The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031843	Bartonella kosoyi strain Tel Aviv chromosome, complete genome	2234681	656711	725594	2234681	tail,capsid,tRNA,portal,terminase,plate,integrase	Acidithiobacillus_phage(24.14%)	66	681635:681651	694609:694625
WP_120100494.1|656711_659627_+|tRNA	isoleucine--tRNA ligase	tRNA	M1NN51	Moumouvirus	25.5	1.6e-64
WP_120100496.1|659804_660296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120100498.1|660968_661415_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_120100500.1|661681_663082_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_120100502.1|663062_663629_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_012230724.1|664430_664877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120100503.1|666349_667681_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_120100505.1|667667_668471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_120100507.1|668516_668762_+	DUF4170 domain-containing protein	NA	NA	NA	NA	NA
WP_120100509.1|669983_671306_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_120100511.1|671295_672336_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_120100513.1|672355_672592_-	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_120100514.1|672704_674558_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	39.5	1.1e-108
WP_120100516.1|674831_675920_+	2'-deoxycytidine 5'-triphosphate deaminase	NA	NA	NA	NA	NA
WP_120100518.1|676967_678119_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_120100519.1|680384_680600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100521.1|680532_680760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100522.1|680756_681419_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	64.3	7.6e-47
681635:681651	attL	AATTTTTAATAAACCAA	NA	NA	NA	NA
WP_120100524.1|684534_684858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100525.1|685036_686464_+	amino acid permease	NA	NA	NA	NA	NA
WP_120100527.1|686505_687186_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.9	1.8e-14
WP_120100528.1|687182_687806_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_120100530.1|687837_688392_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_120100532.1|689233_689542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120100533.1|690641_691799_+|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	39.7	4.4e-74
WP_120100535.1|692721_692997_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_120100537.1|693009_693291_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_120100538.1|693321_695364_-	ATP-binding protein	NA	NA	NA	NA	NA
694609:694625	attR	AATTTTTAATAAACCAA	NA	NA	NA	NA
WP_012230750.1|695567_695780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100541.1|695908_696136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102296.1|696132_696795_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	60.9	9.0e-48
WP_006589072.1|696954_697257_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	3.4e-18
WP_012231054.1|697243_697564_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	46.2	2.6e-16
WP_120100543.1|697607_697886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100545.1|697882_698620_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	40.5	5.5e-46
WP_120100547.1|698931_700239_-	late control protein	NA	K4HZC6	Acidithiobacillus_phage	39.8	7.4e-70
WP_120100548.1|700235_700460_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	53.1	1.1e-05
WP_120100550.1|700456_700837_-|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	43.1	3.4e-23
WP_120100552.1|700842_702978_-|tail	phage tail protein	tail	A0A2I5ARC1	Synechococcus_phage	35.1	6.1e-13
WP_120100553.1|702974_703088_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_120100555.1|703084_703372_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_120100557.1|703373_703880_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.2	3.4e-31
WP_120100558.1|703879_705091_-|tail	phage tail protein	tail	A0A088FVH5	Escherichia_phage	52.4	1.6e-127
WP_120100560.1|705472_706231_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	39.5	9.6e-46
WP_120100562.1|706227_706506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120100564.1|706551_706893_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_120100565.1|706903_707182_-	plasmid maintenance system killer	NA	NA	NA	NA	NA
WP_120102298.1|707376_708198_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	57.9	3.2e-87
WP_120100567.1|708691_710017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100568.1|710031_713175_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	35.0	8.6e-157
WP_120100570.1|713176_714289_-|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	36.4	5.1e-19
WP_120100572.1|714288_715116_-|plate	baseplate assembly protein	plate	A0A219VH98	Ochrobactrum_phage	34.9	3.9e-40
WP_120100574.1|715112_715454_-|plate	baseplate assembly protein W	plate	Q75QM0	Wolbachia_phage	56.9	1.1e-30
WP_120100576.1|715450_716140_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	32.7	1.4e-14
WP_120102300.1|716120_716663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100577.1|716718_717030_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	40.9	2.0e-10
WP_120100579.1|717046_717343_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	48.2	2.4e-13
WP_120100581.1|717389_717668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100582.1|717664_718405_-	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	37.5	1.2e-24
WP_120100584.1|718735_719092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100585.1|719093_720170_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	35.5	1.0e-56
WP_120102301.1|720546_720891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100587.1|720809_721877_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	47.6	1.2e-65
WP_120100588.1|721866_723411_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	41.5	4.6e-95
WP_120100590.1|723410_723659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100592.1|723662_725594_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	52.3	2.8e-166
>prophage 3
NZ_CP031843	Bartonella kosoyi strain Tel Aviv chromosome, complete genome	2234681	889906	898337	2234681		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_120100789.1|889906_892822_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.1	0.0e+00
WP_005773335.1|893154_893661_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.4	8.4e-46
WP_120100791.1|893892_896670_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.5	3.4e-104
WP_120100792.1|896694_897192_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.2	7.5e-23
WP_167309104.1|897204_897807_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.8	2.0e-46
WP_120100795.1|897824_898337_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	61.8	9.1e-48
>prophage 4
NZ_CP031843	Bartonella kosoyi strain Tel Aviv chromosome, complete genome	2234681	964369	988981	2234681	integrase	Lactobacillus_phage(18.75%)	24	957997:958011	966173:966187
957997:958011	attL	ATCTTCTTCATGTTC	NA	NA	NA	NA
WP_150222275.1|964369_965413_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	31.0	4.4e-33
WP_120100633.1|965421_965640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100635.1|965761_966385_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	44.6	1.2e-46
966173:966187	attR	ATCTTCTTCATGTTC	NA	NA	NA	NA
WP_120100636.1|966386_967208_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	41.9	2.2e-40
WP_120100638.1|967818_968286_-	hypothetical protein	NA	A0A0A7NP48	Lactobacillus_phage	58.2	1.4e-10
WP_120100640.1|968279_968681_-	hypothetical protein	NA	A0A0A7NNQ1	Lactobacillus_phage	57.8	2.3e-06
WP_120100641.1|968693_969455_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	42.9	3.3e-46
WP_120102304.1|969535_969895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232384.1|970158_970488_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_120100643.1|970608_970890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120100645.1|970900_971317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012232381.1|971469_972180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100648.1|972255_972720_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	61.0	9.1e-47
WP_120100649.1|972722_973088_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_120100651.1|973077_974193_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_120100860.1|975136_975643_+	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	54.5	1.8e-11
WP_120100861.1|975724_976387_+	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	53.4	4.4e-10
WP_120100862.1|976471_977155_+	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	50.0	6.5e-09
WP_120100863.1|977762_978203_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	54.8	2.3e-31
WP_120100866.1|979491_980271_-	hypothetical protein	NA	K4Q356	Edwardsiella_phage	47.6	4.8e-08
WP_120100867.1|980376_980907_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	53.4	2.0e-10
WP_120100869.1|980988_981570_-	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	53.6	5.0e-10
WP_120100870.1|981652_982450_-	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	55.8	2.6e-09
WP_120100872.1|984019_988981_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	27.7	5.3e-44
>prophage 5
NZ_CP031843	Bartonella kosoyi strain Tel Aviv chromosome, complete genome	2234681	1013313	1023833	2234681		Lactobacillus_phage(20.0%)	15	NA	NA
WP_012231588.1|1013313_1013661_-	YdaU family protein	NA	A0A076GD06	Sinorhizobium_phage	40.9	1.1e-15
WP_120100898.1|1013653_1014130_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	63.8	6.2e-51
WP_120100899.1|1014210_1014645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100901.1|1014661_1014901_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_120100902.1|1015002_1015605_+	helix-turn-helix transcriptional regulator	NA	A0A1X9HW95	Ruegeria_phage	43.5	5.7e-17
WP_120100904.1|1015772_1016153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120100905.1|1016217_1016574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120100906.1|1016646_1017375_+	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	41.5	3.3e-27
WP_120100908.1|1017387_1017705_+	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	63.0	2.5e-11
WP_120100910.1|1017716_1018118_+	hypothetical protein	NA	A0A0A7NNQ1	Lactobacillus_phage	59.6	1.6e-07
WP_120100911.1|1018111_1018612_+	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	52.9	3.5e-12
WP_120102330.1|1018687_1019509_+	ERF family protein	NA	K4NWX3	Pseudomonas_phage	33.7	8.6e-16
WP_120100621.1|1019510_1020134_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	43.9	3.0e-45
WP_120100913.1|1020996_1022160_+	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_120100914.1|1022540_1023833_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	32.3	1.9e-54
>prophage 7
NZ_CP031843	Bartonella kosoyi strain Tel Aviv chromosome, complete genome	2234681	1642167	1662081	2234681	tail,capsid,portal,terminase,integrase	Sulfitobacter_phage(27.27%)	23	1660637:1660652	1672105:1672120
WP_120101659.1|1642167_1643298_-|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	50.5	5.1e-19
WP_120101661.1|1643305_1644307_-|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	36.2	5.4e-20
WP_120101663.1|1644319_1644967_-	transglycosylase SLT domain-containing protein	NA	L7TQZ1	Rhizobium_phage	48.8	1.3e-30
WP_120101664.1|1644966_1647123_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_120101666.1|1647128_1648046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120101668.1|1648024_1648750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120101670.1|1648761_1649646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100686.1|1649647_1650073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100684.1|1650072_1651530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232363.1|1651531_1652239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012232364.1|1652304_1652613_+	hypothetical protein	NA	A0A141GEX6	Brucella_phage	45.3	2.1e-15
WP_012232365.1|1652593_1652878_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	49.4	2.6e-12
WP_120100682.1|1652913_1653294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100681.1|1653305_1653686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100679.1|1653708_1654836_-|capsid	N4-gp56 family major capsid protein	capsid	A0A248SKT9	Klebsiella_phage	32.6	3.0e-43
WP_120102306.1|1654929_1655820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120100677.1|1655845_1657864_-|portal	phage portal protein	portal	C5IHN8	Burkholderia_virus	24.6	3.1e-35
WP_120100676.1|1657848_1659177_-|terminase	PBSX family phage terminase large subunit	terminase	A0A088F6U9	Sulfitobacter_phage	57.8	1.7e-146
WP_120100674.1|1659157_1659493_-	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	41.2	2.1e-05
WP_120100673.1|1659693_1659963_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	46.3	7.6e-14
WP_120100671.1|1659946_1660174_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_120101671.1|1660268_1660703_-	hypothetical protein	NA	NA	NA	NA	NA
1660637:1660652	attL	CAGAAAGTGGATTTTT	NA	NA	NA	NA
WP_120101673.1|1660914_1662081_+|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	41.4	6.2e-76
WP_120101673.1|1660914_1662081_+|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	41.4	6.2e-76
1672105:1672120	attR	AAAAATCCACTTTCTG	NA	NA	NA	NA
>prophage 8
NZ_CP031843	Bartonella kosoyi strain Tel Aviv chromosome, complete genome	2234681	1695023	1732539	2234681	tail,integrase	Edwardsiella_phage(13.04%)	36	1677067:1677083	1737697:1737713
1677067:1677083	attL	TTCGCATCAACGGCAAT	NA	NA	NA	NA
WP_120101688.1|1695023_1696190_-|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	40.1	7.3e-77
WP_120101690.1|1696427_1697069_+	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	52.8	1.0e-08
WP_120101692.1|1697153_1698317_+	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	56.4	6.9e-11
WP_120102381.1|1698414_1699194_+	hypothetical protein	NA	K4Q356	Edwardsiella_phage	49.2	8.2e-08
WP_120101694.1|1701166_1701454_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	42.7	5.3e-13
WP_120101695.1|1701471_1701750_-	Killer protein	NA	A0A0M3LQB1	Mannheimia_phage	46.7	1.2e-17
WP_120101697.1|1702164_1702461_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012231062.1|1702470_1702857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120101699.1|1702849_1703101_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_120101700.1|1703275_1703554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120101702.1|1703550_1704282_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	42.7	6.9e-49
WP_120101703.1|1705385_1706552_+|integrase	site-specific integrase	integrase	A0A088F800	Sulfitobacter_phage	40.9	2.3e-70
WP_007347209.1|1706760_1706961_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_120101705.1|1707268_1708843_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_167309088.1|1709225_1709393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120101707.1|1709450_1714358_+	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	26.8	1.5e-43
WP_120102382.1|1715980_1716778_+	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	50.9	1.2e-09
WP_120101709.1|1716860_1717544_+	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	51.7	5.9e-10
WP_120101711.1|1717623_1718154_+	hypothetical protein	NA	A0A076G7L7	Bacillus_phage	53.4	2.7e-10
WP_120101713.1|1718260_1719040_+	hypothetical protein	NA	K4Q356	Edwardsiella_phage	49.2	4.8e-08
WP_120100557.1|1721446_1721953_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.2	3.4e-31
WP_120100555.1|1721954_1722242_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_120100553.1|1722238_1722352_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_120100552.1|1722348_1724484_+|tail	phage tail protein	tail	A0A2I5ARC1	Synechococcus_phage	35.1	6.1e-13
WP_120100550.1|1724489_1724870_+|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	43.1	3.4e-23
WP_120100548.1|1724866_1725091_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	53.1	1.1e-05
WP_120100547.1|1725087_1726395_+	late control protein	NA	K4HZC6	Acidithiobacillus_phage	39.8	7.4e-70
WP_120101716.1|1726708_1727449_+	phage regulatory protein/antirepressor Ant	NA	B5AX29	Iodobacteriophage	39.5	1.7e-26
WP_120101718.1|1727445_1727724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120101720.1|1727778_1728090_-	addiction module antidote protein	NA	NA	NA	NA	NA
WP_120101721.1|1728101_1728425_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	1.7e-15
WP_120102384.1|1728530_1729193_+	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	61.5	2.6e-47
WP_120100541.1|1729189_1729417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012230750.1|1729545_1729758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120101723.1|1729888_1731064_-|integrase	site-specific integrase	integrase	A0A1X9HVL9	Ruegeria_phage	41.7	1.1e-75
WP_120101725.1|1731612_1732539_-	porin family protein	NA	O11861	Bartonella_henselae_phage	44.6	1.6e-55
1737697:1737713	attR	ATTGCCGTTGATGCGAA	NA	NA	NA	NA
>prophage 9
NZ_CP031843	Bartonella kosoyi strain Tel Aviv chromosome, complete genome	2234681	1910741	2023873	2234681	tail,transposase,protease,integrase	Ochrobactrum_phage(55.56%)	66	2009527:2009546	2024056:2024075
WP_120101941.1|1910741_1911467_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_120101943.1|1912488_1913577_+	DUF3792 domain-containing protein	NA	NA	NA	NA	NA
WP_120102397.1|1913788_1914982_+	MFS transporter	NA	NA	NA	NA	NA
WP_120101945.1|1915172_1915844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120101947.1|1915857_1917111_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_120101949.1|1917453_1917843_+	glyoxalase	NA	NA	NA	NA	NA
WP_150222303.1|1918391_1918568_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_150222305.1|1921205_1921586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120101960.1|1921929_1922361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120101962.1|1922708_1923878_+	MFS transporter	NA	NA	NA	NA	NA
WP_120101964.1|1925396_1926758_+	MFS transporter	NA	NA	NA	NA	NA
WP_120101970.1|1936356_1936749_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_120101972.1|1936907_1938002_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_120101974.1|1940388_1940973_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_120101976.1|1941050_1942184_-	type III PLP-dependent enzyme	NA	A0A2K9L0W9	Tupanvirus	30.2	1.4e-37
WP_120102399.1|1943789_1944707_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_120101982.1|1944819_1945485_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_150222307.1|1945440_1945776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120101986.1|1945879_1946710_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_120101989.1|1947336_1948452_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.7	1.7e-27
WP_120101993.1|1948910_1949111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102401.1|1950133_1952929_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	53.3	2.5e-272
WP_120101995.1|1952934_1953303_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_120101997.1|1953309_1954422_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_120101999.1|1955082_1955748_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_120102001.1|1955761_1955962_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_120102402.1|1956930_1957311_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	50.6	1.8e-13
WP_120102007.1|1957807_1958839_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_120102009.1|1959388_1960051_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_120102011.1|1960511_1961330_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_120102013.1|1961357_1962392_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	1.4e-26
WP_120102015.1|1962384_1963044_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_120102017.1|1964782_1965262_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_120102019.1|1965429_1966758_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_120102021.1|1968196_1968553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102023.1|1969344_1969641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167309091.1|1970448_1970613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102025.1|1971329_1972073_+	creatininase family protein	NA	NA	NA	NA	NA
WP_120102027.1|1972095_1973127_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_120102029.1|1973138_1974110_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_120102031.1|1975448_1978757_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_120102033.1|1978924_1982956_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_150222309.1|1983123_1986474_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_167309092.1|1986805_1986967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102404.1|1991975_1994792_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_120102039.1|1995601_1998853_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_150222311.1|1999519_2005321_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_120102044.1|2005520_2006471_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_120102046.1|2006570_2007527_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	43.0	6.4e-63
WP_120102048.1|2007519_2008470_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_120102049.1|2008466_2009225_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.6	2.1e-16
2009527:2009546	attL	TTTTCAAAGGGTCTTCAAAG	NA	NA	NA	NA
WP_150222289.1|2010213_2011224_-	late control protein	NA	A0A219VHA9	Ochrobactrum_phage	51.2	6.3e-85
WP_120101381.1|2011214_2011469_-|tail	phage tail protein	tail	A0A1S5NR68	Burkholderia_phage	37.3	4.7e-05
WP_120102364.1|2011465_2011912_-|tail	phage tail protein	tail	A0A219VHA8	Ochrobactrum_phage	41.5	3.2e-25
WP_150222287.1|2011923_2012103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102053.1|2014552_2014966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102055.1|2014975_2015494_-|tail	phage tail protein	tail	A0A219VHB2	Ochrobactrum_phage	64.7	1.3e-62
WP_150222361.1|2015490_2016780_-|tail	phage tail protein	tail	A0A219VHA7	Ochrobactrum_phage	62.2	5.1e-148
WP_120102407.1|2016952_2018314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102057.1|2018904_2020887_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A219VHD4	Ochrobactrum_phage	60.3	1.6e-161
WP_120102059.1|2020883_2021342_-	hypothetical protein	NA	A0A219VHC5	Ochrobactrum_phage	64.3	1.6e-43
WP_120102061.1|2021338_2022298_-	ParB/RepB/Spo0J family partition protein	NA	A0A219VHB6	Ochrobactrum_phage	47.6	3.4e-72
WP_120102063.1|2022297_2022696_-	hypothetical protein	NA	A0A219VHC3	Ochrobactrum_phage	58.1	1.1e-29
WP_007346581.1|2022679_2022817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120102409.1|2022893_2023199_-	transcriptional regulator	NA	A0A219VHB8	Ochrobactrum_phage	67.1	1.5e-18
WP_120102064.1|2023345_2023873_+	helix-turn-helix transcriptional regulator	NA	A0A219VHC1	Ochrobactrum_phage	39.0	3.7e-20
2024056:2024075	attR	TTTTCAAAGGGTCTTCAAAG	NA	NA	NA	NA
