The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	40295	51751	2156271		Synechococcus_phage(33.33%)	7	NA	NA
WP_000668280.1|40295_42449_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	8.0e-45
WP_000801620.1|42461_43811_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043300.1|43980_44688_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	39.2	1.8e-41
WP_000361192.1|44889_48615_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.6	2.8e-37
WP_000220648.1|48707_50150_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	2.8e-54
WP_000182575.1|50186_51209_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	1.2e-64
WP_000717501.1|51205_51751_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	9.7e-24
>prophage 2
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	84906	150052	2156271	integrase,tRNA,protease,bacteriocin	Streptococcus_phage(42.86%)	58	77252:77297	107021:107066
77252:77297	attL	GCTCAAAACACTGTTTTGAGGTTGCAGATAGAACTGACGAAGTCAG	NA	NA	NA	NA
WP_033705527.1|84906_86073_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	68.3	1.5e-151
WP_050456366.1|86341_86524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705176.1|88315_88864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705175.1|89241_89652_+	DUF722 domain-containing protein	NA	C5J954	Streptococcus_phage	37.8	3.3e-16
WP_033705174.1|90027_91221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172964100.1|91220_91388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148246.1|92730_92991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058099.1|92944_93166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714582.1|93484_94414_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_033705172.1|94427_95351_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000800407.1|95608_97084_+	DUF3502 domain-containing protein	NA	NA	NA	NA	NA
WP_001030029.1|97355_98342_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_033705171.1|98616_99477_+	DUF4299 domain-containing protein	NA	NA	NA	NA	NA
WP_033705170.1|99547_100612_-	membrane protein	NA	NA	NA	NA	NA
WP_001233684.1|100673_101585_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_000198688.1|101577_102171_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000273863.1|102157_102484_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000744892.1|102622_103789_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_033705169.1|103846_105004_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001035700.1|105045_106896_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	30.5	7.6e-28
WP_172964099.1|106920_107313_-	hypothetical protein	NA	NA	NA	NA	NA
107021:107066	attR	CTGACTTCGTCAGTTCTATCTGCAACCTCAAAACAGTGTTTTGAGC	NA	NA	NA	NA
WP_000200892.1|107470_108103_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000500038.1|108124_108997_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_000838912.1|109005_109677_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_033705661.1|109918_110506_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	55.6	2.3e-26
WP_001268172.1|110557_111421_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033705660.1|111886_114106_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.7	3.0e-39
WP_001096141.1|114098_114566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781023.1|114562_115915_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000424424.1|116060_116441_+|bacteriocin	SP_0115 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_001189286.1|116943_117264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012291603.1|118401_118614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001858829.1|119418_120477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705659.1|120790_121768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705658.1|122144_122519_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_033705657.1|122726_123629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424441.1|123684_124038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172964101.1|124034_124763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172964102.1|125897_126401_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	52.7	1.4e-45
WP_126432039.1|126686_128948_+	pneumococcal surface protein A	NA	NA	NA	NA	NA
WP_001862370.1|129349_130471_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193627.1|130611_131067_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_033705653.1|131076_132990_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_001862367.1|133184_134864_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000639577.1|134865_135099_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000974047.1|135916_136069_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
WP_000180803.1|136071_136257_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibA	bacteriocin	NA	NA	NA	NA
WP_033705651.1|136424_137108_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_033705650.1|137104_137542_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000655053.1|137531_138542_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_078064003.1|140594_140921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375707.1|142354_143230_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000288036.1|143324_144941_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	36.0	3.0e-28
WP_001290269.1|145200_145629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069855.1|145640_146390_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_033705649.1|147970_148834_+	MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033705648.1|149119_149353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738305.1|149374_150052_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	463616	511132	2156271	tRNA,protease,bacteriocin	Bacillus_phage(22.22%)	46	NA	NA
WP_000181374.1|463616_464120_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000185835.1|464572_465136_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000678707.1|465149_465776_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_033705413.1|465803_466220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418402.1|466556_467144_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_033705412.1|467533_469141_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.8	1.7e-140
WP_033705411.1|469699_471331_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_078376616.1|471623_476603_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001096742.1|476692_477889_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000119905.1|478024_478552_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000659547.1|478628_478985_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_001122906.1|479021_480368_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_078134659.1|480457_480577_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_000410533.1|480541_480691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067592.1|480834_480972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240090.1|482381_482990_-	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	30.1	3.9e-13
WP_000651177.1|483000_483798_-	tyrosine-type DNA invertase PsrA	NA	A0A0H4TI16	Erysipelothrix_phage	28.7	1.3e-21
WP_001845509.1|483854_484892_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_033705512.1|485404_486868_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000229090.1|486880_489214_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	27.9	5.8e-25
WP_001088689.1|489821_490331_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_000255779.1|490494_491529_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_000046031.1|491555_492080_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034662.1|492559_494383_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.2	1.3e-133
WP_000343113.1|494393_494798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066295.1|495141_496278_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.3	2.4e-24
WP_001808905.1|496611_496806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777753.1|496967_497255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705511.1|497264_497675_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	30.7	3.4e-05
WP_000889921.1|497742_498474_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	5.3e-25
WP_000653771.1|498470_499520_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132572.1|499687_500017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682133.1|500293_500632_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001219122.1|500636_501374_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000275285.1|501386_502727_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000358814.1|502771_502927_-	quorum-sensing system pheromone BlpC	NA	NA	NA	NA	NA
WP_033705510.1|502983_504345_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_078376619.1|504355_505999_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.2	5.3e-41
WP_000205166.1|505925_506513_-	peptidase C39	NA	NA	NA	NA	NA
WP_033705509.1|506872_507127_+|bacteriocin	two-peptide bacteriocin subunit BlpM	bacteriocin	NA	NA	NA	NA
WP_001099490.1|507142_507346_+|bacteriocin	two-peptide bacteriocin subunit BlpN	bacteriocin	NA	NA	NA	NA
WP_001809846.1|507589_507739_+|bacteriocin	bacteriocin-like peptide BlpO	bacteriocin	NA	NA	NA	NA
WP_000346296.1|507842_507962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705507.1|508429_508801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705506.1|510177_510411_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_033705505.1|510442_511132_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	813983	881242	2156271	bacteriocin,transposase,holin,tRNA,integrase,protease	Streptococcus_phage(52.63%)	57	824308:824336	827586:827614
WP_000530084.1|813983_815240_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
WP_033705332.1|815411_815846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705331.1|815983_817126_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_033705330.1|817134_818349_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001076714.1|818483_819308_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033705329.1|820081_821248_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001825037.1|823261_823804_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_033705328.1|823800_824919_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
824308:824336	attL	AAATCCCGATTTAACGAGATGTTTGGGGA	NA	NA	NA	NA
WP_000260605.1|824978_825215_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000158366.1|825211_825625_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_033705544.1|826651_827581_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.8e-33
WP_000466624.1|827603_828122_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
827586:827614	attR	AAATCCCGATTTAACGAGATGTTTGGGGA	NA	NA	NA	NA
WP_000526318.1|828151_831502_+	DEAD/DEAH box helicase family protein	NA	A0A2H4P9W3	Gordonia_phage	24.8	2.4e-11
WP_000530084.1|832131_833388_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
WP_001042995.1|833512_833983_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212037.1|833999_836273_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_033705398.1|836619_839721_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.5	1.3e-112
WP_000820852.1|839803_840811_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042809.1|840869_842375_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000749599.1|844181_845054_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_000420571.1|845686_845998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705395.1|846001_846718_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617845.1|846847_847663_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123614.1|847659_848565_-	permease	NA	NA	NA	NA	NA
WP_076742442.1|848906_849272_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001809527.1|849268_850273_+	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_000359137.1|850374_852504_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778576.1|852490_852940_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|852998_853271_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680766.1|853624_853816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705394.1|854243_855002_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
WP_000489404.1|855003_856992_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_165842651.1|857034_857679_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_001153814.1|857704_858580_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	8.0e-28
WP_000661011.1|859286_860762_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_033705392.1|861697_862558_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000088777.1|862554_863814_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001863222.1|863813_864941_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_033705391.1|864937_866023_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.5	2.0e-89
WP_001246755.1|866032_866908_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.1e-77
WP_000593576.1|867088_867898_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602452.1|868169_868391_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000745369.1|868444_869116_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001809535.1|869167_869365_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001025729.1|869357_870266_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	5.2e-06
WP_000745389.1|870262_870724_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403193.1|870713_871601_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_033705390.1|871603_873487_+|holin	phosphorylcholine esterase CbpE	holin	Q332B9	Clostridium_botulinum_C_phage	23.7	1.5e-10
WP_001844793.1|873566_874697_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.1e-114
WP_033705388.1|874706_875969_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	65.0	4.5e-141
WP_000689716.1|875972_876770_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	49.8	8.0e-59
WP_033705387.1|876989_877628_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	67.6	4.9e-75
WP_033705386.1|877624_878515_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	52.0	1.5e-74
WP_000358228.1|878551_878869_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166880.1|878871_879741_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	76.1	2.7e-116
WP_001261456.1|879967_880486_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345254.1|880594_881242_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	33.7	7.0e-13
>prophage 5
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	1068866	1092616	2156271	integrase	Streptococcus_phage(89.47%)	22	1077081:1077097	1093607:1093623
WP_033705457.1|1068866_1071680_+	CHAP domain-containing protein	NA	Q4Z9D9	Staphylococcus_phage	40.4	1.2e-08
WP_000420682.1|1072246_1072561_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|1072576_1072963_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000879507.1|1074378_1074531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001841741.1|1074553_1075972_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	99.0	6.3e-232
WP_001814874.1|1076020_1076104_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038795.1|1076228_1076966_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	3.1e-134
1077081:1077097	attL	TACGGGGAATTTGTATC	NA	NA	NA	NA
WP_001009056.1|1078649_1078871_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000342539.1|1078987_1079485_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_000506270.1|1079459_1079966_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000331160.1|1079949_1082397_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000804748.1|1082399_1084577_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_033705455.1|1084573_1085575_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	95.8	7.7e-184
WP_033705454.1|1085589_1086504_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	92.4	9.5e-157
WP_001814923.1|1086748_1086865_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691743.1|1086880_1088800_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	97.8	0.0e+00
WP_000336323.1|1088918_1089086_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|1089145_1089499_-	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000804885.1|1090003_1090426_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_000857133.1|1090422_1090653_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000814511.1|1091113_1091317_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_001291561.1|1091398_1092616_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
1093607:1093623	attR	TACGGGGAATTTGTATC	NA	NA	NA	NA
>prophage 6
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	1115590	1123595	2156271	integrase	Streptococcus_phage(87.5%)	10	1117360:1117374	1124358:1124372
WP_000492698.1|1115590_1116274_+	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	52.7	8.3e-65
WP_000118332.1|1116276_1117692_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	72.6	1.5e-201
1117360:1117374	attL	CAAATGAAAATTGAA	NA	NA	NA	NA
WP_000981955.1|1117688_1118054_+	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	45.5	3.0e-21
WP_001080184.1|1118043_1118334_+	hypothetical protein	NA	Q6DMX6	Streptococcus_phage	52.7	3.1e-21
WP_000827835.1|1118628_1118985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401236.1|1118989_1119355_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_000237134.1|1119341_1121171_+	relaxase/mobilization nuclease domain-containing protein	NA	A0A1B0RXG0	Streptococcus_phage	37.5	3.6e-06
WP_000919632.1|1121274_1121502_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	46.9	1.0e-06
WP_001022845.1|1121768_1122002_+	hypothetical protein	NA	W6LM55	Streptococcus_phage	50.7	4.6e-15
WP_000291923.1|1122086_1123595_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	27.6	8.4e-25
1124358:1124372	attR	CAAATGAAAATTGAA	NA	NA	NA	NA
>prophage 7
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	1172345	1238675	2156271	bacteriocin,holin,transposase,tRNA,protease	Bacillus_phage(17.65%)	60	NA	NA
WP_000530084.1|1172345_1173602_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
WP_033705352.1|1173651_1173954_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001013256.1|1174214_1175093_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_001002635.1|1175102_1176377_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_000200428.1|1176472_1177066_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_001231016.1|1177066_1177588_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_000128188.1|1177609_1177732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000625732.1|1177879_1178677_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_000078847.1|1178920_1179664_-	sortase SrtA	NA	NA	NA	NA	NA
WP_033705351.1|1179663_1182132_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.5	2.1e-105
WP_000204727.1|1182325_1183312_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001143843.1|1183609_1186864_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000150984.1|1187028_1188915_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1V0SF91	Hokovirus	23.7	1.1e-10
WP_001812387.1|1188989_1189244_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000208080.1|1189245_1189488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289493.1|1189578_1190388_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	39.0	1.8e-34
WP_000886210.1|1190389_1191739_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.6	1.8e-34
WP_000722076.1|1191731_1192436_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	2.8e-39
WP_000886147.1|1192490_1193666_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000845290.1|1193994_1195665_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_000699488.1|1195894_1196584_+	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_001284128.1|1196595_1197147_+	phosphopantothenoylcysteine decarboxylase	NA	A0A068EHP1	Penguinpox_virus	37.6	3.1e-25
WP_000747408.1|1197130_1197694_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001097389.1|1197975_1198503_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000159185.1|1198514_1199030_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000085593.1|1199026_1199494_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000216012.1|1199566_1200055_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000639842.1|1200020_1200584_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000607027.1|1200593_1202582_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_033705350.1|1202658_1203612_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_033705349.1|1203784_1205950_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001096313.1|1205949_1206690_+	amino acid ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.3	2.8e-18
WP_033705348.1|1206838_1208326_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	32.8	1.9e-69
WP_000522311.1|1208371_1209661_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000763458.1|1209664_1210483_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000153023.1|1210482_1211277_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_033705347.1|1211273_1214813_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_000661498.1|1214803_1215502_-	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	33.8	3.9e-25
WP_000931178.1|1215819_1216806_-	GMP reductase	NA	G3MBI2	Bacillus_virus	72.2	1.1e-137
WP_001813445.1|1216980_1218297_-	McrC family protein	NA	NA	NA	NA	NA
WP_033705346.1|1218283_1220215_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.7	1.8e-16
WP_001810980.1|1220378_1220540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199865.1|1220800_1220944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001811821.1|1221162_1221522_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_000762426.1|1221525_1221795_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_001010962.1|1222840_1223935_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_000461588.1|1223953_1224610_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000638789.1|1224653_1225286_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001220357.1|1225378_1225738_-	YbaN family protein	NA	NA	NA	NA	NA
WP_000179635.1|1225958_1228046_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.6	3.0e-105
WP_001812957.1|1228212_1229256_-	TIGR00341 family protein	NA	NA	NA	NA	NA
WP_033705344.1|1230094_1230943_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.5	2.5e-34
WP_000643970.1|1231038_1231728_-	NTP transferase domain-containing protein	NA	A0A127AW70	Bacillus_phage	45.0	3.4e-05
WP_000837609.1|1231739_1232618_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033705343.1|1232607_1233477_-|holin	choline kinase LicA	holin	NA	NA	NA	NA
WP_000609885.1|1233493_1234516_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_033705342.1|1234520_1235228_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835915.1|1235563_1237051_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000811874.1|1237060_1237864_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	5.3e-10
WP_001199652.1|1237865_1238675_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	30.3	9.1e-10
>prophage 8
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	1366876	1423520	2156271	holin,tRNA,transposase	Streptococcus_phage(25.0%)	52	NA	NA
WP_000436246.1|1366876_1368133_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	100.0	3.6e-239
WP_001809119.1|1368240_1368552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705574.1|1368566_1369853_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.1	2.1e-40
WP_001810460.1|1370476_1370626_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_078376104.1|1370668_1371022_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_033705573.1|1371029_1372220_+	site-specific DNA-methyltransferase	NA	S0A0D5	Cellulophaga_phage	38.4	5.4e-43
WP_000122904.1|1372734_1373727_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033705572.1|1373886_1375641_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.1e-23
WP_033705571.1|1375624_1377346_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	8.4e-29
WP_033705540.1|1378813_1379509_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_033705541.1|1379496_1380861_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.6e-12
WP_061766759.1|1382197_1383454_+|transposase	ISL3-like element IS1167A family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	99.3	3.4e-237
WP_033705434.1|1383539_1385102_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936200.1|1385243_1385942_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071672.1|1385984_1386881_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872215.1|1386889_1387825_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102211.1|1387821_1388547_-	proteinase	NA	NA	NA	NA	NA
WP_033705433.1|1388630_1389266_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	28.7	6.7e-08
WP_000972916.1|1389267_1390095_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001272961.1|1391694_1392306_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_000855753.1|1392350_1393079_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272306.1|1393117_1394029_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.8	4.5e-90
WP_000926599.1|1394094_1394319_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590970.1|1394396_1395140_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.7e-29
WP_001103449.1|1395139_1395940_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1396097_1396454_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170347.1|1396447_1396978_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405859.1|1396977_1397472_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.8	8.5e-43
WP_000858735.1|1397606_1398053_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097986.1|1398049_1398697_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689945.1|1398717_1399299_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1399299_1400175_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036784.1|1400326_1401706_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_126432080.1|1401999_1402923_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915924.1|1402982_1403588_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.2	7.7e-54
WP_000673694.1|1403606_1404851_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.7	1.7e-55
WP_000371291.1|1405073_1405331_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_033705432.1|1405372_1407409_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038736.1|1407620_1408538_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_012677106.1|1408732_1409059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001846081.1|1409025_1409310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099664.1|1409582_1410425_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.3e-51
WP_050100548.1|1410538_1411930_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000915885.1|1412756_1413734_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_033705429.1|1413730_1414813_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.1	1.8e-37
WP_001040724.1|1417169_1418366_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.6	7.3e-32
WP_000348122.1|1419276_1420146_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_000248996.1|1420368_1420890_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000935666.1|1422062_1422317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705262.1|1422674_1423208_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001808732.1|1423194_1423410_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001815446.1|1423376_1423520_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	1495390	1504632	2156271	protease,transposase	Streptococcus_phage(57.14%)	10	NA	NA
WP_033705283.1|1495390_1496359_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	100.0	2.8e-66
WP_033705285.1|1496392_1497304_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	99.7	2.0e-154
WP_001231086.1|1497300_1498278_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	100.0	1.2e-184
WP_000163033.1|1498274_1499165_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	3.9e-06
WP_001140412.1|1499216_1499597_-	RidA family protein	NA	NA	NA	NA	NA
WP_033705287.1|1499607_1500195_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_001863391.1|1500203_1501436_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	9.3e-131
WP_001864547.1|1501637_1502144_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	42.5	3.0e-27
WP_000229874.1|1502273_1502792_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_000530084.1|1503375_1504632_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
>prophage 10
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	1763821	1771153	2156271		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_000167833.1|1763821_1764523_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.1	4.6e-34
WP_000777248.1|1764945_1765905_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	4.0e-57
WP_001193674.1|1765894_1766851_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000764303.1|1766847_1767600_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	5.6e-14
WP_000858245.1|1767695_1768661_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000821640.1|1768885_1769128_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.4	1.3e-17
WP_033705150.1|1769127_1769850_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000105310.1|1769836_1770406_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	5.0e-15
WP_000351912.1|1770424_1771153_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.3	6.9e-09
>prophage 11
NZ_AP019192	Streptococcus pneumoniae strain ASP0581	2156271	2134027	2142781	2156271		Bacillus_phage(33.33%)	9	NA	NA
WP_000510412.1|2134027_2134867_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.6	1.1e-15
WP_033705083.1|2134851_2135679_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.8	1.0e-16
WP_000712132.1|2135675_2136221_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2136231_2137053_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170195.1|2137094_2138378_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	30.0	1.1e-17
WP_000424263.1|2138374_2139625_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.3	3.5e-93
WP_000455903.1|2139783_2140152_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266660.1|2140154_2141252_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_033705082.1|2141302_2142781_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.3	4.9e-94
