	NA	NA
WP_099963249.1|2389276_2390542_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	34.9	1.3e-47
WP_099963249.1|2389276_2390542_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	34.9	1.3e-47
2396746:2396760	attR	TCGGATGATCCCTGC	NA	NA	NA	NA
>prophage 167
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2415480	2464615	2744393	transposase,tRNA	Bacillus_phage(25.0%)	47	NA	NA
WP_128106011.1|2415480_2416512_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_087607237.1|2417776_2418493_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	34.6	7.3e-11
WP_087607236.1|2418497_2418836_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_087607235.1|2418837_2419395_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_087607234.1|2419391_2419892_-	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_087607233.1|2419888_2420131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087607232.1|2420127_2420766_-	AAA family ATPase	NA	K7R2R7	Vibrio_phage	39.6	8.7e-32
WP_087608785.1|2420762_2421836_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_087607231.1|2421850_2422102_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087608784.1|2422325_2422784_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_087607230.1|2422893_2423112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087607229.1|2423252_2423516_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_087607228.1|2423646_2423931_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162900377.1|2424111_2424264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087607227.1|2424600_2424927_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_162900511.1|2425526_2426072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087607225.1|2426160_2427090_-	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	35.8	1.4e-14
WP_087607224.1|2427451_2428498_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_087607223.1|2428497_2428929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087607222.1|2429012_2430215_-	DUF932 domain-containing protein	NA	A0A1V0DX75	Synechococcus_virus	41.9	3.0e-73
WP_087608783.1|2430353_2432423_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_087607221.1|2432678_2433671_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	35.3	3.9e-23
WP_087607220.1|2433654_2434152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087607219.1|2434157_2435357_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_087607218.1|2435450_2437673_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_084149604.1|2437669_2438827_-	AAA family ATPase	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	35.1	2.3e-14
WP_087607217.1|2440711_2441602_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128106012.1|2441888_2442299_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_128106013.1|2442299_2442524_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_128106014.1|2442778_2443129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106015.1|2444384_2445008_+	phospholipase	NA	NA	NA	NA	NA
WP_086641002.1|2445019_2445934_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128106016.1|2445941_2446622_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_128106017.1|2446798_2447644_-	VOC family protein	NA	NA	NA	NA	NA
WP_086641004.1|2447647_2448217_-	YceI family protein	NA	NA	NA	NA	NA
WP_086641005.1|2448203_2448836_-	cytochrome b	NA	NA	NA	NA	NA
WP_128106018.1|2448840_2449455_-	YceI family protein	NA	NA	NA	NA	NA
WP_058988301.1|2449780_2450833_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_128106019.1|2451071_2452595_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_128106020.1|2452584_2453364_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.6	3.0e-34
WP_128106021.1|2453528_2455145_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_128106022.1|2455497_2456916_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_128106256.1|2457059_2457995_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_128106023.1|2459013_2460399_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_128106024.1|2460799_2461060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106025.1|2461154_2462459_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_128106026.1|2462458_2464615_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	1.0e-31
>prophage 168
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2467828	2468608	2744393		Enterobacteria_phage(100.0%)	1	NA	NA
WP_128106020.1|2467828_2468608_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.6	3.0e-34
>prophage 169
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2475173	2476142	2744393		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_128106032.1|2475173_2476142_-	carbon-nitrogen hydrolase family protein	NA	M1I5T1	Acanthocystis_turfacea_Chlorella_virus	25.1	1.7e-07
>prophage 170
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2487432	2488104	2744393		Pseudomonas_phage(100.0%)	1	NA	NA
WP_128106038.1|2487432_2488104_+	LexA family transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	28.2	1.1e-16
>prophage 171
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2496388	2498056	2744393		Rhizobium_phage(100.0%)	1	NA	NA
WP_128106258.1|2496388_2498056_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	34.9	3.3e-83
>prophage 172
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2503719	2504694	2744393		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_128106046.1|2503719_2504694_-	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	32.1	8.1e-29
>prophage 173
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2510033	2516310	2744393		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_128106259.1|2510033_2512898_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	53.2	5.4e-275
WP_128106050.1|2513014_2513380_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_050818600.1|2513425_2514562_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_128106260.1|2514859_2515732_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_014457515.1|2515842_2516310_-	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	41.7	2.1e-14
>prophage 174
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2520189	2524024	2744393		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_050818603.1|2520189_2520681_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	51.6	1.6e-33
WP_128106052.1|2520722_2521262_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	3.1e-30
WP_128106053.1|2521258_2524024_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.3	4.0e-97
>prophage 175
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2531078	2531864	2744393		Bacillus_virus(100.0%)	1	NA	NA
WP_128106055.1|2531078_2531864_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.1	5.9e-22
>prophage 176
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2542662	2544918	2744393		Bacillus_phage(100.0%)	1	NA	NA
WP_128106061.1|2542662_2544918_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.3	2.9e-29
>prophage 177
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2550083	2551571	2744393		Mollivirus(100.0%)	1	NA	NA
WP_087651594.1|2550083_2551571_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	4.3e-58
>prophage 178
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2557546	2558320	2744393		Oenococcus_phage(100.0%)	1	NA	NA
WP_128106069.1|2557546_2558320_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	30.8	3.8e-05
>prophage 179
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2566715	2568473	2744393		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_128106073.1|2566715_2568473_+	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.3	8.0e-35
>prophage 180
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2575081	2575912	2744393		Bacillus_virus(100.0%)	1	NA	NA
WP_003624643.1|2575081_2575912_-	phosphate ABC transporter ATP-binding protein PstB	NA	G3M9Y6	Bacillus_virus	27.9	5.1e-16
>prophage 181
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2583325	2584858	2744393	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_050820280.1|2583325_2584858_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	35.6	1.6e-23
>prophage 182
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2588843	2589752	2744393		Loktanella_phage(100.0%)	1	NA	NA
WP_050818649.1|2588843_2589752_-	FAD-dependent thymidylate synthase	NA	M4QT16	Loktanella_phage	55.6	1.2e-82
>prophage 183
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2596164	2601026	2744393		Yellowstone_lake_mimivirus(50.0%)	4	NA	NA
WP_128106089.1|2596164_2597310_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.6	3.1e-19
WP_050818658.1|2597438_2597891_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_128106090.1|2597895_2598360_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_128106091.1|2598356_2601026_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	27.1	2.5e-19
>prophage 184
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2604694	2605978	2744393	protease	Vibrio_phage(100.0%)	1	NA	NA
WP_128106093.1|2604694_2605978_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	27.4	2.4e-28
>prophage 185
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2609710	2614168	2744393		Cedratvirus(50.0%)	3	NA	NA
WP_128106096.1|2609710_2610472_-	amino acid ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.0	2.2e-18
WP_050818674.1|2610536_2613230_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_128106097.1|2613421_2614168_+	heme ABC exporter ATP-binding protein CcmA	NA	W5SAS9	Pithovirus	31.5	1.4e-12
>prophage 186
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2618407	2619001	2744393		Synechococcus_phage(100.0%)	1	NA	NA
WP_128106100.1|2618407_2619001_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	53.6	2.3e-18
>prophage 187
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2632543	2633830	2744393		Klosneuvirus(100.0%)	1	NA	NA
WP_050818700.1|2632543_2633830_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.1	1.3e-26
>prophage 188
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2638893	2640687	2744393		Bacillus_phage(100.0%)	1	NA	NA
WP_128106110.1|2638893_2640687_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	1.1e-31
>prophage 189
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2646717	2649336	2744393	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_128106116.1|2646717_2649336_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	37.3	2.7e-148
>prophage 190
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2667306	2668875	2744393		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_128106121.1|2667306_2668875_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	6.2e-23
>prophage 191
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2672170	2672728	2744393		Paracoccus_phage(100.0%)	1	NA	NA
WP_087651631.1|2672170_2672728_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	62.6	7.1e-38
>prophage 192
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2676586	2677855	2744393	tRNA	Serratia_phage(100.0%)	1	NA	NA
WP_128106128.1|2676586_2677855_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	35.6	7.2e-62
>prophage 193
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2682656	2690098	2744393		Enterobacteria_phage(75.0%)	6	NA	NA
WP_128106130.1|2682656_2683715_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.3	5.4e-95
WP_128106131.1|2683711_2684623_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	53.5	3.3e-85
WP_128106132.1|2684669_2685242_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.3	4.7e-37
WP_128106133.1|2685244_2686153_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_128106134.1|2686262_2687210_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_128106135.1|2687479_2690098_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.0	1.1e-80
>prophage 194
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2694136	2702830	2744393	tRNA	unidentified_phage(25.0%)	8	NA	NA
WP_128106139.1|2694136_2695300_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.1	1.5e-26
WP_128106140.1|2695308_2696493_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	24.5	5.9e-26
WP_003623374.1|2696940_2697606_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_128106141.1|2697674_2698445_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_167506902.1|2698441_2699812_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.5	7.6e-41
WP_128106142.1|2700068_2701406_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003623367.1|2701413_2702319_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_003623364.1|2702503_2702830_-	thioredoxin TrxA	NA	A0A1B0V6E5	Roseobacter_phage	34.7	2.5e-11
>prophage 195
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2710454	2715936	2744393		Roseobacter_phage(33.33%)	4	NA	NA
WP_128106146.1|2710454_2711237_+	response regulator transcription factor	NA	A0A0K0PVG9	Roseobacter_phage	47.1	1.3e-16
WP_128106147.1|2711398_2712757_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_167506879.1|2712889_2713924_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.9	2.0e-17
WP_128106149.1|2713998_2715936_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	47.0	6.1e-113
>prophage 196
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2723183	2724260	2744393		Bacillus_phage(100.0%)	1	NA	NA
WP_014457605.1|2723183_2724260_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.7	4.3e-07
>prophage 197
NZ_CP042808	Acetobacter oryzoeni strain B6 chromosome, complete genome	2744393	2736322	2739366	2744393		Yellowstone_lake_phycodnavirus(50.0%)	5	NA	NA
WP_050818878.1|2736322_2737237_-	J domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	30.5	4.3e-16
WP_003623324.1|2737233_2737404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050818882.1|2737685_2737988_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_050818884.1|2738044_2738545_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_128106157.1|2738544_2739366_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.0	1.2e-20
>prophage 1
NZ_CP042809	Acetobacter oryzoeni strain B6 plasmid unnamed1, complete sequence	246434	120988	189431	246434	integrase,transposase	uncultured_Caudovirales_phage(30.0%)	65	122686:122703	140641:140658
WP_061487123.1|120988_121426_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061487122.1|121422_121770_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	61.7	8.0e-32
122686:122703	attL	CTTGCGCCCCCAGCCGTG	NA	NA	NA	NA
WP_128106402.1|123878_124127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106333.1|124313_125732_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	27.5	2.5e-23
WP_128106334.1|125780_126347_-	hydrolase	NA	NA	NA	NA	NA
WP_128106158.1|126388_127446_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_128106335.1|127627_128284_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128106336.1|128466_129729_+	sodium:proton antiporter	NA	A0A2H4J428	uncultured_Caudovirales_phage	33.9	5.9e-16
WP_128106337.1|129834_130293_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128106403.1|130409_130778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106338.1|131054_132146_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_128106339.1|132257_133136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128106340.1|133424_134063_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	32.5	5.5e-10
WP_128106341.1|134112_134409_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_094755956.1|134405_134789_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_128106342.1|135266_135962_-	VIT family protein	NA	NA	NA	NA	NA
WP_128106404.1|136158_136725_+	cytochrome b	NA	NA	NA	NA	NA
WP_128106343.1|136875_138096_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_128106344.1|138801_141975_-	error-prone DNA polymerase	NA	A0A0K1Y8T6	Streptomyces_phage	28.0	3.5e-97
140641:140658	attR	CTTGCGCCCCCAGCCGTG	NA	NA	NA	NA
WP_128106405.1|141971_143486_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_128106345.1|143409_144204_-	damage-inducible protein	NA	NA	NA	NA	NA
WP_052051316.1|144488_145250_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_035379799.1|145249_145891_+	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	46.1	3.3e-39
WP_061487229.1|146018_147764_+	oleate hydratase	NA	NA	NA	NA	NA
WP_128106346.1|148233_149400_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_128106347.1|149560_150862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128106348.1|151095_151833_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_128106349.1|151835_155132_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.7	9.3e-61
WP_128106350.1|155163_155790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128106351.1|155711_156368_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_128106352.1|156357_157884_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.1	5.0e-86
WP_128106353.1|157918_158515_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_128106354.1|159174_159414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106355.1|159519_160158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106356.1|161441_162529_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	2.2e-43
WP_003626675.1|163154_163430_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_003618980.1|163471_164581_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	24.7	5.6e-10
WP_003618982.1|164640_165042_+	VOC family protein	NA	NA	NA	NA	NA
WP_075624153.1|165066_165894_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_086642061.1|166390_166732_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_035379786.1|166728_167025_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099540569.1|167341_168055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099540579.1|168265_168880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099540568.1|169228_169534_-	CcdB family protein	NA	NA	NA	NA	NA
WP_099540567.1|169534_169780_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_003618967.1|171112_171460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116100388.1|171560_172472_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_116100387.1|172512_173259_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.6	1.3e-05
WP_116100386.1|173408_174323_+	helix-turn-helix transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	31.6	6.7e-09
WP_003618947.1|174342_174825_-	DUF2938 family protein	NA	NA	NA	NA	NA
WP_099540562.1|174928_175381_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_128106357.1|175550_176630_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_116100384.1|177151_177577_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_063355034.1|177573_177816_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_061487123.1|178268_178706_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061487122.1|178702_179050_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	61.7	8.0e-32
WP_128106358.1|179115_180705_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.7	2.5e-104
WP_014095370.1|180972_182052_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	55.5	7.7e-81
WP_128106359.1|182060_182759_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.3	3.4e-82
WP_014095368.1|182782_184078_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.3	5.2e-132
WP_014095367.1|184077_184500_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	1.0e-49
WP_124298038.1|184496_184850_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167506903.1|185116_185299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010512305.1|185799_186414_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.7	2.1e-38
WP_099542122.1|186539_189431_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.9	3.3e-187
>prophage 1
NZ_CP042811	Acetobacter oryzoeni strain B6 plasmid unnamed3, complete sequence	29595	0	7274	29595	transposase	Stx2-converting_phage(50.0%)	5	NA	NA
WP_099542122.1|399_3291_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.9	3.3e-187
WP_128106493.1|3673_3931_-	mobilization protein	NA	NA	NA	NA	NA
WP_128106494.1|4896_6507_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	43.2	5.1e-113
WP_128106495.1|6570_6918_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	50.5	1.6e-24
WP_128106496.1|6914_7274_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	42.3	1.0e-05
>prophage 2
NZ_CP042811	Acetobacter oryzoeni strain B6 plasmid unnamed3, complete sequence	29595	12326	17339	29595		Erythrobacter_phage(33.33%)	5	NA	NA
WP_128106500.1|12326_12830_-	transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	49.2	1.3e-22
WP_128106501.1|12826_13435_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	49.1	1.5e-33
WP_128106502.1|13503_13743_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_128106513.1|13807_14101_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_128106503.1|14264_17339_+	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	26.7	2.4e-10
>prophage 3
NZ_CP042811	Acetobacter oryzoeni strain B6 plasmid unnamed3, complete sequence	29595	22620	27697	29595	integrase,transposase	uncultured_Caudovirales_phage(20.0%)	6	21765:21783	24914:24932
21765:21783	attL	ATATCAGCGATAGATGGCA	NA	NA	NA	NA
WP_070324342.1|22620_24090_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	23.7	2.6e-15
WP_062144550.1|24238_24832_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.8	5.4e-28
WP_128106508.1|24979_25597_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.9	4.6e-14
24914:24932	attR	TGCCATCTATCGCTGATAT	NA	NA	NA	NA
WP_128106509.1|25639_26275_+	AAA family ATPase	NA	A2I303	Vibrio_virus	29.8	8.4e-11
WP_062106156.1|26301_26553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128106510.1|26596_27697_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	39.9	1.1e-61
