The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	511561	564225	6876113	tail,plate,tRNA,holin	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_003109020.1|511561_512587_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
WP_003085061.1|512665_513235_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|513318_513672_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085067.1|513662_514205_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|514177_515410_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|515453_515960_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|516053_517607_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|517603_518875_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|518975_520898_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|521174_521507_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|521550_522402_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|522401_522782_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|522818_523625_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003129197.1|523740_524727_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003129198.1|524723_526016_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_140786404.1|525996_528798_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_033989253.1|528924_529941_+	phosphotransferase	NA	NA	NA	NA	NA
WP_033990554.1|529937_530612_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|530613_531372_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003137371.1|531372_532434_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_033990555.1|532585_534979_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|535024_535657_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|535785_536820_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|537053_538163_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_033990556.1|538218_539265_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015502276.1|539379_540627_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|540732_541563_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|541686_542361_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_023100179.1|542360_543179_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_023100180.1|543251_544730_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|544916_545231_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003109047.1|545330_546101_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	7.9e-72
WP_003085132.1|546558_546759_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|546806_547166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137382.1|547529_547979_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|548000_548516_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|548512_549070_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|549222_549549_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|549545_550433_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|550425_550959_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_015502281.1|550960_553069_+|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|553077_553518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033990557.1|553560_554721_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.2	5.0e-187
WP_003085175.1|554733_555237_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|555251_555596_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_033990559.1|555765_558003_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003085182.1|558012_558885_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|558859_559066_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_023095155.1|559123_560113_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_023095156.1|560145_560775_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|560771_561134_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003137395.1|561130_561388_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	6.4e-18
WP_023091406.1|561735_562341_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	3.5e-75
WP_003085203.1|562342_563392_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|563388_564225_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	1297587	1306616	6876113		Bacillus_phage(33.33%)	9	NA	NA
WP_003098558.1|1297587_1298223_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_033991080.1|1298268_1299162_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1299266_1300271_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1300697_1301021_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1301087_1303655_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092267.1|1303634_1303799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098486.1|1303780_1304788_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1304935_1305442_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1305575_1306616_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	2459845	2466739	6876113	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2459845_2461126_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003108773.1|2461127_2462525_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003138951.1|2462529_2463504_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_009314043.1|2463591_2464575_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.2e-141
WP_003090393.1|2464571_2464907_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2464903_2465209_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2465208_2465568_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_023128817.1|2465564_2465960_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	7.7e-47
WP_003090386.1|2466070_2466739_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 4
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	4687280	4697283	6876113	coat,integrase	Pseudomonas_phage(90.0%)	15	4686309:4686336	4698958:4698985
4686309:4686336	attL	GAGGGTTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_033990852.1|4687280_4688264_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.6	4.7e-93
WP_033990854.1|4688263_4689556_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	4.8e-247
WP_033990855.1|4689785_4691060_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	87.5	2.8e-199
WP_003114150.1|4691063_4691420_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_074241366.1|4691424_4692699_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	87.6	8.0e-45
WP_033990857.1|4692846_4693095_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	91.5	2.0e-32
WP_033964688.1|4693107_4693359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|4693371_4693464_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003140508.1|4693480_4693915_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_052150384.1|4694048_4694426_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	95.2	1.2e-57
WP_033990858.1|4694415_4695093_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_016852068.1|4695089_4695305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071534861.1|4695435_4695705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125093622.1|4695760_4696558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126071378.1|4696554_4697283_+	hypothetical protein	NA	S5W9H2	Leptospira_phage	48.5	6.3e-10
4698958:4698985	attR	GAGGGTTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 5
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	5544466	5584411	6876113	head,integrase,transposase	Pseudomonas_phage(96.0%)	52	5547322:5547339	5587836:5587853
WP_003094179.1|5544466_5544826_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_023657063.1|5544828_5545392_-	regulatory protein GemA	NA	J9RWI3	Pseudomonas_phage	100.0	5.0e-100
WP_044069193.1|5545378_5545846_-	hypothetical protein	NA	J9SH82	Pseudomonas_phage	100.0	6.3e-56
WP_003148480.1|5545847_5546066_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_003094188.1|5546067_5546757_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
WP_031638066.1|5546758_5547382_-	DUF3164 family protein	NA	J9SHK0	Pseudomonas_phage	100.0	4.5e-110
5547322:5547339	attL	CCAGGCGCCCCTTGGCGT	NA	NA	NA	NA
WP_033990702.1|5547374_5547575_-	bacteriophage protein	NA	J9RWL7	Pseudomonas_phage	100.0	1.3e-31
WP_003094193.1|5547567_5547942_-	hypothetical protein	NA	Q5ZR08	Pseudomonas_phage	94.4	3.9e-64
WP_003094195.1|5547941_5548223_-	hypothetical protein	NA	J9STZ0	Pseudomonas_phage	100.0	3.3e-44
WP_003094197.1|5548219_5548561_-	hypothetical protein	NA	J9SNT1	Pseudomonas_phage	100.0	9.3e-57
WP_034023955.1|5549727_5551512_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	99.3	0.0e+00
WP_003094208.1|5551515_5552493_-	hypothetical protein	NA	J9SND0	Pseudomonas_phage	100.0	8.9e-161
WP_003094211.1|5552502_5552817_-	hypothetical protein	NA	J9SH06	Pseudomonas_phage	100.0	1.2e-50
WP_003094213.1|5552813_5553074_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	100.0	1.6e-40
WP_023127890.1|5553066_5553555_-	hypothetical protein	NA	J9SVV8	Pseudomonas_phage	100.0	2.8e-91
WP_023127889.1|5553678_5553903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003094216.1|5554187_5554418_-	DNA-binding protein	NA	J9SNE2	Pseudomonas_phage	100.0	3.2e-37
WP_023127888.1|5554523_5554895_+	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	98.1	2.6e-20
WP_031299624.1|5554912_5555410_+	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	100.0	3.3e-87
WP_124084312.1|5555414_5555858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003138152.1|5556469_5556727_+	membrane protein	NA	J9STQ9	Pseudomonas_phage	100.0	5.6e-38
WP_034011213.1|5556884_5557514_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	99.0	1.4e-119
WP_071535463.1|5557510_5557729_+	hypothetical protein	NA	J9RWE5	Pseudomonas_phage	93.1	1.8e-29
WP_033868849.1|5557715_5558327_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	93.1	4.8e-96
WP_003094234.1|5558330_5558720_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003139994.1|5558721_5559018_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	4.6e-52
WP_003094238.1|5559022_5559598_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_003139988.1|5559599_5561303_+	hypothetical protein	NA	A0A0S4L072	Pseudomonas_phage	99.8	0.0e+00
WP_003152194.1|5561302_5562781_+	DUF935 family protein	NA	J9RWN4	Pseudomonas_phage	100.0	1.4e-287
WP_044069194.1|5562780_5564031_+|head	phage head morphogenesis protein	head	A0A0S4L0Q0	Pseudomonas_phage	99.3	4.7e-239
WP_003139982.1|5564027_5564597_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|5564884_5566054_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|5566057_5566435_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_003139975.1|5566446_5567376_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	100.0	7.6e-178
WP_003094256.1|5567422_5567617_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|5567616_5567943_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|5567950_5568460_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|5568461_5568917_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003094267.1|5569125_5569878_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003139971.1|5569879_5570386_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_023657077.1|5570612_5574455_+	hypothetical protein	NA	A0A0S4L7E6	Pseudomonas_phage	97.0	0.0e+00
WP_034070703.1|5574462_5575419_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	95.9	1.7e-185
WP_034070705.1|5575420_5576344_+	hypothetical protein	NA	A0A0A7DJR0	Pseudomonas_phage	91.9	1.1e-173
WP_073665512.1|5576343_5578047_+	hypothetical protein	NA	Q6TM53	Pseudomonas_phage	98.1	0.0e+00
WP_023102216.1|5578036_5578858_+	DUF2163 domain-containing protein	NA	A0A0A7DJU6	Pseudomonas_phage	99.6	8.5e-165
WP_003094581.1|5578866_5579106_+	hypothetical protein	NA	A0A0U5KN06	unidentified_phage	100.0	3.6e-39
WP_023102217.1|5579102_5579321_+	hypothetical protein	NA	A0A125RNE0	Pseudomonas_phage	100.0	9.8e-36
WP_101516584.1|5579310_5581518_+	hypothetical protein	NA	L7P7W0	Pseudomonas_phage	98.4	0.0e+00
WP_025921041.1|5581514_5582663_+	hypothetical protein	NA	A0A1C6ZDS2	Pseudomonas_phage	100.0	1.7e-227
WP_023465148.1|5582659_5582950_+	hypothetical protein	NA	A0A1C6ZDQ9	Pseudomonas_phage	100.0	1.9e-47
WP_010791890.1|5583028_5583253_+	hypothetical protein	NA	A0A0A1IX79	Pseudomonas_phage	100.0	2.5e-34
WP_003123548.1|5583721_5584411_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.2	7.0e-27
5587836:5587853	attR	CCAGGCGCCCCTTGGCGT	NA	NA	NA	NA
>prophage 6
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	5872776	5921278	6876113	protease,integrase,tRNA	Ectocarpus_siliculosus_virus(25.0%)	43	5906675:5906720	5933594:5933639
WP_019485018.1|5872776_5874231_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003162969.1|5874465_5874588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003096016.1|5874567_5875977_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_023876104.1|5876124_5876529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096022.1|5876525_5878733_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_021204967.1|5879019_5879541_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_003096027.1|5879537_5880110_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_003096033.1|5880380_5881457_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	2.4e-05
WP_003104661.1|5881459_5882890_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_101516585.1|5882942_5883176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096038.1|5883701_5884169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019485014.1|5884167_5884629_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003096050.1|5884687_5885179_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003096057.1|5885215_5885470_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	1.6e-13
WP_003096058.1|5885471_5885891_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003096060.1|5886215_5887763_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003096062.1|5888076_5888895_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003096067.1|5890360_5891671_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
WP_003096069.1|5891670_5892444_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_020750962.1|5892512_5893994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096075.1|5894031_5894787_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106330.1|5894936_5895689_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003111636.1|5895779_5896526_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|5896697_5897468_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|5897478_5898216_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_033991503.1|5898264_5898525_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_023092720.1|5898528_5899167_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|5899166_5899760_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003135903.1|5899920_5900319_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_011666785.1|5900355_5900592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023876106.1|5900588_5901695_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023876107.1|5901788_5904041_+	AsmA family protein	NA	NA	NA	NA	NA
WP_003096098.1|5904037_5905105_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|5905148_5905421_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003096102.1|5905448_5906531_+	oxidoreductase	NA	NA	NA	NA	NA
5906675:5906720	attL	ATTGAAAATCCCCGTGTCGGCGGTTCGATTCCGTCCCTGGGCACCA	NA	NA	NA	NA
WP_079868542.1|5906809_5907847_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	36.0	5.5e-36
WP_009681704.1|5907913_5908333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073662588.1|5908546_5908759_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_140786478.1|5913979_5914918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140786479.1|5914898_5915537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009681708.1|5916549_5918463_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009681709.1|5918459_5920151_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009681710.1|5920147_5921278_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
5933594:5933639	attR	ATTGAAAATCCCCGTGTCGGCGGTTCGATTCCGTCCCTGGGCACCA	NA	NA	NA	NA
>prophage 7
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	6184263	6243928	6876113	protease,integrase,transposase	Vibrio_phage(25.0%)	51	6189390:6189406	6253417:6253433
WP_033997905.1|6184263_6185358_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.0	9.6e-39
WP_033997903.1|6185357_6186305_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_033997901.1|6186304_6187033_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010794508.1|6187035_6187629_+	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	36.8	1.8e-23
WP_033997900.1|6187625_6188816_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_033997898.1|6188863_6189313_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_033997897.1|6189324_6190359_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	46.9	4.1e-71
6189390:6189406	attL	CGCCCTGCTGCTGGACA	NA	NA	NA	NA
WP_010792502.1|6190387_6190966_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	8.7e-31
WP_033997894.1|6190999_6191578_+	TerD family protein	NA	NA	NA	NA	NA
WP_033997892.1|6191712_6192738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033997890.1|6192804_6193782_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_071538368.1|6193846_6195040_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_033997886.1|6195146_6196406_-	tellurium resistance protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.1	3.6e-13
WP_033997883.1|6197487_6198756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033997920.1|6198782_6199634_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_033997919.1|6199642_6201517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140786480.1|6201526_6202738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058131787.1|6202925_6204041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058131789.1|6204053_6204302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021263239.1|6204515_6205601_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101516640.1|6205725_6206871_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.0	5.7e-34
WP_058131793.1|6206950_6207223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058131795.1|6207291_6207483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058131797.1|6207880_6209131_+	TerD family protein	NA	NA	NA	NA	NA
WP_058131799.1|6209176_6209701_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_010792483.1|6209697_6210093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079991010.1|6210678_6212598_-	helicase	NA	NA	NA	NA	NA
WP_058178518.1|6212761_6213043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140786481.1|6213908_6214433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794448.1|6215110_6215515_+	response regulator	NA	NA	NA	NA	NA
WP_101516641.1|6215511_6216357_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_108720486.1|6216802_6217964_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.9	4.7e-84
WP_101516656.1|6217918_6219022_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010794451.1|6221141_6222233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101516655.1|6222264_6223470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101516654.1|6223603_6224638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018395.1|6225061_6225982_+	hypothetical protein	NA	A0A2I7R6K1	Vibrio_phage	44.8	3.5e-34
WP_033997839.1|6225984_6226359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032488481.1|6230373_6231156_-	oxacillin-hydrolyzing class D beta-lactamase LCR-1	NA	NA	NA	NA	NA
WP_101516661.1|6231177_6231408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|6231600_6231780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|6231709_6232549_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|6232542_6232890_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_076611542.1|6233112_6234156_+|transposase	IS110-like element ISPa21 family transposase	transposase	NA	NA	NA	NA
WP_000381802.1|6234420_6234954_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000470556.1|6234959_6235250_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_101516660.1|6235343_6235898_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_124156107.1|6237907_6238942_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_010794469.1|6240100_6241474_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_124083333.1|6241470_6241980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074241223.1|6241963_6243928_-|integrase	integrase	integrase	NA	NA	NA	NA
6253417:6253433	attR	TGTCCAGCAGCAGGGCG	NA	NA	NA	NA
>prophage 8
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	6600846	6712139	6876113	integrase,transposase,holin	Salmonella_phage(12.5%)	110	6610427:6610442	6713772:6713785
WP_003115797.1|6600846_6601770_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003097323.1|6601786_6603298_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_003122286.1|6603410_6604325_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003114635.1|6604335_6604713_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_003097330.1|6604691_6605057_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_003111192.1|6605064_6605688_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003097337.1|6605873_6606680_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003097340.1|6606676_6607885_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003111191.1|6607988_6608876_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003097345.1|6608976_6609192_+	dodecin family protein	NA	NA	NA	NA	NA
WP_003097347.1|6609375_6609603_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_014603455.1|6609900_6611589_+	two-partner secretion system transporter TpsB2	NA	NA	NA	NA	NA
6610427:6610442	attL	TGCGCGAACTGGAGCA	NA	NA	NA	NA
WP_116858295.1|6621728_6622334_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
6610427:6610442	attL	TGCGCGAACTGGAGCA	NA	NA	NA	NA
WP_049347895.1|6622333_6622663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533946.1|6623087_6623330_+	hydrolase	NA	NA	NA	NA	NA
WP_023094285.1|6623511_6624204_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078452217.1|6624194_6624623_+	EndoU domain-containing protein	NA	NA	NA	NA	NA
WP_071534147.1|6624774_6624990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031656967.1|6625210_6628549_+	filamentous hemagglutinin	NA	NA	NA	NA	NA
WP_019485604.1|6628545_6628863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114586.1|6629093_6629795_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071534148.1|6630044_6630557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025992542.1|6631577_6631766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124080958.1|6631976_6632234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115685.1|6632345_6632624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083536.1|6632722_6633118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533982.1|6633131_6633386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019484681.1|6633382_6634792_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_003114583.1|6634955_6636329_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003083559.1|6636824_6637511_+	curli production assembly protein CsgG	NA	NA	NA	NA	NA
WP_003083569.1|6637541_6637895_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003083573.1|6637891_6638557_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003104304.1|6638571_6638955_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033991471.1|6639236_6640898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083582.1|6641511_6641652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033991473.1|6642468_6644301_+	asparagine synthase (glutamine-hydrolyzing)	NA	G9E4W0	Ostreococcus_lucimarinus_virus	23.7	4.7e-22
WP_003083588.1|6644353_6644782_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003083590.1|6644989_6645538_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.6	8.0e-34
WP_003083593.1|6645576_6646083_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_003083596.1|6646148_6647069_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003111522.1|6647176_6648064_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003111521.1|6648126_6648831_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|6648914_6649370_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003083610.1|6649480_6649714_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|6649725_6650163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|6650219_6650636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020750957.1|6650727_6651855_+	aminopeptidase	NA	NA	NA	NA	NA
WP_033991475.1|6652878_6653544_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_033991476.1|6653536_6654079_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003083621.1|6654156_6656202_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083624.1|6656198_6656474_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_033991477.1|6656562_6656826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979087.1|6656872_6659227_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003152713.1|6659223_6661326_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023083569.1|6661318_6662263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123789211.1|6662316_6662646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152712.1|6663089_6663956_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003152710.1|6664183_6666160_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.9	1.6e-31
WP_023436340.1|6666156_6667518_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021263504.1|6667518_6670707_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
6667736:6667751	attR	TGCGCGAACTGGAGCA	NA	NA	NA	NA
WP_021263503.1|6670737_6670959_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
6667736:6667751	attR	TGCGCGAACTGGAGCA	NA	NA	NA	NA
WP_021263502.1|6671061_6671652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021263501.1|6671648_6673049_+	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	31.4	8.6e-40
WP_011979096.1|6673203_6673467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031300087.1|6673481_6674084_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_125093639.1|6674268_6674520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152701.1|6674538_6674772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152698.1|6675111_6675393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053527406.1|6675530_6675773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074241128.1|6676036_6677215_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	49.7	2.1e-100
WP_008567175.1|6677553_6677970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008567178.1|6677988_6679671_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	5.3e-36
WP_008567179.1|6679703_6680138_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_008567180.1|6680150_6680426_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_008567181.1|6680439_6680790_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_008567182.1|6680861_6681272_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_008567184.1|6681414_6681597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008567186.1|6681835_6682189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019486123.1|6682260_6683343_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010794484.1|6684094_6685711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794485.1|6685721_6686879_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011979105.1|6686976_6687105_-	ultraviolet light resistance protein B	NA	A0A218MNF2	uncultured_virus	75.8	6.0e-09
WP_003152688.1|6688304_6689087_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003152686.1|6689157_6689541_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003152684.1|6689658_6690627_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010794530.1|6691570_6692533_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_003090764.1|6692578_6692938_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090760.1|6692937_6693789_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	64.0	1.0e-96
WP_003090759.1|6693803_6695291_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.7	4.3e-239
WP_023435250.1|6695634_6696624_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003132004.1|6696620_6696857_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995360.1|6696853_6697219_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003156770.1|6697236_6698922_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	5.5e-41
WP_003131987.1|6698993_6699269_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003131974.1|6699281_6699632_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131969.1|6699703_6700138_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_060853318.1|6700306_6700945_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	53.8	1.6e-41
WP_021264345.1|6701010_6701355_-	hypothetical protein	NA	A0A2I7S8K9	Vibrio_phage	40.6	2.0e-11
WP_021264346.1|6701369_6701636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|6702511_6702691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|6702620_6703460_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_016805816.1|6703453_6703771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126071399.1|6704391_6704580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006473469.1|6704548_6707434_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.0	1.9e-190
WP_003155734.1|6708360_6708837_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_063844482.1|6708962_6709199_-	trimethoprim-resistant dihydrofolate reductase DfrB5	NA	A0A0H5ARK7	Pseudomonas_phage	55.4	1.6e-12
WP_013263788.1|6709391_6709850_-	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_003108247.1|6709938_6710739_-	subclass B1 metallo-beta-lactamase VIM-2	NA	NA	NA	NA	NA
WP_000845048.1|6710905_6711919_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_140786496.1|6711887_6712139_+|transposase	transposase	transposase	NA	NA	NA	NA
6713772:6713785	attR	CTCGGCCAGCGCCT	NA	NA	NA	NA
>prophage 9
NZ_CP032569	Pseudomonas aeruginosa strain BA7823 chromosome, complete genome	6876113	6715512	6787835	6876113	plate,integrase,transposase	Salmonella_phage(42.86%)	58	6713724:6713783	6748884:6749075
6713724:6713783	attL	GGCGCCGGCCGTCACGGTGGCCACGTCCACCAGCTGCAGCAGCTCGACCTCGGCCAGCGC	NA	NA	NA	NA
WP_042933573.1|6715512_6718527_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.6	8.5e-69
WP_023911045.1|6718523_6718886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095462805.1|6719212_6721669_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.1	3.3e-71
WP_023911048.1|6721665_6722061_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003131921.1|6722077_6722320_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_033869463.1|6722384_6722723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023911051.1|6722824_6724081_+	TolC family protein	NA	NA	NA	NA	NA
WP_075123178.1|6724077_6725559_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058148348.1|6725555_6728717_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003131925.1|6728713_6729070_+	copper-binding protein	NA	NA	NA	NA	NA
WP_079747962.1|6729494_6730181_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_031275452.1|6730275_6730938_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_021702871.1|6731094_6731370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003131929.1|6731362_6731647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071543060.1|6731682_6732012_-	DUF2790 domain-containing protein	NA	NA	NA	NA	NA
WP_125896094.1|6732173_6732503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031275454.1|6733010_6733226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003131931.1|6733415_6734735_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_003131934.1|6734757_6735501_-	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	44.2	6.7e-60
WP_003131935.1|6735530_6736502_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023911060.1|6736681_6737680_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003131939.1|6737718_6738363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124105.1|6738343_6738823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124104.1|6739008_6739329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058199783.1|6739373_6739712_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_003131969.1|6739754_6740189_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_003131974.1|6740260_6740611_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131987.1|6740623_6740899_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000995360.1|6742674_6743040_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003132004.1|6743036_6743273_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003124096.1|6744390_6744951_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_140786489.1|6744953_6747920_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_140786490.1|6748568_6748808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150544.1|6749619_6750549_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
6748884:6749075	attR	GGCGCCGGCCGTCACGGTGGCCACGTCCACCAGCTGCAGCAGCTCGACCTCGGCCAGCGCCTGCAGGCGCTCGGTCTGGCCCGGTGTTTGTCTTCCAGGAAACGTACAGCACCAGGTTGTTTGTGTGTTTTGACGTACAGGCCCGGCCCGTCGCCTCGGCGCCGGCCTGGCCGGCGACGTGCTCCAGGTGCA	NA	NA	NA	NA
WP_003150546.1|6750987_6751398_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003299771.1|6751401_6754395_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003150552.1|6754628_6754904_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089115.1|6754916_6755267_-	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003089120.1|6755341_6755740_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003150556.1|6755750_6755933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003463565.1|6756148_6757069_-	cation transporter	NA	NA	NA	NA	NA
WP_003150565.1|6759652_6761365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083630.1|6762995_6763910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015502123.1|6763971_6765684_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_015502124.1|6765676_6766876_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003083639.1|6770699_6771428_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003083642.1|6771437_6772118_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_009875647.1|6772114_6775645_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_003118500.1|6775641_6776991_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004355761.1|6776997_6778332_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003083660.1|6778347_6778812_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033990906.1|6780740_6781775_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003083666.1|6781863_6782382_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003104973.1|6782394_6783891_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|6783966_6784455_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|6784622_6785468_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003111625.1|6785469_6785979_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003083676.1|6785975_6787835_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
