The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	828737	859960	4576669	transposase	Escherichia_phage(60.0%)	19	NA	NA
WP_139535873.1|828737_829718_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_000019440.1|830067_831048_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000107596.1|831572_832361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125400686.1|832799_833910_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_125400687.1|833996_834245_-	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_139535862.1|834289_835270_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.6e-184
WP_125401200.1|835378_835795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139535874.1|842293_843445_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_050010557.1|843945_846672_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_077779087.1|847212_849552_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_125400556.1|850290_851373_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_050010559.1|851408_852188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050010560.1|852433_853723_-	porin	NA	NA	NA	NA	NA
WP_077779088.1|853862_854042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050010561.1|854919_855225_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_050010566.1|855244_856579_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_125400555.1|856617_857997_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_050010567.1|858007_858319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118645.1|859036_859960_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
>prophage 2
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	1294151	1354528	4576669	tRNA,transposase,protease	Escherichia_phage(14.29%)	59	NA	NA
WP_085948316.1|1294151_1295425_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000089743.1|1295826_1296237_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_000771860.1|1296435_1297242_-	ribonuclease I	NA	NA	NA	NA	NA
WP_000955044.1|1297476_1298847_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000237131.1|1299288_1299873_+	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
WP_000034825.1|1300058_1300268_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_038989254.1|1300436_1300871_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000939755.1|1300951_1301335_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	2.6e-23
WP_000959103.1|1301426_1302215_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_000503935.1|1302343_1302547_+	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_000042647.1|1302660_1303626_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000284048.1|1303804_1304455_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_000850550.1|1304555_1304819_-	YbeD family protein	NA	NA	NA	NA	NA
WP_000858708.1|1304924_1306136_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.2	3.6e-103
WP_125401098.1|1306276_1307365_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	54.8	1.6e-09
WP_024256918.1|1307375_1308488_-	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_000776205.1|1308490_1310392_-	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_000776098.1|1310422_1310890_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_001161671.1|1310893_1311211_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_000838875.1|1311469_1312111_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_000620558.1|1312114_1313146_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_125401097.1|1313145_1313709_-	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_104918503.1|1313723_1316306_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	4.0e-184
WP_001044880.1|1316540_1317023_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_000019440.1|1318457_1319438_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_125401049.1|1319483_1319912_-	Hsp70 family protein	NA	A0A2P1ELQ7	Moumouvirus	34.2	2.0e-16
WP_001207494.1|1319995_1320931_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1321048_1321774_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_000272805.1|1321773_1322448_-	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000020941.1|1322447_1323188_-	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_001309342.1|1323357_1324266_-	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_104918502.1|1324721_1326599_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_125401048.1|1326730_1328269_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_001278605.1|1328293_1329172_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_000084469.1|1329261_1329729_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_000490838.1|1329725_1330805_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
WP_000162740.1|1330918_1332343_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_104918501.1|1332488_1333664_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_001109104.1|1333670_1334255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046076542.1|1335398_1335836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000337080.1|1335877_1337542_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	7.9e-85
WP_001548310.1|1337798_1338551_-	ribonucleotide monophosphatase NagD	NA	NA	NA	NA	NA
WP_000187590.1|1338598_1339819_-	DNA-binding transcriptional regulator NagC	NA	NA	NA	NA	NA
WP_000271141.1|1339827_1340976_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_001237072.1|1341034_1341835_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_125401047.1|1342167_1344114_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	2.0e-07
WP_125401046.1|1344316_1345981_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_125401045.1|1345931_1346120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258839.1|1346431_1347838_+	chitoporin	NA	NA	NA	NA	NA
WP_000733595.1|1347887_1348214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131702.1|1348297_1348744_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_001406816.1|1348736_1348823_-	fur leader peptide	NA	NA	NA	NA	NA
WP_001018618.1|1349032_1349563_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_001300829.1|1349702_1349996_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_125401044.1|1350135_1350900_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	3.7e-05
WP_002431422.1|1351084_1351630_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001297249.1|1351655_1353296_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_038989254.1|1353463_1353898_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_038989254.1|1354093_1354528_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	1549465	1558923	4576669		Enterobacteria_phage(85.71%)	10	NA	NA
WP_046080770.1|1549465_1550392_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	2.2e-23
WP_125401065.1|1550396_1551128_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1551108_1551216_-	protein YohO	NA	NA	NA	NA	NA
WP_001240384.1|1551275_1552007_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	97.0	2.0e-109
WP_002431447.1|1552228_1553914_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	93.8	3.3e-288
WP_125401064.1|1553910_1554630_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002431448.1|1554676_1555147_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	4.0e-82
WP_000643203.1|1555189_1555648_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	2.4e-52
WP_125401063.1|1555774_1557790_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	89.3	0.0e+00
WP_125401062.1|1557786_1558923_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	2.2e-163
>prophage 4
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	1686536	1761412	4576669	plate,portal,head,integrase,holin,transposase,tail,protease,capsid,terminase	Enterobacteria_phage(33.85%)	107	1686410:1686469	1723798:1724435
1686410:1686469	attL	TTTTTATTGTTATCCCTAAACCACCTCCTAGGGAGGTGGTGATTGATCCTGTAAGGCTAT	NA	NA	NA	NA
WP_038989254.1|1686536_1686971_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_125400491.1|1687167_1688202_+	transport protein YeeE	NA	NA	NA	NA	NA
WP_000985273.1|1688239_1688467_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_125400490.1|1688509_1689934_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001007947.1|1690115_1691294_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1691274_1691466_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_000545724.1|1691496_1691664_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	94.5	5.4e-26
WP_125400489.1|1691699_1691999_-	hypothetical protein	NA	G9L655	Escherichia_phage	97.0	1.1e-50
WP_125400488.1|1692086_1692368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125400487.1|1692482_1693067_-	DUF551 domain-containing protein	NA	I6R0R2	Salmonella_phage	43.5	9.7e-46
WP_125400486.1|1693068_1693731_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	63.4	3.4e-79
WP_069897485.1|1693727_1694294_-	HNH endonuclease	NA	C6ZR32	Salmonella_phage	89.2	5.4e-94
WP_001214456.1|1694425_1694590_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_001111335.1|1694600_1694894_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	3.2e-50
WP_001535902.1|1694917_1695505_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	8.4e-106
WP_015966849.1|1695501_1696182_-	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	100.0	5.8e-127
WP_000613346.1|1696190_1696379_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_015966850.1|1696375_1696489_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	100.0	2.7e-13
WP_001198858.1|1696481_1696622_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_097409331.1|1696812_1697283_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	96.8	6.5e-85
WP_100008766.1|1697539_1697812_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
WP_074459702.1|1697789_1697921_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	95.3	2.7e-17
WP_097409342.1|1697892_1698078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528776.1|1698235_1699012_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_097409329.1|1698999_1699542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250473.1|1699639_1700347_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1700425_1700653_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000189606.1|1700791_1701088_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_000166207.1|1701120_1701267_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000067065.1|1701259_1702120_+	replication protein	NA	K7PL20	Enterobacteria_phage	100.0	3.0e-160
WP_125400485.1|1702227_1704108_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.4	0.0e+00
WP_000736903.1|1704185_1704626_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_125400484.1|1704622_1705168_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	6.4e-100
WP_001254251.1|1706587_1706770_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_029396171.1|1706766_1706937_+	protein ninF	NA	K7P6X0	Enterobacteria_phage	98.2	1.2e-25
WP_125401193.1|1706929_1707652_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	98.8	1.3e-129
WP_000247766.1|1707651_1707942_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	96.9	1.2e-49
WP_001008180.1|1707938_1708301_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1708297_1708486_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235461.1|1708482_1709106_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_125401194.1|1709246_1709429_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	88.1	1.1e-21
WP_000783734.1|1709539_1709863_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_047400067.1|1709846_1710323_+	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	98.7	8.3e-88
WP_125401189.1|1710306_1710699_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	94.6	2.3e-59
WP_125401190.1|1710583_1710856_+	peptidase	NA	Q8SBD8	Shigella_phage	95.6	8.2e-40
WP_125401191.1|1710882_1711233_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	2.2e-61
WP_000929187.1|1711358_1711853_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	2.5e-87
WP_125401195.1|1712086_1713583_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	4.1e-298
WP_000605606.1|1713594_1713777_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|1713776_1715018_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_053895080.1|1714995_1715646_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000257492.1|1715660_1716866_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000601360.1|1716915_1717116_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|1717118_1717442_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702401.1|1717438_1717849_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000224838.1|1717823_1718330_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	2.9e-83
WP_001569335.1|1718326_1718887_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497753.1|1718895_1719066_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_125401192.1|1719049_1720546_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	98.4	4.8e-275
WP_000090998.1|1720545_1720902_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000571712.1|1720898_1721222_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	100.0	6.5e-52
WP_097758328.1|1721306_1723208_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.4	0.0e+00
WP_000738065.1|1723272_1723761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038989254.1|1723924_1724359_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_125400883.1|1724447_1725821_+	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.0	1.2e-243
1723798:1724435	attR	TTTTTATTGTTATCCCTAAACCACCTCCTAGGGAGGTGGTGATTGATCCTGTAAGGCTATAGCCTGAAGAATGCCCATGTCGGAATATCTCTGCTTACTCACCACAAGTAAAAGGAGACAAACTGACATGGGGCTTTACAGAAGTTCATCACATGTATATTGGCGTTGCAAATATCACATAGTCTGGACGCCAAAGTACCGTTTTAGGATCCTGAGGGATAAATTGGGCAAGGAGCTGTACAGAACCATCTATATTCTTTGCGGAATAAAAGATTGCGAGGTTCTGGAGTTAAATGTACAGCCAGATCATGTGCATCTTGTCGTAATAGTGCCGCCAAAAATCTCAATATCTACTCTGATGGGGCACCTGAAAGGTCGCAGTGCAATTAGGCTCTACAATCGATTCCCGCATATCAGGAAGAAGTTATGGGGAAACCATTTTTGGTCGCGGGGTTACTTTGTCGATACGGTAGGCGTGAACGAAGAAATTATCAGACGATATGTGAGGCATCAGGAAAAGATGGAACAAACACATGAACAGCAGATGGAGTTGCTAGAGTAGAAAACGGAATATGACATTTGCCCCCCTTATAGGGGGCATTCTGAAAAGCCACCTCCTCAGGAGGTGGTCTTTTACT	NA	NA	NA	NA
WP_125400882.1|1725817_1726897_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	1.2e-206
WP_001259088.1|1726896_1727445_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_125400886.1|1727444_1727870_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	5.2e-81
WP_125400881.1|1727856_1728915_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	1.5e-198
WP_125400880.1|1728905_1729490_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	4.1e-113
WP_125400885.1|1729760_1730759_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	62.9	1.6e-117
WP_125400879.1|1730761_1731184_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	50.7	2.8e-31
WP_125400878.1|1731375_1731507_+	umuD domain protein	NA	O64339	Escherichia_phage	66.7	3.6e-09
WP_125400877.1|1731873_1732341_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200864.1|1732447_1733506_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000449651.1|1733673_1734009_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_000018486.1|1734116_1735331_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_024256479.1|1735320_1735767_-	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_000431410.1|1735771_1736122_-	propanediol utilization microcompartment protein PduU	NA	NA	NA	NA	NA
WP_000075780.1|1736121_1736676_-	propanediol utilization microcompartment protein PduT	NA	NA	NA	NA	NA
WP_125400876.1|1736678_1738019_-	electron transport complex protein RnfC	NA	NA	NA	NA	NA
WP_125400875.1|1738015_1739128_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001097320.1|1739138_1740521_-	CoA-acylating propionaldehyde dehydrogenase PduP	NA	NA	NA	NA	NA
WP_125400874.1|1740517_1741525_-	two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO	NA	NA	NA	NA	NA
WP_125400873.1|1741535_1741811_-	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
WP_125400872.1|1741814_1742306_-	microcompartment protein PduM	NA	NA	NA	NA	NA
WP_000360798.1|1742302_1742935_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_000814169.1|1742934_1743369_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001057752.1|1743394_1743670_-	propanediol utilization microcompartment protein PduJ	NA	NA	NA	NA	NA
WP_125400871.1|1743689_1744040_-	propanediol dehydratase	NA	NA	NA	NA	NA
WP_125400870.1|1744029_1745862_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_001090594.1|1745872_1746397_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
WP_000405059.1|1746411_1747074_-	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
WP_125400869.1|1747084_1748749_-	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
WP_125400868.1|1748767_1749577_-	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_015953494.1|1749573_1749858_-	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_024256672.1|1750361_1751153_+	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.0	1.9e-12
WP_125400867.1|1751347_1752265_+	regulatory protein PocR	NA	NA	NA	NA	NA
WP_105223494.1|1752763_1753249_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_000621210.1|1753475_1754402_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000481836.1|1754468_1754798_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000095888.1|1754813_1755215_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_125400866.1|1755247_1755913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564322.1|1755924_1756545_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_046080818.1|1756541_1757015_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_125400865.1|1757026_1757974_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_125400864.1|1758025_1761412_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 5
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	1784556	1842316	4576669	plate,tRNA,transposase	uncultured_Caudovirales_phage(16.67%)	41	NA	NA
WP_038989254.1|1784556_1784991_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_046077395.1|1787039_1787201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000889443.1|1787326_1787587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160804.1|1792157_1792619_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_125400481.1|1792646_1794545_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	40.9	2.0e-23
WP_001142958.1|1794754_1795273_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002432281.1|1795865_1796465_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000058010.1|1796479_1797961_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_125400480.1|1797963_1798401_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_125400479.1|1798406_1800239_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_125400478.1|1800202_1801240_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_125400477.1|1801263_1802496_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_125400483.1|1802576_1803080_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_125400476.1|1803082_1804438_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046083390.1|1804496_1805240_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_125400475.1|1805248_1807975_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	6.5e-84
WP_125400474.1|1807971_1808715_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_024256676.1|1808711_1810151_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_125400482.1|1810259_1813646_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_125400473.1|1813656_1815015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284966.1|1815032_1815512_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_125400472.1|1815726_1816398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104917402.1|1816397_1816847_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_125400471.1|1816851_1817223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125282644.1|1817635_1818094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998326.1|1818105_1818426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125400470.1|1819068_1819290_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.0	1.5e-12
WP_125401075.1|1820985_1821846_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_125401074.1|1821854_1824278_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_125401073.1|1824826_1826218_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.8	2.4e-18
WP_125401072.1|1826557_1828087_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000092920.1|1828450_1829785_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_002431488.1|1829864_1832012_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856807.1|1832070_1833528_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	30.4	1.8e-48
WP_000003789.1|1833796_1835314_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.1	1.3e-86
WP_125401076.1|1835564_1836881_-	guanine deaminase	NA	NA	NA	NA	NA
WP_000353197.1|1838886_1839825_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_000283681.1|1839911_1840649_+	phosphatase	NA	NA	NA	NA	NA
WP_125401071.1|1840672_1841227_+	molecular chaperone	NA	NA	NA	NA	NA
WP_024256467.1|1841327_1841810_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_038989254.1|1841881_1842316_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	2372143	2417735	4576669	plate,tRNA,portal,integrase,holin,tail,head,capsid,terminase	Enterobacteria_phage(77.78%)	55	2374478:2374502	2410376:2410400
WP_001234797.1|2372143_2372608_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.2	9.5e-12
WP_125400424.1|2372685_2373435_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	29.7	1.2e-08
WP_000954971.1|2373438_2374419_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2374478:2374502	attL	AAAGAAAAAAGGCCGCAAAGCGGCC	NA	NA	NA	NA
WP_001434769.1|2374611_2375049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097234299.1|2375527_2376481_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	1.3e-79
WP_000904671.1|2376569_2376878_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001151410.1|2376974_2377253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125400423.1|2377267_2377606_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	3.7e-50
WP_000588758.1|2377616_2377895_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	9.9e-33
WP_000514277.1|2377906_2378149_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|2378145_2378259_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000985152.1|2378345_2378549_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000091213.1|2378545_2378764_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
WP_001545551.1|2378872_2379262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125400422.1|2379258_2382099_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.1	0.0e+00
WP_000686524.1|2382175_2383135_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_000211252.1|2383139_2383451_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	91.3	1.5e-45
WP_000885991.1|2384100_2385300_-	hypothetical protein	NA	A0A0P0IKU8	Acinetobacter_phage	33.2	2.3e-54
WP_000087812.1|2385836_2386883_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_125400421.1|2386882_2388634_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_125400420.1|2388788_2389625_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.2	6.2e-147
WP_001055104.1|2389648_2390701_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632355.1|2390746_2391547_+|terminase	terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	87.2	1.3e-122
WP_000063074.1|2391649_2392144_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_000864901.1|2392143_2392344_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2392346_2392670_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_125400419.1|2392666_2393059_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.2e-70
WP_125400418.1|2393055_2393463_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	3.8e-65
WP_033552265.1|2393600_2394068_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
WP_125400417.1|2394060_2394696_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_125400416.1|2394692_2395274_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.1e-102
WP_125400415.1|2395270_2395621_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	1.6e-59
WP_105284235.1|2395624_2396521_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	3.7e-153
WP_125400414.1|2396513_2397044_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	96.9	1.1e-91
WP_125400413.1|2397046_2399005_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	95.3	9.3e-109
WP_125400412.1|2399901_2400480_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.4	3.2e-65
WP_105283738.1|2400507_2401242_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	36.7	2.8e-34
WP_123059585.1|2401564_2402053_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	96.9	2.8e-83
WP_125400411.1|2402065_2404873_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_000333503.1|2404859_2405015_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651582.1|2405023_2405398_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	74.0	3.1e-37
WP_000290462.1|2405453_2405966_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005386.1|2405965_2407150_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_097751386.1|2407307_2408417_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	5.3e-194
WP_000604994.1|2408539_2409325_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|2409520_2409781_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2409971_2410112_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2410417_2410717_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2410376:2410400	attR	AAAGAAAAAAGGCCGCAAAGCGGCC	NA	NA	NA	NA
WP_125400410.1|2410721_2413109_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2413123_2414107_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2414390_2414435_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2414557_2414914_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2414966_2415164_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2415260_2415803_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144186.1|2415806_2417735_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	8.0e-129
>prophage 7
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	2613750	2652920	4576669	transposase,coat	Escherichia_phage(22.22%)	38	NA	NA
WP_125399655.1|2613750_2614458_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054626932.1|2614483_2614687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125399656.1|2614801_2616850_+	tape measure protein	NA	A0A1B1PD82	Escherichia_phage	26.7	2.4e-46
WP_125399657.1|2617007_2617781_+	hypothetical protein	NA	A0A0F6TIY9	Escherichia_coli_O157_typing_phage	77.2	4.2e-89
WP_125399658.1|2617800_2619444_-	recombinase family protein	NA	A0A142LP20	Marinitoga_camini_virus	24.3	2.9e-07
WP_125399659.1|2619495_2620101_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|2620121_2620349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104919642.1|2620442_2621684_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001285183.1|2621833_2623267_-	gluconate:proton symporter	NA	NA	NA	NA	NA
WP_000019440.1|2623425_2624406_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000776567.1|2624738_2625653_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125401015.1|2625703_2626957_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_125401016.1|2626953_2627310_+	RidA family protein	NA	NA	NA	NA	NA
WP_000420612.1|2627512_2628433_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024555.1|2628432_2628738_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000983596.1|2628783_2629428_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763853.1|2629435_2629825_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.0	2.0e-07
WP_000036402.1|2629839_2630889_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_000204372.1|2630885_2631752_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_125401017.1|2631771_2633337_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.6	1.2e-10
WP_125401018.1|2633396_2634356_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_125401019.1|2634352_2636740_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_125401020.1|2636715_2637462_-	molecular chaperone	NA	NA	NA	NA	NA
WP_125401027.1|2637474_2637948_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_125401021.1|2638026_2638596_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_001098482.1|2638865_2639360_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_072274242.1|2639376_2641332_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000796096.1|2641336_2642251_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000905460.1|2642247_2643135_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291584.1|2643259_2643838_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_002431607.1|2643840_2644191_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000332011.1|2645008_2645437_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089023.1|2645443_2646868_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000165652.1|2646842_2647646_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100214.1|2647799_2648786_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002432082.1|2648800_2650315_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	6.7e-14
WP_125401022.1|2650409_2651399_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_125401023.1|2651783_2652920_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	3773458	3848890	4576669	tRNA,portal,integrase,transposase,holin,tail,protease,terminase	Enterobacteria_phage(41.18%)	89	3774152:3774166	3849084:3849098
WP_001241205.1|3773458_3774145_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
3774152:3774166	attL	GCTCTTTTACTCTTT	NA	NA	NA	NA
WP_001541509.1|3774542_3774683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3774778_3775495_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_038989254.1|3775666_3776101_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_125399709.1|3776190_3777549_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219550.1|3777606_3779031_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_001188059.1|3779030_3779720_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_000875492.1|3779732_3780206_-	protein CreA	NA	NA	NA	NA	NA
WP_000371663.1|3780416_3781286_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942353.1|3781282_3781930_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_022646480.1|3781981_3782497_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068678.1|3782490_3782817_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409424.1|3782906_3784844_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	6.1e-12
WP_000046749.1|3785054_3786722_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000007436.1|3786777_3787062_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000093833.1|3787095_3788328_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|3788348_3789731_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132947.1|3789779_3790748_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|3790853_3791498_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105851.1|3791525_3792542_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_125399708.1|3792573_3792837_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224875.1|3792997_3793717_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3793773_3794997_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477829.1|3795048_3796371_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
WP_001295412.1|3796448_3797228_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_125399707.1|3797485_3799036_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_125399706.1|3799007_3799871_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_125399705.1|3800001_3800784_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002431697.1|3800780_3801854_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3801975_3802137_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|3802263_3802869_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|3803261_3804848_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|3805067_3805316_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001372053.1|3805742_3805856_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836769.1|3805924_3806158_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086527.1|3806537_3807128_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_104917277.1|3807225_3807801_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_125399711.1|3807800_3808763_-|tail	tail fiber protein	tail	A0A0E3GML4	Enterobacteria_phage	67.3	1.2e-45
WP_001233185.1|3811035_3811635_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	89.9	1.1e-100
WP_125282553.1|3811546_3811771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104918139.1|3811702_3815191_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.5	0.0e+00
WP_000090917.1|3815250_3815883_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_125399704.1|3815819_3816563_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.1e-150
WP_001152389.1|3816568_3817267_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	3.0e-134
WP_000447253.1|3817276_3817606_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_125399703.1|3817605_3820671_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3820642_3820972_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3820980_3821367_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211109.1|3821427_3822171_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_000677106.1|3822567_3823146_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|3823157_3823433_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3823425_3823749_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_125399702.1|3823835_3825863_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_015953980.1|3825807_3827388_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|3827315_3827528_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934084.1|3827524_3829627_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.0	0.0e+00
WP_125399701.1|3829626_3830118_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.0	9.5e-71
WP_032243018.1|3830107_3830386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548593.1|3830670_3830877_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_024256583.1|3831172_3831346_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|3831518_3831674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|3831820_3832009_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3832019_3832232_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|3832595_3833093_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101174.1|3833089_3833623_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	3.2e-96
WP_001306174.1|3833736_3833997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189905.1|3833944_3834496_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.9e-35
WP_000839581.1|3834500_3834716_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066482.1|3835468_3835684_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000087756.1|3835986_3836199_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001047084.1|3836614_3837367_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_016230662.1|3837380_3838370_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_125399700.1|3838377_3839175_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	6.4e-149
WP_125399699.1|3839194_3839584_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210160.1|3839580_3839907_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	1.0e-52
WP_015953975.1|3839906_3840401_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	1.1e-85
WP_000104941.1|3840397_3841339_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_001250269.1|3841328_3841508_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_048814586.1|3841683_3842235_-	hypothetical protein	NA	S5FXP0	Shigella_phage	96.7	4.2e-99
WP_000205495.1|3842272_3842473_-	cell division protein	NA	NA	NA	NA	NA
WP_000450739.1|3842571_3843198_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559922.1|3843425_3843941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135674.1|3844443_3844806_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.1e-60
WP_000081304.1|3844871_3845696_+	YfdQ family protein	NA	U5P439	Shigella_phage	98.9	9.5e-148
WP_000008231.1|3845824_3846361_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.3e-99
WP_024195021.1|3846395_3846590_+	hypothetical protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
WP_071821821.1|3846595_3846871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|3847073_3847406_+	protein flxA	NA	NA	NA	NA	NA
WP_001218281.1|3847666_3848890_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.0	9.5e-237
3849084:3849098	attR	AAAGAGTAAAAGAGC	NA	NA	NA	NA
>prophage 9
NZ_CP040805	Escherichia fergusonii strain EFCF056 chromosome, complete genome	4576669	4286312	4338017	4576669	plate,lysis,portal,head,integrase,holin,tail,protease,capsid,terminase	Escherichia_phage(46.81%)	67	4301998:4302041	4333512:4333555
WP_000208242.1|4286312_4286843_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293345.1|4286852_4288184_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	2.2e-45
WP_125399748.1|4288250_4289177_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4289269_4289755_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4289816_4290062_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084279.1|4290489_4291335_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	5.7e-15
WP_000136798.1|4291357_4292866_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_125399747.1|4292978_4293989_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_125399746.1|4294085_4294832_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323545.1|4294836_4295265_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_046082156.1|4295292_4295592_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000175060.1|4295800_4296241_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802212.1|4296341_4296941_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4297048_4297816_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000710181.1|4297871_4298621_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_125399769.1|4298724_4299714_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002431815.1|4299870_4300833_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076736.1|4301013_4301916_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4301998:4302041	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4302152_4302371_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_125399745.1|4302452_4303616_-	phage late control D family protein	NA	M1SV93	Escherichia_phage	99.5	1.1e-205
WP_096891294.1|4303615_4304095_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	96.9	1.1e-82
WP_125399744.1|4304109_4306557_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.7	0.0e+00
WP_049804398.1|4306549_4306669_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	3.0e-15
WP_001031303.1|4306701_4306977_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_023568729.1|4307033_4307552_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	4.2e-93
WP_001286716.1|4307564_4308755_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_096891288.1|4308814_4309408_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.3e-102
WP_139535890.1|4309438_4309828_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	54.1	1.9e-13
WP_096891291.1|4309849_4310290_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.7	8.6e-55
WP_125399743.1|4310261_4310855_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	62.6	2.3e-58
WP_139535887.1|4310854_4312138_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.7	1.2e-162
WP_001285341.1|4312134_4312746_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
WP_001121479.1|4312738_4313647_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127164.1|4313651_4313999_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_125399741.1|4313995_4314631_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.7e-112
WP_001001780.1|4314697_4315150_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001406878.1|4315142_4315610_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
WP_001440152.1|4315572_4315746_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001585210.1|4315717_4316143_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	6.1e-66
WP_096282621.1|4316130_4316556_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	6.1e-58
WP_001144101.1|4316570_4317068_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_125399740.1|4317067_4317349_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	4.8e-43
WP_000846399.1|4317352_4317556_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4317555_4318065_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|4318164_4318908_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_001248583.1|4318911_4319985_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001085953.1|4320043_4320898_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156872.1|4321071_4322844_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_096979121.1|4322843_4323878_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	7.9e-200
WP_001161722.1|4324304_4325246_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	73.7	2.0e-133
WP_001389947.1|4325328_4325811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119270.1|4325994_4326480_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	37.1	6.0e-09
WP_000268626.1|4327617_4329894_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_000027659.1|4329883_4330159_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4330155_4330380_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4330379_4330682_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4330681_4330906_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4330969_4331470_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4331639_4331912_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4332048_4332342_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4332411_4333392_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_002431816.1|4333578_4334079_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4333512:4333555	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033732.1|4334229_4334928_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	3.1e-06
WP_046082548.1|4334924_4336298_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.5	5.9e-17
WP_125399739.1|4336417_4336624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125399738.1|4336643_4337327_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_125399737.1|4337396_4338017_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 1
NZ_CP040807	Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence	90871	0	28753	90871	protease,transposase,integrase	Escherichia_phage(40.0%)	24	2389:2448	26098:26918
WP_015387340.1|0_876_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_013023839.1|922_1399_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
2389:2448	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|2440_3145_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|3527_3944_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|3948_4467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|4466_5255_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_139535892.1|5754_6198_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	100.0	2.5e-70
WP_139535893.1|6080_6359_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	100.0	5.4e-39
WP_139535896.1|6245_7058_+	class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	92.9	3.4e-97
WP_012372818.1|7227_7983_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000954592.1|11893_12070_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|12399_13215_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|13275_14079_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|14078_14915_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|15220_15463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139535894.1|16249_17449_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_023300759.1|18046_19261_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_000743213.1|22093_22318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|22314_23052_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001550559.1|23158_23650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|25400_26105_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000439434.1|27415_27748_-	hypothetical protein	NA	NA	NA	NA	NA
26098:26918	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAAAAATAGTCCTTCAGTGGGACGAAATGATCCGGACCGCTGGCTCCCTGAAGCTGGGCAAAGTACAGGCTTCAGTGCTGGTCCGTTCATTGCTGAAAAGTGAACGTCCTTCCGGACTGACTCAGGCAATCATTGAAGTGGGGCGCATCAACAAAACGCTGTATCTGCTTAATTATATTGATGATGAAGATTACCGCCGGCGCATTCTGACCCAGCTTAATCGGGGAGAAAGTCGCCATGCCGTTGCCAGAGCCATCTGTCACGGTCAAAAAGGTGAGATAAGAAAACGATATACCGACGGTCAGGAAGATCAACTGGGCGCACTGGGGCTGGTCACTAACGCCGTCGTGTTATGGAACACTATTTATATGCAGGCAGCCCTGGATCATCTCCGGGCGCAGGGTGAAACACTGAATGATGAAGATATCGCACGCCTCTCCCCGCTTTGCCACGGACATATCAATATGCTCGGCCATTATTCCTTCACGCTGGCAGAACTGGTGACCAAAGGACATCTGAGACCATTAAAAGAGGCGTCAGAGGCAGAAAACGTTGCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAA	NA	NA	NA	NA
WP_000557619.1|27749_28007_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|28099_28753_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP040808	Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence	80801	42343	50112	80801	integrase	Escherichia_phage(28.57%)	11	44211:44226	57829:57844
WP_000086147.1|42343_43027_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_001739825.1|43410_44313_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
44211:44226	attL	GCTGAATACCTTCATT	NA	NA	NA	NA
WP_012783918.1|44350_44620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618110.1|44730_44979_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|44975_45413_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_058799170.1|45412_46684_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	2.4e-142
WP_000340829.1|46688_47081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103691.1|47085_48057_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.6	6.3e-66
WP_000633913.1|48285_48930_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|48923_49199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058799171.1|49329_50112_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	2.0e-54
57829:57844	attR	GCTGAATACCTTCATT	NA	NA	NA	NA
>prophage 1
NZ_CP040810	Escherichia fergusonii strain EFCF056 plasmid pEF05, complete sequence	79936	21678	27448	79936	transposase	Salmonella_phage(33.33%)	8	NA	NA
WP_013188475.1|21678_22554_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_139535905.1|22588_22834_+	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	100.0	1.1e-08
WP_001067855.1|22724_23429_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_139535899.1|23814_24231_+	FosA3/FosA4 family fosfomycin resistance glutathione transferase	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|24235_24754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139535907.1|24686_25541_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_134791419.1|25848_26724_-	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	9.4e-154
WP_001217881.1|26890_27448_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
>prophage 1
NZ_CP040811	Escherichia fergusonii strain EFCF056 plasmid pEF06, complete sequence	67036	1077	10161	67036		uncultured_Mediterranean_phage(66.67%)	12	NA	NA
WP_139535910.1|1077_3432_+	hypothetical protein	NA	A0A1B1INS9	uncultured_Mediterranean_phage	37.6	3.2e-116
WP_139535911.1|3570_3876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535912.1|3905_4511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535913.1|4750_5686_+	hypothetical protein	NA	A0A1B1INY0	uncultured_Mediterranean_phage	32.0	3.5e-21
WP_139535914.1|5810_6443_+	hypothetical protein	NA	A0A1B1INZ5	uncultured_Mediterranean_phage	43.8	3.4e-36
WP_139535915.1|6429_6807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535916.1|6808_7651_+	hypothetical protein	NA	E1AC11	Pseudoalteromonas_phage	51.6	2.0e-39
WP_139535917.1|7692_8145_+	hypothetical protein	NA	A0A0K0MD20	Pseudoalteromonas_phage	46.7	7.0e-36
WP_139535918.1|8310_8547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535919.1|8509_8926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535920.1|8932_9352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535921.1|9381_10161_+	hypothetical protein	NA	A0A1B1INZ2	uncultured_Mediterranean_phage	51.9	4.6e-67
>prophage 2
NZ_CP040811	Escherichia fergusonii strain EFCF056 plasmid pEF06, complete sequence	67036	20656	25777	67036		EBPR_podovirus(33.33%)	9	NA	NA
WP_139535933.1|20656_21019_+	DEAD/DEAH box helicase	NA	A0A218M7A5	Flavobacterium_phage	49.5	1.3e-13
WP_139535934.1|21350_21677_+	hypothetical protein	NA	F8TUW6	EBPR_podovirus	29.0	3.5e-05
WP_139535935.1|21670_21997_+	SWF/SNF helicase family protein	NA	A0A2I5ARE3	Synechococcus_phage	42.7	3.2e-14
WP_139535936.1|22522_23047_+	site-specific DNA-methyltransferase	NA	F8TUJ7	EBPR_podovirus	51.6	2.3e-22
WP_139535937.1|23412_23592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535938.1|23862_24207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535939.1|24692_24887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535940.1|24966_25365_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	56.7	1.9e-32
WP_139535941.1|25552_25777_+	hypothetical protein	NA	S0A0E4	Cellulophaga_phage	62.3	1.4e-13
>prophage 3
NZ_CP040811	Escherichia fergusonii strain EFCF056 plasmid pEF06, complete sequence	67036	54099	59221	67036		Flavobacterium_phage(33.33%)	9	NA	NA
WP_139535933.1|54099_54462_+	DEAD/DEAH box helicase	NA	A0A218M7A5	Flavobacterium_phage	49.5	1.3e-13
WP_139535934.1|54793_55120_+	hypothetical protein	NA	F8TUW6	EBPR_podovirus	29.0	3.5e-05
WP_139535935.1|55113_55440_+	SWF/SNF helicase family protein	NA	A0A2I5ARE3	Synechococcus_phage	42.7	3.2e-14
WP_139535960.1|55630_56491_+	site-specific DNA-methyltransferase	NA	A0A218M7A5	Flavobacterium_phage	34.8	9.0e-40
WP_139535937.1|56856_57036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535938.1|57306_57651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535939.1|58136_58331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139535940.1|58410_58809_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	56.7	1.9e-32
WP_139535941.1|58996_59221_+	hypothetical protein	NA	S0A0E4	Cellulophaga_phage	62.3	1.4e-13
