The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	0	47193	3600228	transposase	Enterobacteria_phage(50.0%)	32	NA	NA
WP_161595258.1|1128_2931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005137646.1|2914_4162_-	radical SAM protein	NA	NA	NA	NA	NA
WP_033133941.1|4161_4899_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_005137649.1|4913_5399_-	hypothetical protein	NA	A0A2I2L429	Orpheovirus	32.6	1.1e-05
WP_142028573.1|5662_6253_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.1	1.2e-30
WP_033134859.1|7397_8360_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_157671745.1|8429_8591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028575.1|8780_9083_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142028577.1|9087_10179_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_004883943.1|10465_10783_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_118902217.1|10779_12069_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_142028579.1|12086_15434_-	SWIM zinc finger family protein	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	31.2	3.0e-51
WP_005092561.1|16764_17685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743262.1|17707_18640_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.5	7.1e-59
WP_000734101.1|18752_19073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733361.1|19196_19580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000672051.1|19604_20369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002159601.1|20460_21069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000543471.1|24368_24866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902208.1|24862_27043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040037.1|29915_30848_-|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_118902205.1|31264_33901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040037.1|34257_35190_-|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_017396282.1|35773_37036_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_004985675.1|37200_37842_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004985679.1|37942_38341_-	OsmC family protein	NA	NA	NA	NA	NA
WP_004985681.1|38337_39285_-	pirin family protein	NA	NA	NA	NA	NA
WP_004985683.1|39590_39893_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_100834157.1|39919_40309_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_004985686.1|40323_40848_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104470630.1|42755_43975_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.2	7.6e-77
WP_032012138.1|46920_47193_-	hypothetical protein	NA	A0A2H4IYJ6	uncultured_Caudovirales_phage	59.1	1.2e-19
>prophage 2
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	50881	58015	3600228		Hyphantria_cunea_nuclear_polyhedrosis_virus(50.0%)	5	NA	NA
WP_125316849.1|50881_54229_-	DEAD/DEAH box helicase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	30.7	4.0e-51
WP_000557943.1|54644_54908_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_043975117.1|54894_55158_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_008942447.1|56072_56537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_118902195.1|56662_58015_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.5	3.2e-52
>prophage 3
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	61106	62756	3600228		Staphylococcus_phage(100.0%)	1	NA	NA
WP_118902187.1|61106_62756_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	8.4e-79
>prophage 4
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	79417	80744	3600228	transposase	Erysipelothrix_phage(50.0%)	2	NA	NA
WP_118902173.1|79417_79636_-	hypothetical protein	NA	A0A0H4TFE5	Erysipelothrix_phage	41.4	1.9e-07
WP_005274609.1|79814_80744_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
>prophage 5
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	89962	108965	3600228		Tupanvirus(28.57%)	16	NA	NA
WP_118902160.1|89962_90979_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.4	2.8e-80
WP_118902156.1|90971_92645_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_004637413.1|92647_93907_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	NA	NA	NA	NA
WP_118902153.1|93924_94800_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	8.5e-62
WP_118902150.1|94813_96688_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.2	1.1e-21
WP_118902147.1|96839_98015_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	47.4	8.6e-102
WP_118902144.1|98111_98786_-	acetyltransferase	NA	NA	NA	NA	NA
WP_118902141.1|98766_99381_-	sugar transferase	NA	NA	NA	NA	NA
WP_118902139.1|99373_100627_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_118902134.1|100659_102003_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.6	1.4e-84
WP_118902129.1|102008_102800_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_161595259.1|102796_104011_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_118902122.1|104046_105057_-	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	38.6	5.8e-14
WP_118902119.1|105050_106016_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_118902116.1|106019_107495_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_118902113.1|107831_108965_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.3	5.9e-31
>prophage 6
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	129722	133530	3600228		Bacillus_virus(100.0%)	4	NA	NA
WP_005092725.1|129722_130712_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	G3M9Z0	Bacillus_virus	32.8	2.2e-05
WP_118902089.1|130738_131914_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_004637372.1|131910_132714_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_075316448.1|132729_133530_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.5	9.2e-31
>prophage 7
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	138676	141514	3600228	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_118902080.1|138676_141514_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.9	1.1e-73
>prophage 8
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	149723	151506	3600228		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_075316455.1|149723_150278_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.7	8.1e-18
WP_017395491.1|150408_151506_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	29.5	2.5e-10
>prophage 9
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	155572	157516	3600228		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004949942.1|155572_157516_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.6	1.7e-147
>prophage 10
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	165617	166130	3600228		Tetraselmis_virus(100.0%)	1	NA	NA
WP_005086095.1|165617_166130_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.3	9.4e-21
>prophage 11
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	174129	178782	3600228	transposase	uncultured_virus(66.67%)	4	NA	NA
WP_005091964.1|174129_175083_+	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	34.8	5.4e-38
WP_001223318.1|175578_176280_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_005091959.1|176711_178028_+	guanine deaminase	NA	NA	NA	NA	NA
WP_005091958.1|178254_178782_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.3	5.2e-14
>prophage 12
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	183354	194120	3600228		Staphylococcus_phage(25.0%)	9	NA	NA
WP_005086077.1|183354_183678_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	48.1	1.4e-14
WP_004637316.1|183687_184083_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831329.1|184110_184245_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_005086074.1|184915_186310_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_005091944.1|186422_187571_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	31.9	3.3e-45
WP_005091943.1|187598_188693_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_005091941.1|188742_191211_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.0	5.4e-114
WP_004637309.1|191300_191858_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_004637308.1|192191_194120_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.0	3.4e-63
>prophage 13
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	197917	198253	3600228		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_005086061.1|197917_198253_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	1.1e-25
>prophage 14
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	213235	214861	3600228	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_005088614.1|213235_214861_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	2.8e-143
>prophage 15
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	218713	219676	3600228	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_118902065.1|218713_219676_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
>prophage 16
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	224998	226294	3600228		Enterobacteria_phage(100.0%)	1	NA	NA
WP_075314274.1|224998_226294_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	66.7	2.5e-150
>prophage 17
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	231261	243802	3600228		Leptospira_phage(25.0%)	11	NA	NA
WP_017396294.1|231261_234390_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.1	9.5e-23
WP_017396438.1|234522_234900_+	membrane protein	NA	NA	NA	NA	NA
WP_004637270.1|235048_236164_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	33.3	3.1e-24
WP_017396296.1|236277_237099_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_118902062.1|237188_237836_+	START domain-containing protein	NA	NA	NA	NA	NA
WP_118902059.1|237877_239065_-	MFS transporter	NA	NA	NA	NA	NA
WP_100833019.1|239066_239873_-	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	34.9	5.3e-34
WP_118902055.1|240002_240905_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113997942.1|240852_241263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396435.1|241352_242780_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_118902052.1|242776_243802_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	29.2	6.0e-43
>prophage 18
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	247425	247584	3600228		Moraxella_phage(100.0%)	1	NA	NA
WP_004637251.1|247425_247584_-	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	72.3	1.9e-09
>prophage 19
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	250797	258122	3600228		Bacillus_virus(33.33%)	7	NA	NA
WP_035374997.1|250797_252075_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	1.6e-80
WP_118902039.1|252074_252956_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_118902036.1|253135_254875_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004637244.1|254923_255643_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	36.8	6.3e-39
WP_005087342.1|255678_256281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005087340.1|256296_257190_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005088793.1|257462_258122_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	2.5e-26
>prophage 20
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	264701	342962	3600228	integrase,transposase	uncultured_virus(16.67%)	59	260694:260708	336149:336163
260694:260708	attL	GGTAATAAAGTATCA	NA	NA	NA	NA
WP_118902030.1|264701_265037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017395860.1|265132_265537_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_142028581.1|265609_265795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023188010.1|269324_270023_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000999878.1|270015_271905_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_023188009.1|271901_272753_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_023188008.1|272772_273864_+	TniQ family protein	NA	NA	NA	NA	NA
WP_023270956.1|273882_275298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000530048.1|275366_276005_+	hypothetical protein	NA	A0A2H4J137	uncultured_Caudovirales_phage	38.6	1.4e-26
WP_023188004.1|278870_279551_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	40.2	6.6e-30
WP_023188003.1|279641_279983_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_023188002.1|280067_280511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142028582.1|282781_283045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023188000.1|283058_284528_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023187999.1|284545_287680_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_023187998.1|287692_288025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023270952.1|288065_288779_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_023187996.1|288789_289479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023187995.1|289555_290863_+	MFS transporter	NA	NA	NA	NA	NA
WP_023187994.1|290957_291146_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_023187993.1|291210_292083_-	DMT family transporter	NA	NA	NA	NA	NA
WP_023187992.1|292108_292699_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_005274609.1|297122_298052_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
WP_118902016.1|298074_299013_-	hypothetical protein	NA	Q858S3	Enterobacteria_phage	45.1	1.4e-17
WP_023187990.1|299146_299605_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_118902013.1|299615_302102_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	1.0e-91
WP_023187988.1|302222_302537_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023187987.1|302761_304450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023187986.1|304490_305495_-	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	27.1	7.5e-22
WP_023187985.1|305945_307127_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_008942230.1|307130_310295_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	19.4	1.6e-22
WP_170830421.1|310339_311773_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_008942232.1|311849_312233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942233.1|312213_312783_+	ester cyclase	NA	NA	NA	NA	NA
WP_170830422.1|312979_313891_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_071211303.1|314076_316005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023187982.1|316049_317444_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_005314752.1|317446_317908_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_023187981.1|317913_319626_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_023187980.1|319625_320639_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_023187979.1|321138_322221_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	36.4	2.4e-37
WP_023187978.1|322650_323358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171479072.1|323359_324328_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_118902007.1|324969_325848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902004.1|325862_327056_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_118902001.1|327222_328809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901998.1|329217_329490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901995.1|329501_329717_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_118901992.1|329936_331439_-	TniQ family protein	NA	NA	NA	NA	NA
WP_118901989.1|331441_333124_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_118901986.1|333153_335295_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_118901983.1|335278_336082_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_118901979.1|336236_338075_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7J689	Paramecium_bursaria_Chlorella_virus	44.7	1.2e-126
336149:336163	attR	TGATACTTTATTACC	NA	NA	NA	NA
WP_100833034.1|338087_339452_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.5	1.7e-29
WP_005087280.1|339474_339996_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_118901976.1|339973_340891_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004679125.1|340905_341355_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_004637206.1|341358_341829_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	52.0	1.1e-31
WP_004637205.1|341840_342962_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.2	1.4e-56
>prophage 21
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	347893	349099	3600228		Agrobacterium_phage(100.0%)	1	NA	NA
WP_004637195.1|347893_349099_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.8	1.4e-43
>prophage 22
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	353849	355924	3600228		Bacillus_phage(100.0%)	2	NA	NA
WP_004641648.1|353849_355205_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	7.0e-31
WP_004641646.1|355213_355924_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.7	2.3e-33
>prophage 23
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	363420	363960	3600228		Klosneuvirus(100.0%)	1	NA	NA
WP_005088719.1|363420_363960_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	36.4	2.4e-22
>prophage 24
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	368562	370446	3600228		Bacillus_virus(100.0%)	1	NA	NA
WP_005088714.1|368562_370446_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.7	6.4e-99
>prophage 25
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	376356	377892	3600228		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_005088702.1|376356_377184_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.5e-12
WP_005088699.1|377193_377892_+	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	25.1	1.7e-17
>prophage 26
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	385345	386371	3600228	transposase	Faecalibacterium_phage(100.0%)	1	NA	NA
WP_080591907.1|385345_386371_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	5.1e-26
>prophage 27
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	391914	393907	3600228		Bacillus_virus(50.0%)	2	NA	NA
WP_118901964.1|391914_392682_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.9	4.9e-13
WP_005087217.1|392722_393907_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.9	1.2e-21
>prophage 28
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	398619	399552	3600228	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_020846310.1|398619_399552_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
>prophage 29
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	403647	404130	3600228		Molluscum_contagiosum_virus(100.0%)	1	NA	NA
WP_005087200.1|403647_404130_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	31.9	7.5e-12
>prophage 30
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	414422	415106	3600228		Bacillus_virus(100.0%)	1	NA	NA
WP_004641547.1|414422_415106_+	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	40.1	2.4e-19
>prophage 31
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	425141	430442	3600228		Klosneuvirus(50.0%)	4	NA	NA
WP_004641532.1|425141_426608_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.4	2.7e-89
WP_005088679.1|426734_428072_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_004641528.1|428084_428741_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_118901942.1|428741_430442_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	9.3e-65
>prophage 32
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	439028	440987	3600228		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005088666.1|439028_440987_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.6	2.7e-92
>prophage 33
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	448593	463417	3600228		Campylobacter_phage(16.67%)	11	NA	NA
WP_118901936.1|448593_450279_+	NTPase	NA	X2KLG0	Campylobacter_phage	24.5	1.6e-16
WP_005088654.1|450293_453125_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	0.0e+00
WP_017396722.1|453384_453957_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_004641483.1|454012_454366_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_008941060.1|454517_455192_-	thiaminase II	NA	NA	NA	NA	NA
WP_004641480.1|455364_456447_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.4	3.8e-88
WP_004641478.1|456578_457943_+	MFS transporter	NA	NA	NA	NA	NA
WP_004641476.1|457994_458576_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	62.3	1.4e-36
WP_017396719.1|458976_460410_+	amino acid permease	NA	NA	NA	NA	NA
WP_008941075.1|460467_461970_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.6	9.2e-16
WP_008941076.1|462124_463417_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	1.3e-26
>prophage 34
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	471691	508393	3600228	integrase,transposase	Enterobacteria_phage(16.67%)	30	479735:479755	504933:504953
WP_118901380.1|471691_472850_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.1	1.5e-50
WP_020846310.1|477267_478200_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_017396498.1|478275_479475_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	4.7e-79
479735:479755	attL	TACCGACAAATATACCGACAA	NA	NA	NA	NA
WP_118901933.1|480141_481188_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_118901930.1|481190_482366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100222603.1|482404_483494_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_118901927.1|483621_483834_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_118902254.1|484140_485268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017396597.1|485876_486179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941089.1|486181_486676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941090.1|486795_488778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941091.1|488785_491416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941092.1|491412_493941_+	hypothetical protein	NA	A0A0F7L5T6	uncultured_marine_virus	24.6	6.9e-48
WP_017396596.1|494055_494520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941094.1|494595_494817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941095.1|494844_495276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941096.1|495405_495606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941097.1|495714_496047_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_008941098.1|496049_496499_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	46.6	1.6e-32
WP_005091342.1|496630_497671_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	82.7	7.7e-171
WP_008941099.1|497850_498225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941100.1|498296_499607_-	AAA family ATPase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	93.1	4.9e-207
WP_008941101.1|499606_500359_-	helix-turn-helix domain-containing protein	NA	E2GLZ1	Acinetobacter_phage	61.5	6.4e-26
WP_008941103.1|500514_501072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941104.1|501068_501386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941105.1|501382_502078_-	Rha family transcriptional regulator	NA	G0ZND1	Cronobacter_phage	38.2	8.0e-23
WP_008941106.1|502080_502368_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_008941108.1|503564_504854_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.6	2.0e-67
WP_008941109.1|505276_507157_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	30.2	7.9e-73
504933:504953	attR	TACCGACAAATATACCGACAA	NA	NA	NA	NA
WP_017396594.1|507316_508393_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	37.5	9.8e-28
>prophage 35
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	515495	519870	3600228	transposase	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_008941116.1|515495_516950_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	71.8	3.7e-187
WP_008941117.1|517184_517916_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_008941118.1|518083_518617_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_081400882.1|518844_519870_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	4.4e-25
>prophage 36
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	525015	527253	3600228		Bacillus_phage(100.0%)	2	NA	NA
WP_004641411.1|525015_526470_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	1.3e-14
WP_004641409.1|526488_527253_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	1.7e-29
>prophage 37
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	537710	540947	3600228		Pandoravirus(50.0%)	2	NA	NA
WP_004641379.1|537710_538988_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.3	9.6e-14
WP_004641376.1|539285_540947_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.5	5.8e-43
>prophage 38
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	556089	561628	3600228		Ralstonia_phage(100.0%)	8	NA	NA
WP_118901914.1|556089_557334_-	hypothetical protein	NA	Q6UAZ2	Ralstonia_phage	39.1	7.7e-16
WP_059212516.1|557403_557679_-	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_118901911.1|557671_558874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901908.1|559028_559301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901905.1|559318_559522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901902.1|559651_559897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004909669.1|559991_560276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901899.1|560314_561628_-	replication initiation factor domain-containing protein	NA	A0JC21	Ralstonia_phage	31.3	1.3e-21
>prophage 39
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	604941	608523	3600228		Salmonella_phage(50.0%)	3	NA	NA
WP_005088484.1|604941_607050_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.5	9.0e-09
WP_004641282.1|607283_607562_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_008941154.1|607905_608523_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	31.7	7.9e-14
>prophage 40
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	634640	643164	3600228		Rhodococcus_phage(25.0%)	9	NA	NA
WP_008941174.1|634640_635468_+	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	41.2	1.4e-10
WP_005086963.1|635523_636756_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	3.1e-102
WP_008941175.1|636744_636921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941176.1|637117_638527_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017396724.1|639016_639781_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	29.3	1.8e-15
WP_008941179.1|640040_640355_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_008941180.1|640367_640958_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005086949.1|641211_641583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171055819.1|641934_643164_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	5.6e-11
>prophage 41
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	665628	666848	3600228	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_087486619.1|665628_666848_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
>prophage 42
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	681723	682326	3600228		Staphylococcus_phage(100.0%)	1	NA	NA
WP_026056260.1|681723_682326_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.4	8.7e-42
>prophage 43
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	686304	695754	3600228		Catovirus(25.0%)	9	NA	NA
WP_008941202.1|686304_688248_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	28.4	1.3e-46
WP_115736358.1|688666_689485_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-21
WP_004641120.1|689481_690258_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_004641119.1|690257_690920_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_008941205.1|690987_691572_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004641115.1|691583_691871_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_005086869.1|691989_693906_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	34.1	2.6e-79
WP_005086867.1|693979_694996_-	magnesium and cobalt transporter CorA	NA	NA	NA	NA	NA
WP_008941208.1|695169_695754_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	37.0	7.0e-20
>prophage 44
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	708542	709244	3600228	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_004678526.1|708542_709244_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
>prophage 45
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	713126	714674	3600228		Klebsiella_phage(100.0%)	1	NA	NA
WP_005088327.1|713126_714674_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.1	1.3e-78
>prophage 46
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	738374	799985	3600228	protease,transposase	uncultured_virus(18.18%)	45	NA	NA
WP_004678526.1|738374_739076_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_004641016.1|739265_741476_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_005088313.1|741549_742305_-	DUF2314 domain-containing protein	NA	NA	NA	NA	NA
WP_005088311.1|742363_743251_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005086822.1|743312_743762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005086820.1|743774_743981_-	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_008941218.1|744019_746059_-	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	22.1	3.0e-33
WP_008941219.1|746250_748689_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.9	2.4e-69
WP_008941221.1|749268_750333_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_005086812.1|750398_751895_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_008941222.1|751909_752353_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005086808.1|752449_753445_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_017396695.1|753779_754712_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.6e-58
WP_004678526.1|755505_756207_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_010326927.1|766120_767146_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_008941224.1|767366_768662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640980.1|768817_769315_+	YcxB family protein	NA	NA	NA	NA	NA
WP_008941225.1|769356_769998_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005086792.1|770068_770965_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005086790.1|770956_771766_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008941226.1|771873_772782_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004640968.1|772809_774060_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_004640966.1|774175_774766_+	NAD(P)H:quinone oxidoreductase	NA	M1IDR7	Acanthocystis_turfacea_Chlorella_virus	35.2	6.6e-18
WP_004640964.1|774801_775614_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_115736360.1|775720_776503_+	NRDE family protein	NA	NA	NA	NA	NA
WP_118901873.1|776561_778760_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_004640957.1|778933_779722_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_017395723.1|779718_780168_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_004640952.1|780180_780399_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_008941231.1|780549_781173_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	29.1	3.0e-13
WP_171057898.1|781821_782364_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_005086774.1|782405_782999_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004640940.1|782998_784159_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_008941234.1|784240_785935_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_005088289.1|786528_788721_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004640930.1|788978_790310_+	trigger factor	NA	NA	NA	NA	NA
WP_004640929.1|790516_791122_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.6	2.4e-63
WP_004640927.1|791149_792460_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	8.6e-127
WP_005086756.1|792620_793337_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_008941237.1|793405_794662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941238.1|794812_796339_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_008941239.1|796521_797382_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004640918.1|797561_798470_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017396528.1|798500_799106_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099143725.1|799234_799985_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.8	1.6e-24
>prophage 47
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	806187	807453	3600228		Streptococcus_phage(100.0%)	1	NA	NA
WP_004640911.1|806187_807453_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.3	7.6e-96
>prophage 48
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	811584	813768	3600228		Moraxella_phage(100.0%)	1	NA	NA
WP_004640902.1|811584_813768_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	47.7	7.5e-176
>prophage 49
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	821381	821708	3600228	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_142028591.1|821381_821708_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	60.3	1.2e-13
>prophage 50
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	847624	850011	3600228	protease,transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_020846310.1|847624_848557_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_115736369.1|848913_849570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640844.1|849585_850011_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	47.3	7.3e-27
>prophage 51
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	854445	858175	3600228		Vibrio_phage(50.0%)	5	NA	NA
WP_005089121.1|854445_855291_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A0U4JGQ0	Vibrio_phage	36.5	9.2e-05
WP_171402604.1|855458_856775_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_004640826.1|856798_857350_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004640824.1|857433_857634_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004640823.1|857743_858175_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	2.0e-19
>prophage 52
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	867978	872468	3600228	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_008942384.1|867978_868947_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.3	1.6e-32
WP_004640806.1|868957_870859_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004640804.1|870911_871241_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_017396715.1|871340_872468_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	9.8e-95
>prophage 53
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	875879	877121	3600228		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_008942378.1|875879_877121_+	HAMP domain-containing histidine kinase	NA	B5LWN8	Feldmannia_species_virus	24.6	3.2e-14
>prophage 54
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	881084	887876	3600228		Paramecium_bursaria_Chlorella_virus(25.0%)	6	NA	NA
WP_008942375.1|881084_882245_+	nucleotide sugar dehydrogenase	NA	M1GX70	Paramecium_bursaria_Chlorella_virus	48.8	1.8e-99
WP_026056342.1|882408_883164_+	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	27.1	1.3e-10
WP_004675536.1|883195_884191_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_005083352.1|884206_884965_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_005083348.1|885026_885938_+	hypothetical protein	NA	A0A2H4UTT0	Bodo_saltans_virus	20.3	4.0e-06
WP_008942373.1|885974_887876_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	34.4	3.0e-56
>prophage 55
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	892228	894007	3600228	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_008942369.1|892228_894007_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.4	2.0e-17
>prophage 56
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	907309	912733	3600228		Bacillus_phage(33.33%)	5	NA	NA
WP_005083316.1|907309_907993_+	response regulator	NA	W8CYM9	Bacillus_phage	34.2	8.7e-30
WP_008942357.1|908046_909132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942356.1|909354_909951_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_008942355.1|909981_911424_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.1	1.6e-44
WP_017395573.1|911563_912733_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	33.2	8.5e-33
>prophage 57
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	935083	935989	3600228		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_004640707.1|935083_935989_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 58
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	952724	958837	3600228	transposase	uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_017396575.1|952724_956093_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	68.2	0.0e+00
WP_020846310.1|956060_956993_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_087486619.1|957618_958837_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
>prophage 59
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	966845	972271	3600228		Bordetella_phage(50.0%)	4	NA	NA
WP_017395388.1|966845_968051_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.6	3.0e-126
WP_008941680.1|968299_969757_-	amino acid permease	NA	NA	NA	NA	NA
WP_008941679.1|969825_970851_-	methyltransferase	NA	NA	NA	NA	NA
WP_004640659.1|970912_972271_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	48.9	2.2e-24
>prophage 60
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	975834	979053	3600228		Bacillus_virus(50.0%)	2	NA	NA
WP_100833968.1|975834_976656_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	30.1	7.0e-26
WP_100833967.1|976860_979053_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	45.5	1.2e-83
>prophage 61
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	985475	994196	3600228		Bacillus_phage(50.0%)	5	NA	NA
WP_004640629.1|985475_985859_+	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	29.4	1.9e-05
WP_004640626.1|985880_986243_+	response regulator	NA	W8CYM9	Bacillus_phage	34.2	2.5e-12
WP_004640625.1|986291_986828_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_008941668.1|986875_988957_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	6.6e-12
WP_118901840.1|989114_994196_+	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	37.9	5.3e-15
>prophage 62
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1006598	1007810	3600228		Salmonella_phage(100.0%)	1	NA	NA
WP_118901831.1|1006598_1007810_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.8	1.0e-25
>prophage 63
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1013497	1014409	3600228		Klosneuvirus(100.0%)	1	NA	NA
WP_100834273.1|1013497_1014409_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	29.4	2.1e-07
>prophage 64
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1020766	1022515	3600228	transposase	Faecalibacterium_phage(50.0%)	2	NA	NA
WP_010326927.1|1020766_1021792_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_118901819.1|1021804_1022515_-	NYN domain-containing protein	NA	A0A2P0VNQ4	Tetraselmis_virus	26.5	2.7e-05
>prophage 65
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1038089	1043370	3600228		Streptococcus_phage(50.0%)	3	NA	NA
WP_118901806.1|1038089_1040099_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.9	8.8e-38
WP_005083119.1|1040108_1040720_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_118901803.1|1040733_1043370_+	sensor histidine kinase KdpD	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.6	1.1e-08
>prophage 66
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1067515	1072345	3600228		Planktothrix_phage(50.0%)	5	NA	NA
WP_171055809.1|1067515_1068241_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.3	2.9e-31
WP_004640466.1|1068255_1068939_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005089384.1|1068940_1069684_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005083077.1|1069762_1070707_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109441418.1|1071160_1072345_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	35.6	2.0e-45
>prophage 67
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1075905	1078803	3600228	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_118901781.1|1075905_1078803_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.8e-145
>prophage 68
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1096360	1097632	3600228	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004640409.1|1096360_1097632_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	1.6e-93
>prophage 69
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1105969	1107850	3600228		Vibrio_phage(100.0%)	1	NA	NA
WP_004681517.1|1105969_1107850_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.1	1.1e-39
>prophage 70
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1124170	1127810	3600228		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_004640350.1|1124170_1125604_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.0e-40
WP_004640348.1|1125740_1126907_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_008941582.1|1126919_1127810_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	6.5e-17
>prophage 71
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1132889	1135137	3600228	transposase	Rhodococcus_phage(50.0%)	2	NA	NA
WP_004640318.1|1132889_1133780_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.3	2.9e-33
WP_005089444.1|1134204_1135137_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.3	7.4e-56
>prophage 72
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1145237	1147133	3600228		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_004640283.1|1145237_1147133_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.8	2.6e-108
>prophage 73
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1155438	1156041	3600228		Salmonella_phage(100.0%)	1	NA	NA
WP_100833910.1|1155438_1156041_+	nicotinamide mononucleotide transporter	NA	A0A0N7CDQ0	Salmonella_phage	29.8	1.3e-08
>prophage 74
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1165951	1168217	3600228	tRNA	Geobacillus_virus(50.0%)	2	NA	NA
WP_161414322.1|1165951_1166728_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.7	9.2e-36
WP_004640251.1|1167311_1168217_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.2	3.1e-91
>prophage 75
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1175588	1179724	3600228	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_100833903.1|1175588_1176545_-	M15 family metallopeptidase	NA	U5PVY5	Bacillus_phage	34.1	7.0e-09
WP_100833902.1|1176548_1176761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833901.1|1177656_1178424_+	OmpA family protein	NA	NA	NA	NA	NA
WP_118901750.1|1178454_1178718_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004645384.1|1178977_1179724_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.6e-13
>prophage 76
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1184860	1192358	3600228	transposase	Bacillus_virus(50.0%)	8	NA	NA
WP_087662167.1|1184860_1185607_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	7.3e-14
WP_142028593.1|1185780_1186119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833898.1|1186867_1187638_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100833897.1|1187634_1188330_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005089544.1|1188326_1188944_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.8	8.4e-16
WP_100833896.1|1188956_1190291_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.3	4.5e-30
WP_171265837.1|1190516_1191557_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075315071.1|1191566_1192358_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.7	3.1e-31
>prophage 77
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1201512	1201998	3600228		Synechococcus_phage(100.0%)	1	NA	NA
WP_100834271.1|1201512_1201998_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.3	3.8e-19
>prophage 78
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1219630	1220524	3600228		Leptospira_phage(100.0%)	1	NA	NA
WP_161418738.1|1219630_1220524_+	tyrosine recombinase	NA	S5W9T9	Leptospira_phage	25.2	3.9e-14
>prophage 79
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1223843	1226576	3600228		Bacillus_phage(100.0%)	1	NA	NA
WP_113996922.1|1223843_1226576_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	28.4	1.9e-91
>prophage 80
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1231827	1246333	3600228	transposase	Streptococcus_phage(28.57%)	14	NA	NA
WP_118901724.1|1231827_1232907_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	49.2	6.9e-90
WP_004757630.1|1232984_1233128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901721.1|1233163_1234102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640146.1|1234310_1234781_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_001223318.1|1235338_1236040_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_004640143.1|1236492_1237077_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_005084477.1|1237102_1238338_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075315118.1|1238330_1239017_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.8	1.3e-33
WP_118902247.1|1239100_1241539_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	45.9	6.7e-16
WP_118901718.1|1241527_1242484_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_005084487.1|1242623_1243646_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	27.2	5.0e-13
WP_005084488.1|1243792_1244590_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171456280.1|1244636_1245266_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.4	4.0e-29
WP_005089611.1|1245262_1246333_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.7	1.2e-78
>prophage 81
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1255235	1256210	3600228		Klosneuvirus(100.0%)	1	NA	NA
WP_005089620.1|1255235_1256210_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.5	7.3e-46
>prophage 82
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1266437	1272727	3600228	transposase	Burkholderia_phage(33.33%)	4	NA	NA
WP_118901694.1|1266437_1270268_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	52.1	3.3e-102
WP_118901691.1|1270361_1270838_-	DUF1643 domain-containing protein	NA	A0A0U2UUT5	Pseudomonas_phage	37.0	4.7e-22
WP_080591915.1|1270921_1271950_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_118901688.1|1272412_1272727_+	NGG1p interacting factor NIF3	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	32.0	6.8e-14
>prophage 83
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1277316	1281942	3600228		Hokovirus(50.0%)	3	NA	NA
WP_118901679.1|1277316_1280169_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.7	7.6e-11
WP_118901674.1|1280457_1281258_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_161404488.1|1281366_1281942_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A0X8WP26	Ralstonia_phage	30.7	5.8e-19
>prophage 84
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1286410	1287865	3600228		Cellulophaga_phage(50.0%)	2	NA	NA
WP_026070318.1|1286410_1287091_-	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	37.9	1.7e-30
WP_017394497.1|1287154_1287865_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	36.1	2.7e-34
>prophage 85
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1291067	1292141	3600228		Planktothrix_phage(100.0%)	1	NA	NA
WP_004640050.1|1291067_1292141_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.6e-31
>prophage 86
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1297713	1302615	3600228	transposase	Streptococcus_phage(25.0%)	7	NA	NA
WP_118901643.1|1297713_1298355_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	41.6	3.2e-34
WP_008941795.1|1298416_1298983_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_118901640.1|1298994_1299558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004907081.1|1299580_1300510_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	1.4e-51
WP_118901637.1|1300650_1301172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901634.1|1301106_1301589_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	34.2	3.3e-15
WP_005100823.1|1301589_1302615_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
>prophage 87
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1307458	1313377	3600228		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_008941800.1|1307458_1308835_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.9	1.2e-25
WP_034437472.1|1308945_1309401_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_118901631.1|1309554_1311372_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.3	1.3e-19
WP_005084579.1|1311444_1312308_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004640026.1|1312335_1312713_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_004640024.1|1312681_1313377_+	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	33.2	6.8e-22
>prophage 88
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1322130	1327758	3600228		Tupanvirus(66.67%)	4	NA	NA
WP_075315196.1|1322130_1322925_-	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	1.5e-25
WP_075316495.1|1322992_1324594_-	S8 family peptidase	NA	A0A2K9L568	Tupanvirus	36.6	7.5e-32
WP_171479088.1|1325019_1327053_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004639997.1|1327173_1327758_+	lipocalin family protein	NA	A0A2K9L662	Tupanvirus	34.8	1.0e-18
>prophage 89
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1333488	1396770	3600228	protease,tRNA,transposase	Streptococcus_phage(13.64%)	58	NA	NA
WP_004639988.1|1333488_1334622_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	1.4e-69
WP_118901606.1|1334693_1336331_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_118901603.1|1336423_1337443_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_118901601.1|1337467_1338589_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	3.5e-28
WP_118901599.1|1338640_1339333_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_118901597.1|1339299_1340508_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_118901595.1|1340590_1341616_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_004639978.1|1341672_1342578_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_171055803.1|1342584_1343484_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_034437454.1|1343616_1344798_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000760495.1|1345143_1345308_-	rubredoxin	NA	NA	NA	NA	NA
WP_008942042.1|1345660_1346098_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_008942041.1|1346258_1347785_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	39.4	9.8e-90
WP_118901592.1|1347937_1349389_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_005089695.1|1349719_1350628_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_075315226.1|1350673_1352287_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.4	5.8e-40
WP_004639959.1|1352484_1353000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089702.1|1353048_1353312_+	ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004639956.1|1353351_1354680_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005084639.1|1354785_1355775_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004678526.1|1356155_1356857_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_026057263.1|1357109_1358711_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_118901590.1|1358796_1359264_-	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004639950.1|1360912_1362334_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.7	1.6e-54
WP_118901587.1|1362609_1363587_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	8.9e-36
WP_004639946.1|1363590_1364130_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_005084648.1|1364174_1364723_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_118901584.1|1364706_1365255_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005084652.1|1365254_1366001_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-21
WP_004639933.1|1369852_1371043_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075315236.1|1371136_1371736_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.7	8.5e-21
WP_118901581.1|1371725_1372343_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.4	6.3e-11
WP_004639928.1|1372459_1373302_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	4.5e-36
WP_100834268.1|1373421_1374090_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	36.7	1.3e-25
WP_005100823.1|1374233_1375259_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_171055802.1|1375314_1375971_-	peptidase M15	NA	NA	NA	NA	NA
WP_004639922.1|1376146_1376476_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_118901578.1|1377373_1380013_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.0	4.9e-36
WP_004639915.1|1380631_1380850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075315262.1|1381051_1381984_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.3	2.2e-55
WP_026056278.1|1383632_1383860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639899.1|1384004_1384235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639896.1|1384524_1385136_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	55.3	2.8e-48
WP_075315264.1|1385140_1386439_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	46.2	2.4e-105
WP_075315266.1|1386605_1387706_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_118901574.1|1387973_1388624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075315270.1|1388641_1389607_+	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	27.4	3.5e-16
WP_075315272.1|1389708_1390296_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_075315274.1|1390420_1391863_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_075315276.1|1391922_1392417_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075315278.1|1392462_1392828_+	GFA family protein	NA	NA	NA	NA	NA
WP_008942017.1|1392864_1393224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639869.1|1393299_1393746_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	4.2e-17
WP_005084707.1|1393775_1393991_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005084709.1|1394135_1395143_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.1	5.3e-124
WP_118901570.1|1395340_1395820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901566.1|1395877_1396156_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	62.5	6.2e-19
WP_118901564.1|1396152_1396770_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	64.8	1.7e-64
>prophage 90
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1407387	1536178	3600228	portal,capsid,tRNA,terminase,protease,integrase,tail,transposase,head	uncultured_Caudovirales_phage(21.05%)	115	1511347:1511406	1534662:1535970
WP_118901554.1|1407387_1408212_+	protein kinase	NA	A0A1V0SH95	Hokovirus	41.6	6.2e-06
WP_118901551.1|1408884_1410297_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_118901548.1|1410338_1411979_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.4	7.5e-27
WP_118902239.1|1412127_1413321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084804.1|1413389_1414778_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	6.8e-98
WP_118901545.1|1414832_1415564_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_075315304.1|1415582_1416716_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075315305.1|1416720_1417209_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_080591915.1|1417358_1418387_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_118901542.1|1418406_1418874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396770.1|1418889_1419429_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_118901539.1|1419526_1420675_-	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	38.1	3.7e-65
WP_005084819.1|1420827_1421223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075315307.1|1421402_1421765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005084823.1|1421904_1422276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639644.1|1422428_1423202_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	3.4e-54
WP_118901536.1|1423312_1424143_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	2.6e-12
WP_005084828.1|1424290_1425220_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100833815.1|1425284_1427918_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_075315309.1|1428105_1430283_+	MFS transporter	NA	NA	NA	NA	NA
WP_004639634.1|1430285_1430687_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_005084835.1|1430826_1431795_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004639630.1|1431994_1432219_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_118901533.1|1432329_1434423_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_008941999.1|1434404_1436159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639623.1|1436172_1437189_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_004639622.1|1437544_1438114_+	elongation factor P	NA	NA	NA	NA	NA
WP_161412362.1|1438379_1440410_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_171265835.1|1440396_1440699_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_005089856.1|1440780_1441740_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_005089857.1|1441754_1442672_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_005089860.1|1442676_1444668_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_118902236.1|1444923_1445943_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	45.1	2.0e-78
WP_118901529.1|1445971_1446253_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_118901526.1|1446245_1446494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901523.1|1446490_1447117_-	3'-5' exoribonuclease	NA	A0A2I7QNM4	Vibrio_phage	36.0	8.3e-19
WP_118901519.1|1447113_1447464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901515.1|1447551_1447743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901512.1|1447745_1448051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901509.1|1448224_1448971_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_118901506.1|1449133_1449394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901502.1|1449440_1449941_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_118901498.1|1449937_1450222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901495.1|1450224_1451175_+	toprim domain-containing protein	NA	A0A0R6PHP8	Moraxella_phage	35.6	8.9e-49
WP_118901492.1|1451171_1453007_+	hypothetical protein	NA	A0A0R6PHT6	Moraxella_phage	28.2	1.6e-46
WP_118901486.1|1453377_1453842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901483.1|1454016_1454367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901480.1|1454369_1454594_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
WP_118901477.1|1454580_1454889_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	50.0	1.6e-20
WP_118901474.1|1454885_1455212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901470.1|1455442_1455904_+	hypothetical protein	NA	S4TNN3	Salmonella_phage	37.0	9.4e-12
WP_118901467.1|1455905_1457594_+|terminase	terminase large subunit	terminase	A0A2H4J6B3	uncultured_Caudovirales_phage	59.6	1.0e-196
WP_118901464.1|1457652_1458276_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PHN0	Moraxella_phage	40.7	2.7e-38
WP_118901461.1|1458272_1459598_+|capsid	phage major capsid protein	capsid	A0A0R6PCM7	Moraxella_phage	53.0	1.8e-124
WP_118901456.1|1460064_1461330_+|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	55.5	3.7e-127
WP_005196313.1|1461310_1461598_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	45.2	1.8e-13
WP_171479074.1|1461599_1461743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901453.1|1461739_1461922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901450.1|1461995_1462349_+|head	phage head closure protein	head	G3ENA2	Psychrobacter_phage	41.1	8.2e-16
WP_118901447.1|1462352_1462823_+	hypothetical protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	51.0	4.4e-33
WP_118901444.1|1462819_1463182_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_118901441.1|1463247_1463730_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	33.8	2.3e-13
WP_118902233.1|1464182_1464401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901435.1|1464755_1465529_+	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	42.0	5.1e-26
WP_118901432.1|1465618_1466131_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_142028598.1|1467195_1468515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901426.1|1468478_1469252_+	hypothetical protein	NA	J7I4Q7	Acinetobacter_phage	59.7	2.3e-42
WP_118901422.1|1469331_1470090_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	63.9	5.0e-87
WP_118901418.1|1470082_1470469_+	hypothetical protein	NA	J7I476	Acinetobacter_phage	66.4	6.6e-43
WP_118901414.1|1471009_1471495_+	DUF1833 family protein	NA	A0A0D4DCA4	Acinetobacter_phage	34.5	1.6e-22
WP_118901411.1|1471494_1471815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901408.1|1476901_1477807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901405.1|1477892_1478279_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	83.5	3.6e-57
WP_118902229.1|1478614_1479130_+	secretion activator protein	NA	A0A2H4J8Q8	uncultured_Caudovirales_phage	57.3	2.2e-54
WP_005274609.1|1479343_1480273_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
WP_142028600.1|1480952_1481924_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_111828210.1|1483363_1484305_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008941952.1|1484356_1486282_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002058090.1|1486499_1486982_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_002058125.1|1487006_1487999_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_002058083.1|1488034_1489114_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_016541979.1|1489124_1489688_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016541980.1|1489687_1490734_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_118901401.1|1490726_1491017_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_016541981.1|1491027_1492329_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017396274.1|1492411_1492654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941940.1|1495061_1496357_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	63.1	1.9e-163
WP_008941939.1|1496356_1496842_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	55.4	4.1e-42
WP_142028601.1|1497306_1498451_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_008941937.1|1498752_1498995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002047802.1|1499088_1499295_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008941935.1|1499392_1500874_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.5	1.3e-33
WP_008941934.1|1500873_1502073_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_118902226.1|1502157_1503303_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_111828330.1|1503303_1503849_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_118901391.1|1503949_1507390_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_008941927.1|1509364_1511128_+	ATP-dependent helicase	NA	A0A1B1IWE9	uncultured_Mediterranean_phage	23.8	1.3e-05
1511347:1511406	attL	TGAACCGTACCGGGTTTGTCGGAGACTTTTTTATTTAAGTTAAGCCACCTGACCTAACGG	NA	NA	NA	NA
WP_087486619.1|1511385_1512605_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_008941922.1|1514608_1515058_-	cyanase	NA	NA	NA	NA	NA
WP_008303564.1|1515338_1516148_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_008941921.1|1516199_1517924_+	bifunctional protein-serine/threonine kinase/phosphatase	NA	D7F602	Apocheima_cinerarium_nucleopolyhedrovirus	23.0	6.9e-07
WP_005089862.1|1519684_1519861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901388.1|1520198_1520408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161403048.1|1520897_1521017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639601.1|1521792_1522476_-	pirin family protein	NA	NA	NA	NA	NA
WP_004639599.1|1522668_1524012_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	79.4	7.6e-54
WP_004639597.1|1524242_1524632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639596.1|1524801_1526832_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_118901383.1|1527176_1528382_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.5	7.3e-64
WP_118901380.1|1529428_1530587_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.1	1.5e-50
WP_005082417.1|1530853_1531120_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005082419.1|1531235_1532243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901373.1|1532248_1533445_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_087486619.1|1533462_1534681_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_080591915.1|1535149_1536178_+|transposase	transposase	transposase	NA	NA	NA	NA
1534662:1535970	attR	CCGTTAGGTCAGGTGGCTTAACTTAAATAAAAAAGTCTCCGACAAACCCGGTACGGTTCAAGCAGTAGAGAGAGCTTGAGCAAGCGGGTTAAAGGGAAGGTTCATATAATTTCCTCTTAGCAGAAATTTAGGCAATAAAGTGCCTGCATTGATGATTCAAAGGTCATCAATGGCTGTTAATCAAAGAGGATATTCATCGATTCGATTTATTTAGGCACGAGAGAATACCAGACGCAATTCATAGTAAATGCGTAATTGATTTTCTGATGAGAATGGGCTAGTTTGTATTTGTATACGCTTCAATGTCTGAGTTCATTTGTGAATCACTCATTCATATGATCGTGATAACAATCAATGAGTTTGATCGACTGGAATCTCTCCAACTCATTTCAATATCTAATAAATATATTCATATAGATAAATATAATTAAATAGGACTTACGCATTGACGGATTCAAAAAAGTATTAAAATAGTTTATAAAGTATCTGTGATCAGACGAACTAAACATGCTTCTACAGCAACTTGTACATTACCCATTTATATGGGCTTTCTCATGACAGAACCGAACTCTATTAGCTGCACACAACTTGCCGAGACTTATAATATCTCGCATGATAGTGTAAATCGCTTTCTAGAGCGTGAAGACTACACACCTCACGACCTATATCAAGAAGCAATTCAACATATTGATAATAATAAACTTATAGTCAGTATTGATGATACTGTTTTAGATAAACCATATAGTCAACATATGGACTTGGTTAGCTATTTTTGGTCAGGCAAACACCACCGATCCGTCAAGGGGATTAATCTCATTACCTTGTATGCGACAGATCAGAATGGTCAAAATATTCCAATTAATTTCCGAATTTATGACAAATCTGAGGGTAAAACCAAGAATGATTACTTTATGGATATGTTAAGTGAAGTACTTAGTTGGGGTGCAAAGATTCAATTTATTACAGGTGATAGTTGGTATTCATCGACTGCAAATCTAAAAACCATAAGAAAACATGGTATTCGATTTATGTTTGGTATCGACTGTAACCGTAAGGTTTCCCCTGAAAAAGGACAATGGTTTCAACTGCGTTTATTGCCGAATTTCCATCAGGGTCAAGTGGTCTGGCTCAAAGATTTTGGCTTTGTACAATTATTTAAGACTCAGTTAAAAGAACAGCAGAGGTTTTATATTGTGTATCAAGATGAAGATGATTTATTGTCCTTTGAGGGTTTTCATGAATTACATTCAAGTCATTGGAAAATAGAACAATATCACCGAGTGATTAAACAGGTTTGTCATATTGAAAA	NA	NA	NA	NA
>prophage 91
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1542464	1613142	3600228	transposase	Escherichia_phage(45.45%)	63	NA	NA
WP_017396539.1|1542464_1543505_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.6	2.1e-59
WP_008941908.1|1543684_1544806_+	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	42.1	1.2e-41
WP_118901367.1|1544947_1545862_+	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_118901364.1|1545974_1546505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023274801.1|1546552_1546897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028602.1|1546930_1547272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087486619.1|1547317_1548537_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_118901357.1|1548584_1549094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901354.1|1549102_1549330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901351.1|1549464_1549722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901348.1|1550401_1551337_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_004677569.1|1551397_1551658_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_004677567.1|1551729_1553082_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	70.9	5.9e-30
WP_004677565.1|1553084_1554005_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_035328354.1|1554320_1554767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118901345.1|1554815_1556033_+	TolC family protein	NA	NA	NA	NA	NA
WP_078390278.1|1556025_1557495_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_118901339.1|1557512_1560647_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_004677556.1|1560659_1560995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004677554.1|1561037_1561751_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_078390275.1|1561761_1562445_+	transmembrane anchor protein	NA	NA	NA	NA	NA
WP_004677549.1|1563058_1564366_+	MFS transporter	NA	NA	NA	NA	NA
WP_004677547.1|1564365_1564800_+	DedA family protein	NA	NA	NA	NA	NA
WP_171479075.1|1565007_1566138_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_087486619.1|1566106_1567325_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_118901335.1|1568035_1569073_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	32.6	7.5e-49
WP_004639595.1|1569483_1570374_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005082450.1|1570528_1571590_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_017394846.1|1571586_1572222_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_004639588.1|1572258_1572960_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004639587.1|1573068_1574406_+	aromatic acid/H+ symport family MFS transporter	NA	S4TR35	Salmonella_phage	27.2	7.7e-06
WP_017394847.1|1574490_1575747_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_017394848.1|1576026_1577412_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017394849.1|1577408_1578080_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_087486619.1|1579158_1580378_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_115736390.1|1581375_1582200_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_118901331.1|1582340_1583639_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017394859.1|1583833_1584517_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017394858.1|1584531_1586187_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005082473.1|1586291_1587086_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017394857.1|1587233_1588046_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_087486619.1|1588578_1589798_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_005089913.1|1590070_1591426_-	dihydroorotase	NA	NA	NA	NA	NA
WP_005089914.1|1591415_1591976_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_005089916.1|1591997_1592417_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_005089918.1|1592410_1593313_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_008941380.1|1593423_1594137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089922.1|1594143_1594542_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_005089924.1|1594557_1595781_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005082506.1|1595844_1596669_-	IclR family transcriptional regulator PcaU	NA	NA	NA	NA	NA
WP_005089926.1|1596919_1597606_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_005089928.1|1597617_1598271_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_008941379.1|1598403_1599612_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_008941378.1|1599620_1600976_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_008941377.1|1600972_1601758_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_005082520.1|1601800_1603153_+	MFS transporter	NA	NA	NA	NA	NA
WP_005082521.1|1603179_1603593_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_005082522.1|1603603_1604329_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_005089939.1|1604341_1604971_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_161401297.1|1605045_1605879_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.2	3.4e-20
WP_087486619.1|1606188_1607408_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_008941374.1|1608730_1610059_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_080591915.1|1612113_1613142_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 92
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1624410	1627090	3600228	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_005089444.1|1624410_1625343_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.3	7.4e-56
WP_171479089.1|1625403_1626222_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008941361.1|1626274_1627090_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.7e-30
>prophage 93
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1635834	1637373	3600228		Catovirus(100.0%)	1	NA	NA
WP_005089962.1|1635834_1637373_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.2	6.9e-91
>prophage 94
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1655681	1662539	3600228		Leptospira_phage(50.0%)	5	NA	NA
WP_008941347.1|1655681_1658807_-	AdeB/AdeJ family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.3	5.0e-64
WP_005089991.1|1658803_1659946_-	AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	23.7	4.6e-07
WP_005089992.1|1660091_1660823_+	efflux system response regulator transcription factor AdeR	NA	W8CYM9	Bacillus_phage	31.6	6.7e-28
WP_005089995.1|1660812_1661898_+	two-component sensor histidine kinase AdeS	NA	NA	NA	NA	NA
WP_017396341.1|1661990_1662539_+	lipocalin family protein	NA	M1PB32	Moumouvirus	35.1	1.7e-15
>prophage 95
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1670220	1670916	3600228		Bacillus_phage(100.0%)	1	NA	NA
WP_017395079.1|1670220_1670916_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.5	3.0e-30
>prophage 96
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1678991	1679921	3600228		Morganella_phage(100.0%)	1	NA	NA
WP_008941335.1|1678991_1679921_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	32.7	1.8e-38
>prophage 97
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1687545	1690125	3600228		Cronobacter_phage(100.0%)	1	NA	NA
WP_008941329.1|1687545_1690125_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.4	2.7e-124
>prophage 98
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1712225	1712945	3600228		Bacillus_virus(100.0%)	1	NA	NA
WP_026056330.1|1712225_1712945_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	2.1e-13
>prophage 99
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1724888	1806051	3600228	protease,transposase	Lake_Baikal_phage(11.76%)	72	NA	NA
WP_118901311.1|1724888_1726328_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	37.4	7.2e-26
WP_004639436.1|1726390_1726729_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005082691.1|1726746_1728606_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.3	3.6e-102
WP_005090085.1|1728644_1729163_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005082695.1|1729312_1729633_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	3.3e-24
WP_004639432.1|1729662_1730049_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.8	1.6e-52
WP_005090087.1|1730128_1731346_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	28.0	2.5e-27
WP_004639430.1|1731347_1731821_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_008941313.1|1731929_1732577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639427.1|1732790_1733246_+	phasin family protein	NA	NA	NA	NA	NA
WP_004639426.1|1733415_1733688_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	2.2e-24
WP_008941312.1|1733827_1735699_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_100222743.1|1735803_1737028_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	4.6e-21
WP_004639424.1|1737086_1737896_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_118901308.1|1738331_1738814_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_005090091.1|1738925_1739969_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.5	8.7e-114
WP_004639420.1|1740148_1740577_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_004639419.1|1740560_1741262_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005090093.1|1741273_1742131_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_004639417.1|1742184_1742919_+	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_005090094.1|1743086_1745777_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005090096.1|1745940_1747215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639414.1|1747307_1747574_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005090099.1|1747787_1748453_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_004639412.1|1748465_1748978_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_005090100.1|1748990_1749779_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005082727.1|1749889_1750243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639407.1|1750822_1752352_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_005082733.1|1752576_1753968_+	3-oxoacyl-ACP reductase	NA	A9YVT8	Ostreococcus_tauri_virus	33.1	2.7e-09
WP_004639405.1|1754033_1754888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026056319.1|1754972_1756226_+	serine hydrolase	NA	NA	NA	NA	NA
WP_005090107.1|1759641_1760265_+|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
WP_005090109.1|1760266_1760848_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005090111.1|1760975_1762466_+	SmvA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_005090113.1|1762546_1763236_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_118901305.1|1763352_1764240_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_118901302.1|1764236_1764830_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004639395.1|1764829_1765213_-	DUF2237 domain-containing protein	NA	NA	NA	NA	NA
WP_118901298.1|1765352_1766540_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_005082755.1|1766705_1766933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082757.1|1766982_1767366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639391.1|1767582_1768161_+	nitroreductase	NA	NA	NA	NA	NA
WP_118901295.1|1768205_1769279_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005082761.1|1769408_1769864_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005090259.1|1769903_1771043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005090261.1|1771042_1771522_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_004639386.1|1771640_1772648_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004639385.1|1772649_1773243_+	CvpA family protein	NA	NA	NA	NA	NA
WP_005090262.1|1773283_1774822_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.0	9.6e-85
WP_171455241.1|1774916_1776806_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_035375233.1|1776823_1777621_+	PaaX family transcriptional regulator	NA	NA	NA	NA	NA
WP_113997201.1|1777744_1778728_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_118901289.1|1778763_1779177_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004639378.1|1779301_1780078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639377.1|1780090_1781221_+	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	25.3	1.1e-24
WP_118901287.1|1781246_1782167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125317018.1|1782288_1783854_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.2	1.9e-24
WP_161595262.1|1783903_1784560_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	35.7	4.9e-22
WP_142028606.1|1785824_1786091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640153.1|1786021_1786414_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_118901276.1|1786502_1788518_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_118901273.1|1788631_1789531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639373.1|1789636_1790458_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_161401243.1|1790454_1791267_-	TrmJ/YjtD family RNA methyltransferase	NA	NA	NA	NA	NA
WP_008941295.1|1791304_1794868_-	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	35.7	2.8e-172
WP_004639369.1|1796444_1797680_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004639368.1|1797834_1798254_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_004639367.1|1798250_1798739_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	9.6e-23
WP_118901269.1|1798793_1801934_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.9e-71
WP_075315691.1|1801935_1803126_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_142028608.1|1804379_1804982_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_020846310.1|1805118_1806051_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
>prophage 100
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1819061	1820132	3600228		Planktothrix_phage(100.0%)	1	NA	NA
WP_118902300.1|1819061_1820132_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	6.6e-32
>prophage 101
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1837102	1840204	3600228		Salicola_phage(33.33%)	4	NA	NA
WP_171055794.1|1837102_1837933_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.9e-43
WP_004639324.1|1838118_1838361_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000126912.1|1838738_1838951_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
WP_004639323.1|1839052_1840204_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	3.4e-50
>prophage 102
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1847913	1852435	3600228		Brevibacillus_phage(33.33%)	5	NA	NA
WP_004639316.1|1847913_1848696_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	27.2	6.3e-16
WP_004639315.1|1848692_1849580_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.6	6.7e-14
WP_005090353.1|1849638_1850268_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_118902320.1|1850282_1850711_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004639312.1|1850707_1852435_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.8	1.5e-54
>prophage 103
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1861366	1863718	3600228	tRNA	Equid_gammaherpesvirus(50.0%)	3	NA	NA
WP_005090364.1|1861366_1862080_+	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	46.4	7.2e-51
WP_171055793.1|1862076_1863201_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_005080470.1|1863205_1863718_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	33.0	2.9e-06
>prophage 104
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1866871	1867174	3600228		Burkholderia_phage(100.0%)	1	NA	NA
WP_004639292.1|1866871_1867174_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	40.7	1.0e-11
>prophage 105
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1876471	1877134	3600228		uncultured_virus(100.0%)	1	NA	NA
WP_118902326.1|1876471_1877134_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	42.9	8.7e-51
>prophage 106
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1886185	1887411	3600228	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_100222743.1|1886185_1887411_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	4.6e-21
>prophage 107
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1915650	1920770	3600228	protease	uncultured_Mediterranean_phage(25.0%)	6	NA	NA
WP_005080553.1|1915650_1916064_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	47.1	9.0e-14
WP_125316749.1|1916120_1916309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639237.1|1916468_1916591_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_004639236.1|1916687_1918973_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.2	1.5e-163
WP_005090434.1|1918972_1919335_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	57.5	1.5e-25
WP_005080559.1|1919726_1920770_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	45.7	7.9e-83
>prophage 108
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1927710	1931617	3600228		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_004639226.1|1927710_1929348_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.8	2.2e-151
WP_004639225.1|1929378_1930236_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.1e-50
WP_004639224.1|1930327_1931617_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.5	1.1e-137
>prophage 109
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1940564	1941674	3600228		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_026056359.1|1940564_1941674_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.6	8.9e-32
>prophage 110
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1953409	1954339	3600228	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_005274609.1|1953409_1954339_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
>prophage 111
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1970784	1971663	3600228		Bacillus_virus(100.0%)	1	NA	NA
WP_004639185.1|1970784_1971663_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	2.5e-37
>prophage 112
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	1988318	2000043	3600228	transposase	Escherichia_phage(25.0%)	9	NA	NA
WP_087486619.1|1988318_1989538_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_026056311.1|1989901_1990858_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008941399.1|1990961_1991864_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	40.4	2.2e-49
WP_017396624.1|1991860_1993852_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_008941401.1|1993863_1994667_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_008941402.1|1994676_1996278_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	70.8	6.0e-21
WP_017396625.1|1996302_1997475_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004639168.1|1997644_1998238_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008941404.1|1998348_2000043_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.8	1.8e-28
>prophage 113
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2019987	2021079	3600228		Pandoravirus(100.0%)	1	NA	NA
WP_005090564.1|2019987_2021079_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	44.4	1.9e-79
>prophage 114
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2042566	2043658	3600228		Klebsiella_phage(100.0%)	1	NA	NA
WP_004639065.1|2042566_2043658_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	49.1	6.6e-80
>prophage 115
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2048863	2050450	3600228		uncultured_virus(100.0%)	1	NA	NA
WP_005090597.1|2048863_2050450_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	61.5	3.0e-105
>prophage 116
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2068260	2069634	3600228		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004639024.1|2068260_2069634_+	AarF/ABC1/UbiB kinase family protein	NA	A0A2P0VMP1	Tetraselmis_virus	22.9	1.3e-08
>prophage 117
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2073977	2075216	3600228		Catovirus(100.0%)	1	NA	NA
WP_118902362.1|2073977_2075216_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	35.3	6.8e-49
>prophage 118
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2085226	2085976	3600228		Flavobacterium_phage(100.0%)	1	NA	NA
WP_004638991.1|2085226_2085976_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	38.5	5.8e-19
>prophage 119
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2099755	2102229	3600228		Tupanvirus(50.0%)	5	NA	NA
WP_008941473.1|2099755_2100763_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9L5H6	Tupanvirus	32.2	1.4e-47
WP_118902397.1|2100826_2101195_+	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_075315538.1|2101238_2101589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638951.1|2101598_2101883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638950.1|2101917_2102229_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	45.5	3.5e-18
>prophage 120
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2139501	2141526	3600228		Bacteriophage(100.0%)	1	NA	NA
WP_118902424.1|2139501_2141526_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	34.0	1.7e-41
>prophage 121
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2147501	2149208	3600228		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_100833707.1|2147501_2149208_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	21.5	5.4e-12
>prophage 122
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2153821	2157719	3600228	capsid	Escherichia_phage(50.0%)	2	NA	NA
WP_118902430.1|2153821_2155678_-|capsid	phage capsid protein	capsid	A0A1D8EQB5	Escherichia_phage	37.2	1.5e-108
WP_005080980.1|2155868_2157719_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.7	2.1e-25
>prophage 123
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2176869	2178036	3600228		Staphylococcus_phage(100.0%)	1	NA	NA
WP_118902433.1|2176869_2178036_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.1	3.6e-124
>prophage 124
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2183233	2183960	3600228		Lactococcus_phage(100.0%)	2	NA	NA
WP_004638805.1|2183233_2183446_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	68.3	9.0e-18
WP_004638802.1|2183750_2183960_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	4.4e-17
>prophage 125
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2196171	2197197	3600228	transposase	Faecalibacterium_phage(100.0%)	1	NA	NA
WP_005100823.1|2196171_2197197_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
>prophage 126
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2207243	2208242	3600228		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020846396.1|2207243_2208242_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	47.2	8.7e-79
>prophage 127
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2211511	2214352	3600228		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_142028613.1|2211511_2214352_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	53.5	1.6e-290
>prophage 128
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2220291	2222774	3600228		Bacillus_phage(50.0%)	3	NA	NA
WP_005081075.1|2220291_2221653_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	9.9e-17
WP_004638671.1|2221656_2222316_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005081078.1|2222408_2222774_-	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	5.7e-12
>prophage 129
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2235544	2238202	3600228		Amsacta_moorei_entomopoxvirus(50.0%)	3	NA	NA
WP_005081102.1|2235544_2236309_-	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.4	2.3e-15
WP_005081105.1|2236299_2237256_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005081107.1|2237248_2238202_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	42.9	3.9e-76
>prophage 130
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2259213	2260512	3600228		Moraxella_phage(100.0%)	1	NA	NA
WP_005081125.1|2259213_2260512_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PHP6	Moraxella_phage	48.0	7.8e-104
>prophage 131
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2265300	2267064	3600228	transposase	Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_118902476.1|2265300_2265984_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.0	1.8e-51
WP_005064486.1|2266131_2267064_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
>prophage 132
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2270601	2280679	3600228	transposase	Pseudomonas_phage(33.33%)	10	NA	NA
WP_004638625.1|2270601_2271690_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	50.0	6.7e-08
WP_161595263.1|2272066_2272288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902489.1|2272311_2273476_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.2	3.4e-50
WP_004638623.1|2273900_2275154_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.8	1.1e-97
WP_118902492.1|2275534_2276227_+	3'-5' exonuclease	NA	A0A059VJT9	Pseudomonas_phage	39.8	1.8e-35
WP_005081155.1|2276355_2276913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902495.1|2277401_2277905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005081178.1|2278161_2279097_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	8.3e-23
WP_004638607.1|2279093_2279867_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_118902499.1|2279863_2280679_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	36.1	5.0e-40
>prophage 133
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2284022	2284634	3600228		Synechococcus_phage(100.0%)	1	NA	NA
WP_004638601.1|2284022_2284634_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	43.9	1.7e-21
>prophage 134
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2290100	2303427	3600228		Catovirus(50.0%)	10	NA	NA
WP_100833553.1|2290100_2291807_+	DUF4394 domain-containing protein	NA	A0A167R2B9	Powai_lake_megavirus	36.1	4.5e-27
WP_004638594.1|2291871_2292978_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_100833552.1|2293024_2296879_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	25.2	1.2e-43
WP_004638592.1|2297388_2297964_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_005090936.1|2298184_2298400_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004638589.1|2298456_2299635_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	34.6	1.0e-46
WP_118902508.1|2299754_2300774_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004638587.1|2300777_2301365_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005090946.1|2301409_2301628_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_005090948.1|2301861_2303427_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	29.8	5.6e-24
>prophage 135
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2309320	2311036	3600228		Acinetobacter_phage(100.0%)	1	NA	NA
WP_005082137.1|2309320_2311036_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.8	5.7e-78
>prophage 136
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2318941	2389993	3600228	tRNA,protease,integrase,tail,transposase	Moraxella_phage(21.74%)	63	2359025:2359041	2379840:2379856
WP_125269079.1|2318941_2320161_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_005082125.1|2320545_2322273_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	58.0	1.5e-187
WP_004638567.1|2322440_2322950_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.7	1.2e-12
WP_005082123.1|2322971_2323688_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_005082121.1|2323894_2324548_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_118902544.1|2324606_2325230_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_118902547.1|2325277_2325895_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_118902550.1|2325929_2326787_-	DMT family transporter	NA	NA	NA	NA	NA
WP_161418731.1|2326865_2327333_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_004638560.1|2327411_2328356_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_118902556.1|2328362_2330336_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.5	4.8e-81
WP_118902559.1|2330325_2330802_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_118902563.1|2330919_2331828_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_004638556.1|2331937_2332246_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005082104.1|2332344_2332788_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_118902566.1|2332820_2333537_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_118902570.1|2333777_2334275_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_008940984.1|2334414_2335416_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008940983.1|2335559_2337611_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_004638549.1|2337945_2338782_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004638548.1|2338940_2341319_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.5e-174
WP_005082095.1|2341385_2342165_+	RDD family protein	NA	NA	NA	NA	NA
WP_004638545.1|2342462_2343533_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004638544.1|2343536_2345519_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004638543.1|2345523_2346144_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_004638542.1|2346143_2346473_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_004638541.1|2346483_2347362_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_004638540.1|2347549_2347933_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000090661.1|2347944_2348172_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_004638539.1|2348184_2348631_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_008940979.1|2348745_2349045_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_118902573.1|2349226_2350672_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	50.8	6.8e-117
WP_005090979.1|2350736_2351807_+	alanine racemase	NA	NA	NA	NA	NA
WP_005090981.1|2351844_2352270_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_118902576.1|2352316_2353051_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005090986.1|2353067_2353847_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005090989.1|2353843_2354446_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_118902579.1|2354518_2356069_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_171065860.1|2356720_2357284_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_004638526.1|2357655_2358975_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.7	6.3e-69
2359025:2359041	attL	CAACTTAGCGATTAAAT	NA	NA	NA	NA
WP_118902582.1|2359035_2360202_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_118902585.1|2361040_2362066_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171479076.1|2362321_2364970_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.9	7.4e-77
WP_118902591.1|2365254_2366457_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PHZ3	Moraxella_phage	51.8	1.6e-106
WP_118902594.1|2366692_2367403_+	hypothetical protein	NA	A0A2H4JDZ2	uncultured_Caudovirales_phage	28.5	1.6e-05
WP_118902598.1|2367495_2368140_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	53.3	1.8e-61
WP_118902601.1|2368267_2368894_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	37.6	2.2e-24
WP_118902604.1|2368908_2370204_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	51.0	3.8e-127
WP_118902607.1|2370209_2370428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100222603.1|2370859_2371950_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_118902608.1|2372186_2372810_-	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	62.0	4.8e-67
WP_118902609.1|2372874_2373087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142028616.1|2373138_2373450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902611.1|2373538_2374084_-	DUF4376 domain-containing protein	NA	A0A172Q083	Acinetobacter_phage	38.2	4.5e-29
WP_118902613.1|2374080_2385612_-|tail	phage tail protein	tail	A0A0R6PID2	Moraxella_phage	63.8	0.0e+00
2379840:2379856	attR	ATTTAATCGCTAAGTTG	NA	NA	NA	NA
WP_118902616.1|2385670_2386324_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	48.4	1.3e-43
WP_171479077.1|2386340_2386517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902618.1|2386576_2387332_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	58.0	5.2e-84
WP_118902620.1|2387340_2388060_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	66.5	7.1e-91
WP_118902623.1|2388113_2388458_-|tail	phage tail protein	tail	A0A1V0E890	Vibrio_phage	40.5	4.7e-16
WP_118902627.1|2388661_2389312_-	DUF1353 domain-containing protein	NA	A0A0E3Y4V5	Fusobacterium_phage	33.0	2.2e-06
WP_118902630.1|2389415_2389802_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	41.2	6.0e-20
WP_118902633.1|2389804_2389993_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	53.3	5.9e-13
>prophage 137
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2395821	2434990	3600228	terminase,capsid	Acinetobacter_phage(68.42%)	61	NA	NA
WP_118902642.1|2395821_2396169_-	hypothetical protein	NA	A0A0N7IRG4	Acinetobacter_phage	71.9	7.0e-44
WP_118902646.1|2396244_2396586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902650.1|2396589_2397054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118903128.1|2397187_2398072_-	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	52.9	7.0e-56
WP_118902653.1|2398146_2398317_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_118902656.1|2398432_2398663_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_118902663.1|2399134_2399656_-	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	59.2	1.1e-43
WP_118902668.1|2399714_2400644_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.8	6.2e-55
WP_118902671.1|2400787_2401186_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	70.5	1.9e-48
WP_118902674.1|2401187_2401571_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	41.4	2.1e-17
WP_118902677.1|2401545_2401944_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	72.5	1.4e-48
WP_118902679.1|2402116_2402485_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	78.7	1.5e-52
WP_118902683.1|2402484_2402865_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	81.0	2.0e-52
WP_118902686.1|2402868_2403237_-	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	58.3	6.3e-27
WP_118902689.1|2403280_2404231_-	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	87.3	2.5e-160
WP_118902693.1|2404244_2405036_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	71.5	6.7e-82
WP_118903130.1|2405136_2405688_-	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	65.5	6.8e-17
WP_118902696.1|2405965_2407069_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	51.0	2.4e-101
WP_118902699.1|2407072_2408425_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	83.6	1.6e-216
WP_118902702.1|2408465_2409752_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	89.4	7.0e-222
WP_118902705.1|2409726_2410230_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	69.5	1.6e-57
WP_118902708.1|2410288_2410930_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	81.7	4.5e-105
WP_118902711.1|2410898_2411360_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	69.3	4.2e-52
WP_118902714.1|2411406_2412477_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	31.4	7.7e-33
WP_118902717.1|2412564_2412849_-	DUF968 domain-containing protein	NA	A0A1B1P9J2	Acinetobacter_phage	58.8	3.4e-20
WP_142028617.1|2413060_2413729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902728.1|2414211_2414769_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	47.2	5.8e-40
WP_171479078.1|2414795_2414954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902731.1|2414950_2415379_-	hypothetical protein	NA	G3EN88	Psychrobacter_phage	45.1	3.7e-26
WP_118902734.1|2415375_2415579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902737.1|2416255_2417005_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	71.3	3.9e-100
WP_171479079.1|2417001_2418027_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	43.6	1.3e-32
WP_118902740.1|2418056_2418275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902743.1|2418288_2418639_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	82.6	1.1e-47
WP_118902746.1|2418635_2418932_-	hypothetical protein	NA	A0A0D4DCL5	Acinetobacter_phage	71.1	2.6e-31
WP_118902749.1|2418928_2419366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902752.1|2419413_2419677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902756.1|2419673_2419907_-	XRE family transcriptional regulator	NA	M4SQA4	Psychrobacter_phage	40.9	6.0e-07
WP_118902759.1|2420037_2420787_+	LexA family transcriptional regulator	NA	M4T3N8	Psychrobacter_phage	31.1	1.1e-22
WP_118902762.1|2420826_2421129_+	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	80.6	8.0e-36
WP_118902765.1|2421136_2421442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902768.1|2422209_2422536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902772.1|2422583_2423042_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	51.1	5.5e-28
WP_118902775.1|2423041_2423296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902778.1|2423292_2423622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902781.1|2423624_2424746_+	ATP-binding protein	NA	A0A0P0HSM9	Acinetobacter_phage	84.2	1.6e-177
WP_118902785.1|2424742_2425420_+	DUF3820 family protein	NA	A0A0A1IWL5	Pseudomonas_phage	38.4	1.2e-31
WP_118902788.1|2425424_2426513_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	43.9	1.3e-59
WP_118902791.1|2426655_2427357_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_118902795.1|2427353_2427674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902798.1|2427683_2428133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902801.1|2428122_2428314_+	hypothetical protein	NA	A0A220NQN5	Acinetobacter_phage	73.7	2.5e-19
WP_118902805.1|2428313_2428538_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_118902809.1|2428538_2428754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638520.1|2428963_2430244_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005082058.1|2430477_2430741_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	9.1e-12
WP_017396200.1|2430792_2431359_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	44.7	3.7e-26
WP_075315785.1|2431398_2431779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902812.1|2431995_2432550_+	cytochrome b	NA	NA	NA	NA	NA
WP_075315786.1|2432593_2433592_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_118902815.1|2433670_2434990_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.0	5.4e-60
>prophage 138
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2447966	2456041	3600228	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_125269079.1|2447966_2449185_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_001086304.1|2450153_2450423_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_075315796.1|2450505_2452080_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.3	1.4e-67
WP_004638502.1|2452185_2453472_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005082033.1|2454074_2454947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118902835.1|2455015_2456041_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.5	4.5e-30
>prophage 139
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2460564	2461947	3600228		Pandoravirus(100.0%)	1	NA	NA
WP_004638491.1|2460564_2461947_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.4	4.5e-41
>prophage 140
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2469413	2470643	3600228		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_118902851.1|2469413_2470643_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	44.0	1.5e-80
>prophage 141
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2478268	2479450	3600228		Pithovirus(100.0%)	1	NA	NA
WP_004638477.1|2478268_2479450_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	27.7	2.1e-07
>prophage 142
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2490015	2502523	3600228		Acinetobacter_phage(71.43%)	11	NA	NA
WP_100833510.1|2490015_2491266_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.0	6.9e-25
WP_100833509.1|2491265_2492834_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	56.3	6.4e-161
WP_171055742.1|2492991_2494407_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_171261754.1|2495035_2495611_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	94.8	3.7e-106
WP_075315869.1|2495972_2497334_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_075315870.1|2497427_2498222_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_118902860.1|2498502_2499552_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	87.5	2.0e-166
WP_118902864.1|2499561_2500368_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	89.9	5.0e-133
WP_118902867.1|2500560_2501034_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_118903137.1|2501194_2501884_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	81.7	3.4e-98
WP_017394508.1|2501974_2502523_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	94.5	6.4e-92
>prophage 143
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2511417	2515210	3600228		Acaryochloris_phage(50.0%)	3	NA	NA
WP_075315877.1|2511417_2512080_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_005091034.1|2512258_2513503_-	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_118902879.1|2513617_2515210_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.3e-15
>prophage 144
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2519145	2523834	3600228		Lactobacillus_phage(50.0%)	2	NA	NA
WP_118902890.1|2519145_2522208_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	31.9	8.2e-19
WP_118902893.1|2522475_2523834_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.7	3.5e-38
>prophage 145
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2529385	2530222	3600228		Streptococcus_phage(100.0%)	1	NA	NA
WP_026070384.1|2529385_2530222_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.6	4.0e-45
>prophage 146
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2541348	2548510	3600228		uncultured_virus(50.0%)	5	NA	NA
WP_118902918.1|2541348_2544057_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.8	5.6e-88
WP_017394811.1|2544154_2544541_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005081942.1|2544620_2544821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091067.1|2545348_2545936_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_115736520.1|2546080_2548510_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	62.3	7.6e-278
>prophage 147
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2558862	2561478	3600228		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_075315902.1|2558862_2561478_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	52.2	1.6e-278
>prophage 148
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2572837	2578899	3600228	protease	Bodo_saltans_virus(33.33%)	5	NA	NA
WP_118902937.1|2572837_2573800_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.3	6.1e-21
WP_171055781.1|2574069_2574936_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.3e-14
WP_171479091.1|2574995_2576369_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_075315912.1|2576389_2577769_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_115736533.1|2577867_2578899_-	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	40.1	2.5e-65
>prophage 149
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2582113	2583484	3600228		Klosneuvirus(100.0%)	1	NA	NA
WP_004638380.1|2582113_2583484_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	4.5e-25
>prophage 150
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2590334	2593713	3600228		Streptomyces_phage(50.0%)	2	NA	NA
WP_118902952.1|2590334_2590829_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	28.7	5.4e-05
WP_118902956.1|2590884_2593713_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	4.3e-22
>prophage 151
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2606808	2608065	3600228		Phage_21(100.0%)	1	NA	NA
WP_005081826.1|2606808_2608065_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	77.8	1.3e-15
>prophage 152
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2614340	2619190	3600228		Stx2-converting_phage(50.0%)	4	NA	NA
WP_118902978.1|2614340_2615657_+	D-alanyl-D-alanine carboxypeptidase PBP6B	NA	B6DZZ7	Stx2-converting_phage	38.2	1.1e-36
WP_004638348.1|2615750_2617037_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004638347.1|2617158_2617641_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_118902981.1|2617759_2619190_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	32.5	3.9e-56
>prophage 153
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2633515	2634220	3600228		Planktothrix_phage(100.0%)	1	NA	NA
WP_004638327.1|2633515_2634220_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.7e-33
>prophage 154
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2638380	2647118	3600228	protease	uncultured_virus(40.0%)	9	NA	NA
WP_118902994.1|2638380_2640420_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	30.7	1.8e-09
WP_004638320.1|2640593_2641232_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_004638319.1|2641385_2642003_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005081751.1|2642217_2642397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008940900.1|2642445_2643432_-	EF-P lysine aminoacylase GenX	NA	A0A1V0SAC0	Catovirus	27.8	5.5e-25
WP_115736556.1|2643428_2644496_-	4-phosphoerythronate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	2.8e-19
WP_075315948.1|2644687_2645062_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_004638311.1|2645135_2646770_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.6	2.1e-175
WP_004652030.1|2646827_2647118_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.4	2.2e-14
>prophage 155
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2653350	2654283	3600228	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_035374992.1|2653350_2654283_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	9.3e-59
>prophage 156
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2658784	2659543	3600228		Escherichia_phage(100.0%)	1	NA	NA
WP_005081720.1|2658784_2659543_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	9.1e-20
>prophage 157
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2663006	2663855	3600228		Enterococcus_phage(100.0%)	1	NA	NA
WP_008940893.1|2663006_2663855_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	2.8e-25
>prophage 158
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2669043	2669946	3600228		Moraxella_phage(100.0%)	1	NA	NA
WP_118903015.1|2669043_2669946_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	33.3	1.1e-45
>prophage 159
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2679648	2682474	3600228	transposase	Faecalibacterium_phage(50.0%)	3	NA	NA
WP_005100823.1|2679648_2680674_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_005081694.1|2680712_2681171_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005081692.1|2681241_2682474_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	A0A0M3UL24	Mycobacterium_phage	25.0	1.2e-05
>prophage 160
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2703750	2704956	3600228		Klosneuvirus(100.0%)	1	NA	NA
WP_004638269.1|2703750_2704956_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.8	3.0e-25
>prophage 161
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2732770	2739851	3600228		Vibrio_phage(50.0%)	3	NA	NA
WP_118903106.1|2732770_2734810_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.5	2.1e-23
WP_118903109.1|2734976_2736230_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_118903111.1|2736239_2739851_+	AAA family ATPase	NA	M4SNF6	Cyanophage	26.7	1.1e-09
>prophage 162
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2750793	2753309	3600228		Erwinia_phage(50.0%)	2	NA	NA
WP_004638203.1|2750793_2751246_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	64.2	2.6e-46
WP_004638202.1|2751269_2753309_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.9	1.1e-112
>prophage 163
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2759724	2878144	3600228	integrase,tRNA,transposase	uncultured_Mediterranean_phage(11.11%)	104	2776976:2777035	2833441:2834391
WP_075316021.1|2759724_2762820_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.2	5.1e-77
WP_004638192.1|2763122_2764073_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	41.8	3.3e-59
WP_005091373.1|2764166_2764898_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005091376.1|2764926_2765742_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005091378.1|2765727_2766177_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_118903117.1|2766281_2767166_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005091382.1|2767372_2768254_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005081540.1|2768455_2769646_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.6	6.2e-15
WP_004638187.1|2769738_2771877_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	24.7	2.4e-49
WP_004638185.1|2772054_2772525_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004638184.1|2772685_2773060_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_005091386.1|2773231_2774569_-	EcsC family protein	NA	NA	NA	NA	NA
WP_004638181.1|2774859_2776089_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_005091388.1|2776121_2776574_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
2776976:2777035	attL	TAGACTTCCGTCATAAATCAAAAAACGTACAATTTATTTGATCTTAAATTAATCAGCAAA	NA	NA	NA	NA
WP_017395860.1|2777063_2777468_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017395859.1|2777559_2777898_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005081532.1|2778180_2778345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100222603.1|2778900_2779990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005091392.1|2780378_2782004_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.7	4.8e-95
WP_005091394.1|2781996_2783028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005081519.1|2783964_2784228_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.2	3.1e-20
WP_004638166.1|2784229_2784721_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.9	5.3e-29
WP_005091398.1|2785037_2786285_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	56.9	2.9e-124
WP_087554624.1|2787364_2788524_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.4	3.7e-49
WP_005091401.1|2789288_2789654_-	copper-binding protein	NA	NA	NA	NA	NA
WP_005091405.1|2792846_2794346_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005091408.1|2794345_2795650_-	TolC family protein	NA	NA	NA	NA	NA
WP_100833373.1|2795730_2796135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091414.1|2796266_2798096_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_004699719.1|2798085_2798343_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_005091417.1|2798353_2799649_-	cation transporter	NA	NA	NA	NA	NA
WP_004880426.1|2799733_2800138_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_005091419.1|2800187_2801069_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_005091421.1|2801055_2803035_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_005091424.1|2803112_2803415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002058525.1|2803563_2804247_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	2.1e-31
WP_005091426.1|2804236_2805613_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_004880442.1|2805686_2808032_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.1	1.8e-87
WP_005091429.1|2808309_2808690_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_005091431.1|2808757_2809639_+	CopD family protein	NA	NA	NA	NA	NA
WP_005091433.1|2809654_2809927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005091434.1|2810030_2810927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091435.1|2811070_2812210_-	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	43.0	6.7e-43
WP_005091436.1|2812439_2813513_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	38.5	1.0e-56
WP_005091437.1|2813569_2813869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026056367.1|2813984_2814347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091439.1|2814476_2815352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091440.1|2815384_2815750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091441.1|2815750_2816875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091442.1|2817337_2818258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125269079.1|2819032_2820251_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_118901380.1|2821077_2822236_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.1	1.5e-50
WP_118903119.1|2822204_2824679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091447.1|2825045_2825897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091449.1|2826100_2826337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005091450.1|2826338_2826533_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005091452.1|2826659_2827133_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	2.5e-23
WP_005081517.1|2827168_2827741_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_005081516.1|2827824_2828565_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_005091456.1|2828645_2829695_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004638161.1|2829766_2830756_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_005091458.1|2830943_2832821_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.3	7.9e-57
WP_017395860.1|2833528_2833933_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017395859.1|2834024_2834363_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162511261.1|2834375_2834546_-	hypothetical protein	NA	NA	NA	NA	NA
2833441:2834391	attR	TAGACTTCCGTCATAAATCAAAAAACGTACAATTTATTTGATCTTAAATTAATCAGCAAAATTATTTAATTCAAGGGATAATCCTTGGATGAAATTCAAAGATATTCAAAAATTATCAGACGTTAAGTTTCGTAGGCTTACCGGTGTTAGTTGGGCTACATTTAACCTCATGTTGGCCGAGCTAAATAAGCATTTACCTCGTCATATTGGTAAAGGACGACCGCATAAATTACCGTTGGAAGATCGTTTGCTCTTATGTATAGAATATTGGAGAGAATATCGAACATTTTTCCATCTTGGTATGAGTTACGGTGTATCTGAAACGAGTGCAATTCGTATCACACGTGTTATTGAAGATACCTTAATCGGTTCTGGAAAATTTAACTTGCCAAAACAACTTCCTAATCGAGATGAAGTGGATTGGGAAGTTGTTGTGATTGATGCAACTGAAATATTAGTTCAACGTCCAAAAAAAACAGAAGAAATGGTATAGCGGTAAAAAAAAGCGACATACCTTTAAATTTCAGCTATCTATGCACTATACAACAGGTGAAATACTGAGTGTATGTGGAAGTCATGGAAGCATGCATGATTTTAAAATATTTAAAAAAAGTATGAGGAAATTAAAATTTAAGCCCTTTTTTATCGTTGATAAGGGGTATTTAGGGATAAAAAAATTGGGTTTTGGATGCCTCATGCCATCTAAAGCAAAGAAAACTGAAAAATTAGATTCTGAATTAAAAAAGTTAAATAGAGAGATTGGTCGTAGACGAATTCAAGTAGAGCATGTATTTGGAAGGATGAAATGTTTTAAGATTTTATCTTGTGTATATAGAAATCGTCGTAAAAGATTAAACCTGCGGTTTAATTTACTTGCTGGCATATACAATTTAGATTGGGTGAAAGATAAACAATTAAATTGATTGAAAAATGATTTATGAAGGAAGTCTA	NA	NA	NA	NA
WP_004638159.1|2836017_2837301_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_008942493.1|2837461_2839099_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005081509.1|2839103_2839685_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_005081506.1|2839698_2840532_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_004638154.1|2840765_2841719_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.9	2.1e-42
WP_005081504.1|2841815_2842112_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_005081501.1|2842131_2842713_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004638150.1|2842858_2843239_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_005091465.1|2843418_2845209_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_020846296.1|2845205_2846393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091467.1|2846398_2846638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005081497.1|2847069_2847729_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	M4QPK3	Synechococcus_phage	41.7	9.9e-39
WP_005081494.1|2847772_2848447_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005081491.1|2848540_2849308_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_005274609.1|2849832_2850762_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
WP_005081486.1|2852692_2853166_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_004638139.1|2853381_2853624_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.1	4.3e-08
WP_004655272.1|2853739_2853976_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	43.2	1.4e-11
WP_004638137.1|2854062_2854797_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	5.9e-16
WP_118903147.1|2854793_2855780_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_008942576.1|2856026_2857184_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004638135.1|2857257_2857443_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_005081479.1|2857517_2858078_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_171057127.1|2858264_2858837_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_005081475.1|2858925_2859543_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005091477.1|2859554_2860115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091478.1|2860182_2860665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091479.1|2860850_2861585_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171065863.1|2861854_2862625_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_004638126.1|2862621_2863221_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	3.2e-20
WP_005081469.1|2863262_2864207_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_005091481.1|2864272_2865997_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	5.3e-15
WP_118903149.1|2866008_2867151_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_118903151.1|2867158_2868097_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_118903153.1|2868108_2870124_-	Zn-dependent oligopeptidase	NA	NA	NA	NA	NA
WP_118903156.1|2870145_2871957_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_118903300.1|2871971_2873756_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004669181.1|2874133_2875066_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.5	1.6e-58
WP_171479083.1|2875462_2878144_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	2.9e-44
>prophage 164
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2884326	2885622	3600228		Klosneuvirus(100.0%)	1	NA	NA
WP_005091504.1|2884326_2885622_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.9e-17
>prophage 165
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2889720	2891748	3600228		Ralstonia_phage(100.0%)	1	NA	NA
WP_118903162.1|2889720_2891748_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.6	1.6e-124
>prophage 166
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2908879	2912802	3600228	transposase	Enterobacteria_phage(33.33%)	5	NA	NA
WP_125316818.1|2908879_2909812_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.6e-58
WP_003653416.1|2909957_2910527_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	4.3e-75
WP_008941849.1|2910627_2911221_-	LysE family transporter	NA	NA	NA	NA	NA
WP_008941850.1|2911524_2912067_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_001223318.1|2912100_2912802_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
>prophage 167
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2919504	2920434	3600228	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_005274609.1|2919504_2920434_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
>prophage 168
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2948976	2950395	3600228		Bacillus_virus(100.0%)	1	NA	NA
WP_118903171.1|2948976_2950395_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.3	2.6e-20
>prophage 169
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2955095	2961630	3600228	transposase	Bacillus_phage(25.0%)	5	NA	NA
WP_005081325.1|2955095_2955812_-	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.7	4.1e-38
WP_005091576.1|2956334_2959169_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.8	4.0e-177
WP_005081321.1|2959243_2959372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005091578.1|2959511_2960795_+	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.1	3.5e-40
WP_001223318.1|2960928_2961630_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
>prophage 170
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2965139	2965628	3600228		Streptococcus_phage(100.0%)	1	NA	NA
WP_004638027.1|2965139_2965628_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.0	1.4e-26
>prophage 171
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2971841	2972117	3600228		uncultured_virus(100.0%)	1	NA	NA
WP_004638019.1|2971841_2972117_+	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	47.7	2.6e-09
>prophage 172
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	2982818	2984162	3600228		Pandoravirus(100.0%)	1	NA	NA
WP_008941902.1|2982818_2984162_+	chorismate-binding protein	NA	A0A0B5J984	Pandoravirus	35.2	5.9e-30
>prophage 173
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3010298	3013064	3600228		uncultured_virus(100.0%)	1	NA	NA
WP_005092365.1|3010298_3013064_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.4	4.3e-67
>prophage 174
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3018655	3024974	3600228	tRNA	Streptomyces_phage(33.33%)	6	NA	NA
WP_004637976.1|3018655_3018982_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.2	6.9e-17
WP_005085280.1|3019313_3020582_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_004637974.1|3020977_3021193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004637973.1|3021285_3021582_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	40.4	2.1e-12
WP_005085286.1|3021578_3023960_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004637971.1|3023993_3024974_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	39.9	1.4e-36
>prophage 175
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3030751	3035174	3600228	tRNA	Agrobacterium_phage(33.33%)	3	NA	NA
WP_075316144.1|3030751_3031303_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	30.8	6.6e-12
WP_005092352.1|3031308_3033231_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	5.9e-124
WP_005092350.1|3033530_3035174_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.6	2.5e-30
>prophage 176
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3039089	3157557	3600228	integrase,tRNA,transposase	uncultured_Caudovirales_phage(16.13%)	104	3090162:3090177	3110988:3111003
WP_171055770.1|3039089_3040511_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	32.8	1.8e-21
WP_005092347.1|3040678_3041104_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_005092344.1|3041072_3041879_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_118903196.1|3041975_3042698_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017396695.1|3042727_3043660_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.6e-58
WP_004282344.1|3044280_3044982_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.8	3.4e-37
WP_118903198.1|3044981_3045368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004637947.1|3045494_3047801_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_118903200.1|3047847_3049239_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.9	2.0e-28
WP_004637945.1|3049248_3050070_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_171057119.1|3050133_3051072_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.4	2.2e-55
WP_008942172.1|3051209_3054020_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.8	1.8e-49
WP_008942173.1|3054097_3054886_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017396601.1|3054960_3055824_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005085320.1|3055849_3056644_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_004637939.1|3056725_3057124_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_008942177.1|3057204_3057531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396599.1|3057858_3058680_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004637936.1|3058742_3060209_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_004637935.1|3060212_3060536_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005085324.1|3060547_3061675_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005085327.1|3062367_3062865_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_005085329.1|3062936_3063356_+	RidA family protein	NA	NA	NA	NA	NA
WP_008942180.1|3063372_3064560_+	MFS transporter	NA	NA	NA	NA	NA
WP_005085333.1|3064604_3065510_-	ectoine hydroxylase	NA	NA	NA	NA	NA
WP_005085334.1|3065512_3065926_-	ectoine synthase	NA	NA	NA	NA	NA
WP_005085340.1|3065922_3067242_-	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_004637924.1|3067287_3067863_-	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_004637923.1|3067992_3068427_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005092317.1|3068930_3069650_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.6	3.0e-89
WP_005092315.1|3069642_3070683_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_005092314.1|3070694_3071168_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	49.4	3.6e-35
WP_004637919.1|3071174_3071495_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	65.1	1.3e-23
WP_005092312.1|3071552_3071987_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.0	3.3e-43
WP_008942181.1|3072262_3072856_-	LysE family transporter	NA	NA	NA	NA	NA
WP_008942182.1|3073637_3074651_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.4	2.4e-07
WP_008942183.1|3074816_3077918_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.6	3.1e-74
WP_005274609.1|3079233_3080163_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
WP_008942186.1|3081344_3082739_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_008942187.1|3082735_3084169_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_008942188.1|3084158_3085889_-	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
WP_008942189.1|3086217_3087144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942190.1|3087324_3088365_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	36.8	2.8e-43
WP_008942191.1|3088533_3089577_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.5	8.6e-61
WP_008942192.1|3089634_3089922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065286431.1|3090135_3092223_+	AAA family ATPase	NA	NA	NA	NA	NA
3090162:3090177	attL	AAATTTTAGATCAATT	NA	NA	NA	NA
WP_017396499.1|3092777_3093032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942226.1|3093163_3093388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942225.1|3093403_3094063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065286432.1|3094125_3095070_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_017395859.1|3095321_3095660_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017395860.1|3095751_3096156_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017395860.1|3097343_3097748_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017395859.1|3097839_3098178_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065286433.1|3099186_3100113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942217.1|3100115_3101012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942216.1|3101149_3101425_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_008942215.1|3101408_3102560_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	44.2	1.7e-89
WP_017396681.1|3102695_3103715_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004637913.1|3103972_3104428_+	CHAP domain-containing protein	NA	D5GVH7	Campylobacter_virus	43.2	1.3e-13
WP_005092264.1|3104450_3105242_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	28.5	3.5e-14
WP_005092262.1|3105304_3106498_-	MFS transporter	NA	NA	NA	NA	NA
WP_005092261.1|3106603_3109360_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_008942213.1|3109485_3110301_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_008942212.1|3110362_3111259_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
3110988:3111003	attR	AATTGATCTAAAATTT	NA	NA	NA	NA
WP_008942211.1|3111365_3112184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004637906.1|3112257_3113850_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
WP_017396682.1|3114126_3114999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942209.1|3115287_3116892_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_004637903.1|3116948_3118454_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_160124045.1|3118759_3118888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942208.1|3118893_3119244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004637901.1|3119248_3120073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020846310.1|3120551_3121484_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_008942207.1|3121940_3122336_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_008942206.1|3122495_3124007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942205.1|3124301_3125009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942204.1|3125238_3126384_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_080591915.1|3127679_3128708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005089444.1|3129017_3129950_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.3	7.4e-56
WP_004637893.1|3131040_3132057_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004637892.1|3132162_3132654_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005085438.1|3132653_3134378_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	4.1e-52
WP_008942202.1|3134885_3135236_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_008942201.1|3135379_3138004_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.1	1.1e-173
WP_005085445.1|3138211_3138721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004637887.1|3138730_3139726_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005092232.1|3139833_3141153_+	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	58.5	1.3e-08
WP_005092230.1|3141154_3143146_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.9	3.9e-38
WP_005092228.1|3143157_3144546_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_171479084.1|3146279_3147305_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	1.8e-26
WP_171057896.1|3148294_3149128_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004637879.1|3149228_3149957_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_005092221.1|3150118_3150679_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	32.0	4.6e-21
WP_004637877.1|3150803_3151862_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_004637876.1|3151958_3152375_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004637875.1|3152386_3152647_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.2	7.2e-09
WP_005085470.1|3152674_3153133_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_005085472.1|3153188_3153797_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2P1EMK1	Moumouvirus	37.0	2.0e-14
WP_005092219.1|3153783_3154029_-	metal-binding protein	NA	NA	NA	NA	NA
WP_005092217.1|3154033_3154771_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_005092215.1|3154757_3155603_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.6	2.1e-17
WP_017396505.1|3155769_3156147_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005092210.1|3156303_3157557_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	8.5e-39
>prophage 177
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3166622	3167956	3600228		Lausannevirus(50.0%)	2	NA	NA
WP_005092191.1|3166622_3167060_-	thioredoxin TrxC	NA	F2WLG3	Lausannevirus	38.7	4.7e-13
WP_005092188.1|3167059_3167956_-	alpha/beta fold hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	30.7	2.3e-22
>prophage 178
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3183095	3187873	3600228	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_171057897.1|3183095_3184994_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	37.8	5.1e-11
WP_118903203.1|3185302_3186754_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_005083607.1|3186838_3187873_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.8e-47
>prophage 179
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3194827	3196200	3600228		Geobacillus_virus(50.0%)	2	NA	NA
WP_005083621.1|3194827_3195670_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	60.4	6.6e-96
WP_004637828.1|3195690_3196200_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	43.8	1.7e-25
>prophage 180
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3207766	3220215	3600228		Bacillus_phage(25.0%)	10	NA	NA
WP_004637812.1|3207766_3209746_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	26.8	2.1e-47
WP_008942316.1|3210619_3211378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942315.1|3211466_3214106_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.3	1.5e-90
WP_004637807.1|3214139_3214589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004637806.1|3214749_3215112_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005088135.1|3215230_3216241_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005083653.1|3216282_3216528_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005088131.1|3216560_3218474_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	8.4e-46
WP_005083657.1|3218529_3219072_-	DUF4334 domain-containing protein	NA	NA	NA	NA	NA
WP_005083659.1|3219279_3220215_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	33.5	2.2e-39
>prophage 181
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3237628	3239923	3600228		Hokovirus(100.0%)	1	NA	NA
WP_004637783.1|3237628_3239923_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	6.1e-19
>prophage 182
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3258464	3260940	3600228		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
WP_005088100.1|3258464_3259760_+	hypothetical protein	NA	E5EQ95	Micromonas_sp._RCC1109_virus	31.1	6.7e-31
WP_005083719.1|3259851_3260106_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004637763.1|3260211_3260541_-	DUF190 domain-containing protein	NA	A0A2H4J2R0	uncultured_Caudovirales_phage	44.4	1.3e-23
WP_005088098.1|3260559_3260940_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.3	5.2e-24
>prophage 183
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3272269	3274525	3600228	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_005274609.1|3272269_3273199_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	38.3	8.4e-52
WP_004637744.1|3273880_3274525_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.0	4.1e-21
>prophage 184
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3285836	3286538	3600228	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_004678526.1|3285836_3286538_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
>prophage 185
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3292231	3293191	3600228		Moumouvirus(100.0%)	1	NA	NA
WP_004637728.1|3292231_3293191_+	DnaJ domain-containing protein	NA	M1PC06	Moumouvirus	53.0	7.5e-11
>prophage 186
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3299714	3305273	3600228		Brevibacillus_phage(50.0%)	2	NA	NA
WP_005088043.1|3299714_3301520_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	22.6	1.1e-20
WP_005088041.1|3301559_3305273_-	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	22.8	1.1e-09
>prophage 187
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3315333	3316953	3600228		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_004637712.1|3315333_3316953_+	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.0	3.9e-28
>prophage 188
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3320896	3326004	3600228		Bacillus_virus(50.0%)	5	NA	NA
WP_004637708.1|3320896_3321694_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_008942290.1|3321904_3323221_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_017396561.1|3323246_3323627_+	VOC family protein	NA	NA	NA	NA	NA
WP_008942288.1|3323718_3324486_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_005083827.1|3324495_3326004_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	35.6	2.9e-78
>prophage 189
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3336788	3339494	3600228		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004637690.1|3336788_3339494_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.8	9.4e-27
>prophage 190
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3361548	3362448	3600228		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_162920330.1|3361548_3362448_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.8	4.3e-37
>prophage 191
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3371198	3373004	3600228		Bacillus_phage(100.0%)	1	NA	NA
WP_004637656.1|3371198_3373004_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.1e-38
>prophage 192
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3378158	3393884	3600228		uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_005087967.1|3378158_3380078_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.4	7.4e-119
WP_005087965.1|3380247_3380850_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_005087963.1|3381336_3382701_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005087961.1|3382777_3383650_-	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	30.8	2.9e-06
WP_004637647.1|3383744_3384260_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_004637646.1|3384336_3384693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004637645.1|3384897_3385263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004637644.1|3385429_3389623_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	4.1e-69
WP_004637643.1|3389795_3393884_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.0	1.6e-22
>prophage 193
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3397782	3404919	3600228		Klosneuvirus(33.33%)	5	NA	NA
WP_005081540.1|3397782_3398973_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.6	6.2e-15
WP_008942270.1|3399643_3401137_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	27.9	1.2e-26
WP_008942269.1|3401219_3401912_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_026056327.1|3402024_3402633_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_008942267.1|3402711_3404919_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	34.9	2.7e-32
>prophage 194
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3411736	3412474	3600228		Pseudomonas_phage(100.0%)	1	NA	NA
WP_017396675.1|3411736_3412474_-	response regulator transcription factor	NA	Q9MC72	Pseudomonas_phage	34.4	3.3e-06
>prophage 195
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3427645	3428566	3600228		Brevibacillus_phage(100.0%)	1	NA	NA
WP_008942252.1|3427645_3428566_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	2.3e-33
>prophage 196
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3434135	3438362	3600228		Hokovirus(50.0%)	3	NA	NA
WP_005087910.1|3434135_3435701_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.6	2.8e-07
WP_005083966.1|3435723_3437154_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_008942249.1|3437195_3438362_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	30.0	1.7e-12
>prophage 197
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3442366	3465767	3600228	transposase	uncultured_Caudovirales_phage(46.67%)	24	NA	NA
WP_026056263.1|3442366_3443815_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	4.5e-52
WP_008942246.1|3443818_3444226_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_118903234.1|3444261_3444897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100222743.1|3444929_3446155_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	4.6e-21
WP_005083982.1|3446251_3446911_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	1.5e-34
WP_008942244.1|3447066_3447906_-	aquaporin	NA	NA	NA	NA	NA
WP_004637583.1|3448304_3449597_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.8	1.6e-37
WP_005087893.1|3449593_3450694_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.1	6.7e-48
WP_004637581.1|3450706_3451171_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_005087891.1|3451306_3452698_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	33.0	1.3e-35
WP_000780326.1|3452766_3453105_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004637578.1|3453377_3453605_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_142028631.1|3453674_3454532_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087486619.1|3455114_3456333_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_117348086.1|3457027_3457723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000492599.1|3458017_3459505_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	78.6	1.2e-217
WP_002048946.1|3459519_3460371_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	47.3	2.2e-70
WP_118903237.1|3460573_3461008_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	56.5	2.9e-39
WP_000372102.1|3461065_3461386_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	63.7	2.1e-26
WP_004699737.1|3461392_3461866_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.2	5.1e-37
WP_000068656.1|3461873_3462917_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000174605.1|3462922_3463627_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.9	1.3e-92
WP_118903239.1|3463644_3464598_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	5.4e-62
WP_086379299.1|3464699_3465767_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	59.1	3.8e-96
>prophage 198
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3471292	3472003	3600228	transposase	Vibriophage(100.0%)	1	NA	NA
WP_000736404.1|3471292_3472003_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	9.1e-06
>prophage 199
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3476951	3487273	3600228		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_004637542.1|3476951_3477479_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	5.3e-59
WP_005087881.1|3477597_3477996_-	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	40.5	8.1e-12
WP_005087879.1|3478145_3478532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118903243.1|3478598_3480278_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.4	1.8e-36
WP_005087876.1|3480434_3482654_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.4e-81
WP_075316357.1|3482816_3483332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316358.1|3483362_3484007_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004637533.1|3484059_3484542_-	YchJ family protein	NA	NA	NA	NA	NA
WP_118903245.1|3484744_3486325_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	41.8	2.2e-36
WP_171261739.1|3486670_3487273_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	1.3e-13
>prophage 200
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3490979	3500472	3600228		Geobacillus_phage(33.33%)	9	NA	NA
WP_118903251.1|3490979_3491741_+	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	32.5	2.8e-21
WP_171479093.1|3491742_3492798_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_005084062.1|3493195_3493558_+	RidA family protein	NA	NA	NA	NA	NA
WP_115736201.1|3493554_3494085_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_118903255.1|3494404_3496789_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.7	4.3e-116
WP_017395292.1|3496956_3497466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115736203.1|3497576_3498782_-	MFS transporter	NA	NA	NA	NA	NA
WP_115736204.1|3498941_3499493_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_171057128.1|3499542_3500472_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	51.5	4.8e-71
>prophage 201
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3508369	3510343	3600228		Vibrio_phage(100.0%)	1	NA	NA
WP_005092474.1|3508369_3510343_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.1	1.9e-24
>prophage 202
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3515908	3519400	3600228		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_161405037.1|3515908_3519400_+	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	27.1	2.9e-12
>prophage 203
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3530100	3532399	3600228	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_118903279.1|3530100_3531669_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	26.5	4.5e-21
WP_118903281.1|3531661_3532399_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	28.6	1.2e-19
>prophage 204
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3535938	3539495	3600228		Synechococcus_phage(33.33%)	4	NA	NA
WP_004637502.1|3535938_3536469_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.0	2.5e-16
WP_005092484.1|3536594_3537746_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_115736207.1|3537757_3538888_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.5	1.5e-26
WP_005085670.1|3538925_3539495_+	Sua5/YciO/YrdC/YwlC family protein	NA	A0A291ATS8	Pandoravirus	30.4	3.2e-09
>prophage 205
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3546050	3547269	3600228	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_087486619.1|3546050_3547269_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
>prophage 206
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3558340	3560715	3600228	transposase	Planktothrix_phage(50.0%)	3	NA	NA
WP_005085692.1|3558340_3559129_+	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.7	7.0e-15
WP_118903285.1|3559132_3559921_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001223318.1|3560013_3560715_+|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
>prophage 207
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3573646	3575215	3600228		Hokovirus(100.0%)	1	NA	NA
WP_004637461.1|3573646_3575215_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	8.7e-25
>prophage 208
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3579958	3588930	3600228	integrase	Mycobacterium_phage(20.0%)	10	3570487:3570501	3589121:3589135
3570487:3570501	attL	TTTTATCAACAATAT	NA	NA	NA	NA
WP_115736219.1|3579958_3580801_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	24.3	4.2e-10
WP_115736220.1|3580881_3581274_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_115736221.1|3581283_3581592_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_033133953.1|3582313_3582541_-	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	44.9	1.4e-08
WP_000122748.1|3582653_3582863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033133952.1|3582882_3584067_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	31.6	1.1e-40
WP_001084945.1|3584056_3584308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118903289.1|3584373_3584916_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_005092516.1|3584926_3585670_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	36.7	4.4e-43
WP_033133950.1|3585723_3588930_-	DEAD/DEAH box helicase	NA	A0A142KCD4	Gordonia_phage	28.8	1.8e-32
3589121:3589135	attR	TTTTATCAACAATAT	NA	NA	NA	NA
>prophage 209
NZ_CP041224	Acinetobacter haemolyticus strain AN54 chromosome, complete genome	3600228	3593205	3595465	3600228		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_050511473.1|3593205_3594279_-	HNH endonuclease	NA	A0A2I2MUI7	uncultured_Caudovirales_phage	62.5	1.4e-77
WP_081406957.1|3594265_3595465_-	class I SAM-dependent methyltransferase	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	79.3	5.1e-33
>prophage 1
NZ_CP041229	Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence	45460	0	1004	45460		Streptococcus_phage(100.0%)	1	NA	NA
WP_014386410.1|224_1004_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
>prophage 2
NZ_CP041229	Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence	45460	4570	10700	45460		Tetraselmis_virus(50.0%)	6	NA	NA
WP_017480453.1|4570_7483_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	23.9	4.4e-06
WP_015060720.1|8014_8551_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_017480467.1|8774_9005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060719.1|8991_9414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060718.1|9574_9811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060717.1|9872_10700_-	DUF3560 domain-containing protein	NA	H7BV66	unidentified_phage	32.8	2.5e-15
>prophage 3
NZ_CP041229	Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence	45460	15220	15910	45460		Mycobacterium_phage(100.0%)	1	NA	NA
WP_005000446.1|15220_15910_-	AAA family ATPase	NA	W0LIU2	Mycobacterium_phage	32.8	8.0e-15
>prophage 4
NZ_CP041229	Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence	45460	24467	28203	45460		Bacillus_phage(50.0%)	4	NA	NA
WP_017480463.1|24467_25715_+	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	55.6	1.5e-24
WP_015060710.1|25711_27229_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004999346.1|27247_27448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017480462.1|27492_28203_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	50.8	6.9e-30
>prophage 5
NZ_CP041229	Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence	45460	32591	35990	45460		Moraxella_phage(50.0%)	4	NA	NA
WP_015060706.1|32591_33074_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.0	3.6e-22
WP_015060705.1|33070_34783_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_015056389.1|34966_35191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004993315.1|35342_35990_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	31.4	2.6e-15
>prophage 6
NZ_CP041229	Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence	45460	39026	41013	45460		uncultured_virus(100.0%)	2	NA	NA
WP_004201176.1|39026_40667_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|40722_41013_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
