The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	7627	48837	5026592	transposase,protease	Ralstonia_phage(40.0%)	38	NA	NA
WP_012443554.1|7627_8464_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012443555.1|8650_9457_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9733_10927_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11080_11752_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11836_12598_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12644_13067_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13070_13484_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13779_14547_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14557_14827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|14901_16362_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_162531722.1|16534_16699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257020.1|17008_18019_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18290_19493_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19634_21773_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|21983_22277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22308_22806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23052_24033_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24080_25247_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_012443565.1|27435_28653_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_162828845.1|28676_28817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443568.1|29273_30296_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30876_32130_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094187728.1|32203_33001_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157724563.1|32988_33963_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443571.1|34847_35510_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_012443572.1|35663_36458_-	EcsC family protein	NA	NA	NA	NA	NA
WP_027704023.1|36625_37099_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041182297.1|39324_40287_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_012443578.1|40773_41172_-	host attachment protein	NA	NA	NA	NA	NA
WP_012443579.1|41263_41956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|42125_42596_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011407233.1|44062_44374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407232.1|44628_45576_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_012443584.1|45716_46763_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|46901_47183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443586.1|47235_47496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|47563_47773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407229.1|47886_48837_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
>prophage 2
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	91808	138558	5026592	transposase	Ostreococcus_lucimarinus_virus(16.67%)	35	NA	NA
WP_094187710.1|91808_92571_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|92578_94303_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_011257102.1|94543_95485_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|95677_97042_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|97038_98667_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_041182541.1|99140_100724_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_041182542.1|100720_102955_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|102957_104715_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|104771_106661_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_012443627.1|106657_109267_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|109289_109475_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|109589_111752_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|111768_112401_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|112564_113062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|113202_114249_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_125168734.1|115596_115875_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_115877336.1|115871_116837_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443633.1|116931_117945_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_012443634.1|117925_120328_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_080256644.1|120443_120902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|120901_121234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443635.1|121250_121511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|122834_124244_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011407187.1|124592_125024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|125298_125634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|126073_127363_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443641.1|127981_128962_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|129427_129751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443643.1|129692_129935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115877337.1|130310_131276_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443646.1|132947_134324_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_129215536.1|134925_135633_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_011407176.1|135629_136766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147213241.1|137015_137618_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|137601_138558_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 3
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	146559	230966	5026592	tRNA,transposase	Acidithiobacillus_phage(22.22%)	48	NA	NA
WP_115877338.1|146559_147525_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443655.1|147755_148007_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075239626.1|148459_148861_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012443656.1|148884_149115_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012443657.1|149181_149844_-	hemolysin III	NA	NA	NA	NA	NA
WP_012443658.1|150021_152517_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_027703669.1|152513_154340_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_027703670.1|154828_156973_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|157163_158321_-	ROK family protein	NA	NA	NA	NA	NA
WP_012443664.1|158493_161082_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|161092_161878_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_027703672.1|162191_163382_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|164481_164787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256616.1|165046_166210_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	1.6e-39
WP_011257161.1|166356_166737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|166938_171411_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257163.1|171605_173087_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_115877339.1|174324_175290_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115877340.1|176802_178122_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_048488785.1|178389_179766_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	9.5e-76
WP_011407263.1|181167_182196_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057315.1|182369_182465_-	xylosidase	NA	NA	NA	NA	NA
WP_041181912.1|182440_182968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443681.1|183790_185974_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_027703861.1|185985_189336_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|189332_192449_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|194402_195368_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187821.1|196993_197173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494036.1|197175_197502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443686.1|197571_197685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443687.1|197767_199243_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	2.8e-102
WP_115877341.1|200865_202185_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012443690.1|202328_203849_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|203865_204144_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_033013476.1|204333_204672_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|205284_207270_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011409560.1|207901_208864_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|209269_210082_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|210274_210886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|211302_212160_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|212397_214284_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_011407587.1|214654_215689_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_012443698.1|217724_220445_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
WP_012443699.1|220510_222655_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.1	2.0e-27
WP_012443700.1|222651_224334_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012443702.1|224653_226855_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.4	1.5e-19
WP_012443703.1|226851_228528_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012443704.1|229061_230966_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	266624	316622	5026592	tail,transposase	Arthrobacter_phage(27.27%)	41	NA	NA
WP_099051259.1|266624_267726_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_041182294.1|268500_269463_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115877391.1|271530_272496_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443726.1|273174_274212_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011260790.1|274719_275730_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_041182555.1|275918_276764_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|276923_278129_+	aminotransferase	NA	NA	NA	NA	NA
WP_011409775.1|278181_278514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409774.1|278562_279300_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_041182556.1|279296_280769_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011260784.1|281055_282237_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|282308_283592_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_012443732.1|283588_284575_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|284619_285897_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|285893_286514_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|286656_290364_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|290558_290921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|291017_291194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260776.1|291455_292373_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|292725_293358_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_011409767.1|293373_293850_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|293853_294426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260772.1|294422_296438_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|296701_297130_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|297249_298053_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_115877342.1|298112_299102_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409765.1|299515_301588_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|301782_302394_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|303547_304354_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|304490_305288_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|305509_306919_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|307196_307535_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443742.1|307557_309000_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|309270_310326_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|310318_311746_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_012443745.1|312244_312847_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
WP_027704180.1|312917_313550_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_109182045.1|313832_314798_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|314885_315422_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|315480_316008_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|316076_316622_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
>prophage 5
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	341430	415374	5026592	tRNA,transposase	Staphylococcus_prophage(16.67%)	47	NA	NA
WP_011409552.1|341430_342393_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_113341542.1|342519_342735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|342943_343192_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042465346.1|343353_343620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260735.1|345436_346300_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011409738.1|346548_346977_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011260733.1|347078_347537_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182856.1|349003_349960_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
WP_115877343.1|350062_351382_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187713.1|351510_352308_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|352341_353022_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_012443767.1|353114_354191_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|354200_355322_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_113090107.1|355387_356377_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|356505_357269_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187716.1|359201_360000_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|360416_361451_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_027703497.1|361482_362970_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|363068_366002_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012443772.1|366463_367765_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409725.1|369181_370159_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_027703494.1|370199_371618_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|371844_372900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|373877_375350_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_012443780.1|375572_378287_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|378289_379990_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_012443782.1|379989_381249_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_041182560.1|381260_383225_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_012443784.1|383221_385417_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|385592_386660_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259480.1|386885_388223_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012443789.1|388826_389744_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011260701.1|389807_390713_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|391339_392125_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075239583.1|392935_393691_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|393788_394754_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|394908_395811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|395883_396111_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_041182561.1|396126_396768_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|396764_397520_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|397671_398571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|398630_399383_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_094187753.1|399926_400725_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048488786.1|400865_409649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|410034_411849_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012443796.1|411938_412847_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_012443798.1|413136_415374_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	535239	784922	5026592	integrase,tRNA,transposase	Leptospira_phage(13.79%)	201	580227:580246	722341:722357
WP_109181928.1|535239_536205_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082356997.1|537186_537768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443879.1|537864_538056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260591.1|538065_538689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|539117_540038_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260589.1|540037_540556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260588.1|540717_543543_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_048488787.1|543638_543926_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	31.6	8.2e-06
WP_094187715.1|544202_544965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703830.1|548321_548822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409634.1|549728_550676_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_012443887.1|550809_551400_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_012443888.1|551610_552375_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|552860_553280_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_012443890.1|553276_553708_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041182564.1|553704_555711_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_033013372.1|555928_556276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260575.1|556691_556796_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012443895.1|556792_557305_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	69.5	5.5e-45
WP_155296185.1|558792_558933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182565.1|558998_562916_-	avirulence protein	NA	NA	NA	NA	NA
WP_011409622.1|566238_568926_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_125168769.1|569115_570021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409620.1|570017_570752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099051315.1|570857_571959_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	5.2e-40
WP_011409617.1|572317_572608_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_012443905.1|572684_575486_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011260560.1|576433_577333_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_041182568.1|578447_579590_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	6.2e-97
580227:580246	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260557.1|581687_582563_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
580227:580246	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260556.1|582793_584632_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|584806_585073_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|585098_585644_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|586115_587423_+	MFS transporter	NA	NA	NA	NA	NA
WP_012443911.1|587561_588821_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_027703952.1|589249_589783_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182569.1|589793_591170_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.1e-76
WP_011260548.1|591404_591563_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
591268:591287	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_012443914.1|591627_592638_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
591268:591287	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_011260546.1|592866_594537_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|594855_595239_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260544.1|595460_596363_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_080256617.1|596359_598855_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_012443917.1|598862_600494_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011260541.1|600490_601654_-	Fic family protein	NA	NA	NA	NA	NA
WP_011260540.1|601725_602742_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|602843_603164_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011409604.1|603549_604011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260538.1|604037_604514_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|604855_606079_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|606183_606795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443920.1|606896_607640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260534.1|607830_609177_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260533.1|609161_610604_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_012443921.1|610653_612381_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_041182570.1|612738_613335_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_011409602.1|613657_614683_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260529.1|614698_615214_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|615323_615758_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011409601.1|615833_616256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|616284_616755_-	thioesterase	NA	NA	NA	NA	NA
WP_041182571.1|617217_618183_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_115877345.1|618601_619567_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409598.1|620311_621679_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|621968_625109_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012443930.1|625242_628491_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_012443931.1|628583_629828_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407587.1|630087_631122_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409596.1|631203_632520_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|633278_634094_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_041182574.1|635902_636859_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
WP_027704002.1|638678_640391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409585.1|640580_642812_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_094187806.1|643415_644518_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_075240081.1|644566_645241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409581.1|645946_646528_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_011260499.1|646679_647309_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409580.1|647426_648464_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_012443942.1|648600_649398_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409579.1|649390_650107_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260494.1|651256_652051_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011409578.1|652210_652525_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260492.1|652842_653496_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011260491.1|653681_654110_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005990700.1|654113_654506_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260490.1|655054_655672_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_027703893.1|655752_655968_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003483093.1|656310_656781_+	bacterioferritin	NA	NA	NA	NA	NA
WP_041182575.1|656793_657759_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_099051263.1|657837_658817_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.9	1.6e-37
WP_011260487.1|658976_662177_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_011409574.1|662453_662930_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_041182577.1|662946_663900_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011260484.1|663938_665543_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_012443948.1|665693_666290_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011260481.1|666328_667204_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443949.1|667296_667515_-	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_012443950.1|667575_668295_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_011260478.1|668322_668898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260477.1|668908_670072_+	heme A synthase	NA	NA	NA	NA	NA
WP_011409570.1|670074_670971_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011409569.1|671359_672940_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_033013369.1|673123_674170_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_059317500.1|674394_674661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443953.1|674660_674825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407626.1|674895_676215_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012443955.1|676364_677333_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_115840162.1|677545_678865_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|679394_679910_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011257476.1|680312_682535_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257477.1|683000_684026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|684009_684612_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_011257479.1|684942_685788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703444.1|686306_687683_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_027703443.1|687767_689669_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|689854_690070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|690176_690953_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_027703442.1|691114_691789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|691785_692559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|692782_693346_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|693356_695849_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|696031_697306_-	RDD family protein	NA	NA	NA	NA	NA
WP_027703441.1|697347_698070_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|698110_698584_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041182579.1|698626_699769_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|699840_700977_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_027703439.1|701109_701622_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|702015_702939_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|702938_704252_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|704302_706024_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|706188_707466_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|707663_708488_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012443968.1|708491_709547_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_012443970.1|709712_711218_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_048488816.1|711214_711724_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|711833_712967_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|713209_713731_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|713930_714845_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|714945_715386_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|715494_717369_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|717561_717882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|718510_719785_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_011257520.1|719918_720125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|720121_720394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|720390_720636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257523.1|720779_720908_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443979.1|722571_723807_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|723875_724265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712752.1|724261_724465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|724587_725553_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|726791_727514_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_027703875.1|727524_728961_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012443983.1|728960_730229_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|730318_732460_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407520.1|732544_733210_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|733206_733881_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027703874.1|733877_736535_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_012443985.1|736545_737283_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|737621_737834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|738254_738476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239431.1|738485_738800_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_115877346.1|739260_740580_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260472.1|740831_742580_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|742669_743632_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011409564.1|745925_746372_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_002808376.1|746679_746895_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011260469.1|747174_748239_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_011409563.1|748317_748674_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|748901_751073_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_012443995.1|753406_754369_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012443997.1|755364_756543_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011260461.1|756717_757152_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|757712_757994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187777.1|758039_758837_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187784.1|759049_759812_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704068.1|759871_761188_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|761184_761961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|762242_763005_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|763453_764416_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|764635_765433_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260454.1|765588_766686_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_012444005.1|766682_768095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409549.1|768318_769125_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444006.1|769217_769964_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|770270_770468_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|770678_771056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|771281_771623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260447.1|771829_772270_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_012444008.1|772307_773057_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409543.1|773194_773770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465763.1|773894_774512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099051264.1|774554_775352_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260442.1|775360_776170_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_012444011.1|776345_777149_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_027703938.1|777252_778230_+	uroporphyrin-III methyltransferase	NA	NA	NA	NA	NA
WP_011260439.1|778226_779492_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409538.1|779917_780442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703939.1|780571_781867_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_012444016.1|781938_782841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260435.1|783043_783424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182581.1|783956_784922_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	805795	867392	5026592	transposase	Leptospira_phage(22.22%)	37	NA	NA
WP_082356999.1|805795_806830_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.1	9.4e-44
WP_012444032.1|807712_808639_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_011409516.1|808847_809177_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_041182863.1|809571_810243_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011260409.1|810239_810731_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260408.1|810965_811895_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011409514.1|812492_813968_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011409513.1|814002_814851_+	amino acid lyase	NA	NA	NA	NA	NA
WP_099051317.1|814899_816001_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.5e-42
WP_027704189.1|816211_816808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444037.1|817155_818739_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.0	2.5e-35
WP_011409509.1|819129_819321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182582.1|821837_824162_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_012444041.1|826070_827162_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182865.1|827537_828611_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041182866.1|829202_830081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409500.1|830278_831154_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012444044.1|831429_833202_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_012444046.1|833610_835257_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_115877392.1|836477_837854_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_027703842.1|837947_838943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703841.1|839188_840100_+	magnesium transporter	NA	NA	NA	NA	NA
WP_012444053.1|840694_840979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409497.1|841309_841756_+	autotransporter	NA	NA	NA	NA	NA
WP_012444055.1|842019_842988_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	6.6e-100
WP_115862274.1|843200_844520_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260388.1|844936_846610_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_027704042.1|846863_847649_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_094187782.1|848696_849459_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409494.1|849702_850707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182280.1|850745_851675_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011260383.1|852222_855093_-	insulinase family protein	NA	NA	NA	NA	NA
WP_012444064.1|855346_857971_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_012444069.1|859205_860648_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.4e-47
WP_012444070.1|860855_862343_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	1.6e-124
WP_011260378.1|863733_865383_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_012444074.1|866156_867392_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	950097	987747	5026592	transposase	Herpes_simplex_virus(33.33%)	22	NA	NA
WP_012444121.1|950097_951333_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260307.1|952064_954755_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260306.1|954905_957803_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409433.1|960358_961525_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011409432.1|961739_962507_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703724.1|962551_963829_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_012444129.1|963869_964937_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260300.1|964943_965972_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409430.1|965974_967129_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_012444131.1|967548_968154_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011260297.1|968150_969404_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011409429.1|969405_971304_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_012444133.1|971305_973348_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_012444134.1|973972_974203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115877393.1|974664_975630_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115877347.1|975782_977102_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_113341418.1|977481_978939_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_113341417.1|978967_979177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|979290_980505_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187771.1|982475_983238_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|984071_985304_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_099051265.1|986949_987747_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1170963	1218421	5026592	tRNA,transposase	Ralstonia_phage(25.0%)	43	NA	NA
WP_099051268.1|1170963_1171726_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260138.1|1172816_1174556_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_012444256.1|1174960_1175602_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444257.1|1175603_1175840_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011409313.1|1175954_1176419_-	response regulator	NA	NA	NA	NA	NA
WP_012444258.1|1176415_1177246_-	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	5.8e-12
WP_011258802.1|1177583_1178552_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|1179974_1180943_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115877340.1|1181142_1182462_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409289.1|1183789_1184305_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012444263.1|1184400_1185051_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011260092.1|1185466_1186045_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_109181928.1|1187478_1188444_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444266.1|1189107_1190076_-	transaldolase	NA	NA	NA	NA	NA
WP_033013331.1|1190138_1190570_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_012444268.1|1190996_1191938_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409282.1|1192029_1193622_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
WP_010381556.1|1193817_1194381_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_011260084.1|1194582_1195428_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011260083.1|1195665_1196064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260082.1|1196107_1196434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703739.1|1196444_1196822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703740.1|1196935_1197241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260081.1|1197329_1198271_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_011260080.1|1198471_1199269_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_011260079.1|1199249_1199801_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011260078.1|1199797_1200784_-	exodeoxyribonuclease IX	NA	A0A2H4IAS6	Erwinia_phage	27.0	2.8e-13
WP_011409277.1|1200780_1201356_-	nitroreductase	NA	NA	NA	NA	NA
WP_011260076.1|1201723_1204063_+	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011409276.1|1204208_1205306_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_027703741.1|1205703_1206189_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_012444274.1|1206194_1206545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444275.1|1206541_1207111_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011409274.1|1207234_1207540_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_011260068.1|1207536_1209024_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_094187731.1|1208937_1209736_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182599.1|1209939_1210164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409271.1|1210278_1210698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260066.1|1210884_1211439_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_011260065.1|1211503_1212589_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_012444279.1|1214334_1215699_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	35.2	1.1e-31
WP_027703427.1|1216042_1217740_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.2	5.3e-28
WP_012444282.1|1217947_1218421_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1273454	1415289	5026592	tRNA,transposase	Ralstonia_phage(25.93%)	109	NA	NA
WP_012444301.1|1273454_1274513_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1274694_1275458_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409252.1|1277970_1279056_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_011409251.1|1279052_1280123_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_011260011.1|1280130_1280826_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_011260010.1|1280822_1281272_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_041182872.1|1281601_1284556_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.8	2.6e-256
WP_041182602.1|1285023_1285206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703307.1|1285636_1286440_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.3	4.5e-25
WP_041182873.1|1286528_1287740_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444311.1|1287736_1289896_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	5.7e-35
WP_011260005.1|1291237_1291642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444312.1|1291723_1293742_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_041182603.1|1293853_1295524_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_011409241.1|1295520_1296285_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027703306.1|1296384_1298118_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011409239.1|1298336_1299053_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	1.4e-22
WP_027703305.1|1299045_1300338_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_027703304.1|1300489_1300981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003484370.1|1301049_1301307_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_012444318.1|1301309_1302119_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027703303.1|1302154_1302895_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011259995.1|1302899_1303496_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259994.1|1303740_1304937_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010371538.1|1304936_1305578_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011259992.1|1305928_1307110_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_027703302.1|1307191_1307578_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259990.1|1307580_1308255_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011259989.1|1308318_1309116_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011259988.1|1309246_1309426_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_011259987.1|1309422_1309707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444323.1|1310323_1311526_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_012444325.1|1312339_1312486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703300.1|1312543_1313275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444327.1|1313474_1314353_+	M15 family metallopeptidase	NA	A0A0A0RV08	Bacillus_phage	42.7	2.5e-05
WP_012444328.1|1314462_1314723_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_012444329.1|1314782_1316264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703298.1|1316279_1320017_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011259979.1|1320013_1320997_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_012444331.1|1320993_1321800_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011409224.1|1321852_1322926_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_115877349.1|1323875_1326851_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.8	4.5e-54
WP_041182604.1|1326837_1329903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444334.1|1329955_1330915_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_082357001.1|1330982_1331558_+	DNA repair protein	NA	NA	NA	NA	NA
WP_012444336.1|1331610_1332573_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_115877395.1|1332667_1333207_+	DNA repair protein	NA	NA	NA	NA	NA
WP_041182545.1|1333420_1334377_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011407587.1|1336965_1338000_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409215.1|1338789_1339752_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
WP_113341592.1|1342642_1343506_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_161629184.1|1343619_1344213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|1344265_1345222_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_115877350.1|1345771_1347091_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1347303_1348272_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258251.1|1348356_1348590_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_109182069.1|1348822_1350142_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1350341_1351310_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168746.1|1351361_1351853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182607.1|1351849_1356340_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_115877351.1|1356486_1357806_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1358005_1358974_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_027703641.1|1359111_1359681_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012444351.1|1359677_1362086_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1362417_1362879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444353.1|1363125_1364016_-	pirin family protein	NA	NA	NA	NA	NA
WP_129215637.1|1364193_1364706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1364777_1365491_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_012444355.1|1365594_1366344_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_103057495.1|1366692_1366947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444359.1|1367290_1369348_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.4	3.6e-79
WP_044757485.1|1371295_1372417_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1372431_1373238_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_041182609.1|1373242_1374526_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011258265.1|1374552_1375068_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258266.1|1375078_1377247_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.6	2.9e-10
WP_082357002.1|1377315_1378428_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258188.1|1378847_1379816_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258268.1|1380515_1380845_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_128415371.1|1380884_1381103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444366.1|1381334_1384799_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1385201_1385744_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1386155_1387064_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_113328182.1|1387508_1388219_+	histidine kinase	NA	NA	NA	NA	NA
WP_012444368.1|1388346_1389405_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_115877352.1|1389526_1390846_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444370.1|1390916_1391729_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1392463_1392847_+	membrane protein	NA	NA	NA	NA	NA
WP_041182611.1|1392960_1393965_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.1	6.4e-98
WP_027704263.1|1394339_1395563_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	2.4e-54
WP_033013649.1|1395562_1396465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057417.1|1396421_1397876_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_012444376.1|1397855_1398911_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	8.4e-64
WP_011258280.1|1398971_1399784_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1400299_1400683_+	membrane protein	NA	NA	NA	NA	NA
WP_099051270.1|1400805_1401810_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	4.9e-98
WP_041182612.1|1402000_1402615_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011258802.1|1402725_1403694_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408021.1|1404204_1404792_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_012444381.1|1404909_1405794_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_011258289.1|1406979_1408383_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1408396_1408903_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182614.1|1409308_1409767_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1410544_1410748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1412167_1412653_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1412880_1413096_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1413346_1413826_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027704135.1|1413957_1414386_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1414458_1415289_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1421638	1487642	5026592	transposase	Bacillus_virus(11.76%)	44	NA	NA
WP_011258305.1|1421638_1423579_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1423795_1424350_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1424571_1426002_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|1426104_1427523_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_012444400.1|1427939_1428665_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011258310.1|1428763_1429174_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182615.1|1429225_1430182_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.6e-40
WP_012444404.1|1430425_1432807_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1435435_1435846_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1436145_1436328_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1436460_1437501_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1437573_1439019_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_027704131.1|1439145_1440444_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_012444410.1|1440700_1441246_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_012444411.1|1441242_1442706_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1444168_1444423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704130.1|1444825_1445359_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1445384_1445786_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1445754_1446135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1446131_1446374_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258327.1|1446402_1447062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|1447737_1449642_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_012444418.1|1449905_1452302_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258331.1|1452451_1453174_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1456093_1456594_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075242605.1|1456535_1458212_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1458358_1459624_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|1459682_1460876_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|1460872_1461562_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_033013597.1|1461667_1463137_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1463156_1463993_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1464018_1465122_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444428.1|1465118_1468175_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1468240_1468831_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1468962_1470795_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_011407587.1|1471480_1472515_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011257570.1|1473852_1475088_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_115877353.1|1476729_1481211_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408064.1|1481216_1481585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1481754_1482723_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182619.1|1483414_1484371_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	1.1e-41
WP_158645227.1|1484354_1484657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115877354.1|1485217_1486537_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|1486673_1487642_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
>prophage 13
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1538322	1593133	5026592	tRNA,transposase	Ralstonia_phage(57.14%)	30	NA	NA
WP_011258399.1|1538322_1541154_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|1541468_1541969_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|1542057_1543008_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1543521_1544457_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1544456_1546457_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_033013172.1|1546459_1547086_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1547085_1547421_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_012444469.1|1547587_1549468_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012444470.1|1549692_1551939_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_012444471.1|1551962_1553582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444473.1|1553725_1558465_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	1.0e-20
WP_033013550.1|1558466_1558856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113341597.1|1560240_1560594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082356941.1|1561261_1561414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182622.1|1561417_1561993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157724567.1|1563572_1563845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444055.1|1568919_1569888_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	6.6e-100
WP_113000360.1|1570028_1570325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168749.1|1570314_1570914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187763.1|1573791_1574589_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|1575923_1576892_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_041182623.1|1576943_1577219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182297.1|1577222_1578185_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182624.1|1578732_1579470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115877355.1|1579958_1581278_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027704080.1|1583329_1584061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444487.1|1584088_1586923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444488.1|1586919_1587849_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012444489.1|1587857_1590620_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	6.0e-45
WP_011258529.1|1592164_1593133_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
>prophage 14
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1596971	1645136	5026592	plate,transposase	Enterobacteria_phage(20.0%)	30	NA	NA
WP_011259603.1|1596971_1597475_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012444494.1|1597478_1599356_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012444495.1|1599319_1600330_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012444496.1|1600362_1603068_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.1e-80
WP_027703476.1|1603256_1603754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|1603819_1604314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408952.1|1604701_1605160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|1605424_1607362_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408951.1|1607370_1607910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444498.1|1607906_1609319_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408949.1|1609315_1610653_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012444499.1|1610654_1611971_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_012444500.1|1611974_1615433_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_041182626.1|1615429_1616077_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011259593.1|1616073_1616796_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_012444503.1|1616792_1619696_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_012444504.1|1619692_1620019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444505.1|1620191_1621220_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_041182627.1|1621228_1622209_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182628.1|1622322_1624782_-	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259588.1|1624778_1625771_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013236.1|1625767_1626475_-	response regulator	NA	NA	NA	NA	NA
WP_012444509.1|1629507_1632588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444510.1|1633004_1634102_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444511.1|1634487_1636575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1637449_1638406_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012444512.1|1639118_1639697_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182629.1|1639820_1640933_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444514.1|1640989_1643578_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012444515.1|1643660_1645136_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
>prophage 15
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1726662	1736867	5026592	tRNA	Pseudomonas_phage(28.57%)	9	NA	NA
WP_011408886.1|1726662_1728339_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
WP_011408885.1|1728427_1729069_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408884.1|1729241_1730276_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_012444556.1|1730578_1731067_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011259507.1|1731168_1733817_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_003481884.1|1733956_1734169_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_103057523.1|1734771_1735299_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_012444559.1|1735686_1735986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444561.1|1736171_1736867_+	replicative DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
>prophage 16
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1775727	1839468	5026592	tRNA,transposase	uncultured_Caudovirales_phage(46.15%)	40	NA	NA
WP_094187715.1|1775727_1776490_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408860.1|1776900_1777617_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011259464.1|1777856_1778981_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_012444585.1|1778980_1779424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259463.1|1779432_1782675_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011408858.1|1782671_1783148_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259461.1|1783164_1784085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408857.1|1784081_1785821_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_115877358.1|1786367_1787687_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_161629172.1|1787810_1788296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408855.1|1788477_1788855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259457.1|1789015_1789717_-|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_027703619.1|1792525_1793473_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503214.1|1793726_1794851_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_012444590.1|1795055_1796573_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.7	5.5e-85
WP_011408849.1|1796714_1797851_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_011259451.1|1798215_1800393_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408848.1|1800404_1801274_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_012444593.1|1801450_1803133_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	3.2e-33
WP_011259446.1|1803782_1806551_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1806698_1806947_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1806943_1807354_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012444596.1|1807419_1810011_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259442.1|1810364_1811180_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011408846.1|1811835_1814079_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259440.1|1814187_1815264_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011259439.1|1815260_1815857_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011408845.1|1815853_1816720_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_012444601.1|1816973_1819367_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.8e-09
WP_012444602.1|1819451_1819775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099051275.1|1820017_1820816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408841.1|1821664_1822147_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408840.1|1822282_1823068_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_099051276.1|1823388_1824186_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259432.1|1824889_1827151_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011259431.1|1827544_1829806_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_012444606.1|1830398_1832474_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_041182888.1|1833161_1835273_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_012444608.1|1836003_1838262_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	4.9e-13
WP_115840174.1|1838502_1839468_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1845765	1916901	5026592	transposase	Ralstonia_phage(33.33%)	46	NA	NA
WP_011408830.1|1845765_1846020_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011259422.1|1846187_1848197_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|1848230_1848596_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259421.1|1848592_1848901_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011259420.1|1849001_1850024_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259419.1|1850020_1850803_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_012444616.1|1850918_1851779_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_027703782.1|1851785_1852526_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_027703781.1|1852614_1852968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239855.1|1852964_1853480_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011259416.1|1853502_1853895_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_012444621.1|1854046_1854754_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.0	1.4e-51
WP_128415369.1|1854829_1855177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444623.1|1855178_1856984_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703779.1|1857238_1857691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182889.1|1858680_1861782_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703777.1|1862164_1862557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115877359.1|1862623_1863943_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|1864170_1864485_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_157724569.1|1864417_1865371_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182637.1|1865531_1865921_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_041182637.1|1870766_1871156_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_082356945.1|1871195_1873787_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444636.1|1875352_1878115_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	3.3e-43
WP_012444637.1|1878123_1879053_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012444638.1|1879049_1881887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182640.1|1881911_1882646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444640.1|1882663_1885006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|1885037_1885769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115877360.1|1885839_1887159_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|1887455_1888490_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_041182641.1|1888529_1889456_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.5e-93
WP_012444644.1|1889539_1891852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1891862_1892831_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444645.1|1893560_1894838_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_011259402.1|1895015_1896758_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011259401.1|1896916_1897873_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_041182642.1|1897869_1900386_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011408798.1|1900546_1901542_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_094187736.1|1902176_1902940_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257851.1|1903064_1904030_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444648.1|1905005_1908176_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012444649.1|1908188_1909493_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027703873.1|1909507_1910167_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444652.1|1910444_1915469_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_012444654.1|1915917_1916901_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	2.0e-96
>prophage 18
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	1943583	2004652	5026592	tRNA,protease,transposase	Bacillus_virus(22.22%)	48	NA	NA
WP_115877361.1|1943583_1944903_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408779.1|1945409_1946612_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011408778.1|1946608_1948195_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408777.1|1948199_1949693_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_075240166.1|1949838_1951086_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	9.0e-25
WP_011259369.1|1951399_1952230_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_027703622.1|1952385_1952796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444676.1|1953050_1954415_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011259367.1|1954566_1955568_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011259366.1|1955583_1956864_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_012444677.1|1956860_1957739_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011408769.1|1957833_1958352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703624.1|1958351_1958837_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011259362.1|1958891_1959554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408767.1|1959965_1960952_-	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_041182646.1|1961375_1962830_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_012444681.1|1964765_1965752_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011259356.1|1966281_1966926_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259355.1|1966925_1968185_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_027703625.1|1968177_1968936_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011259353.1|1969328_1969964_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259352.1|1970042_1970483_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011408764.1|1970515_1970842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465594.1|1971052_1971397_-	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|1975961_1976927_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|1977507_1978692_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_080256628.1|1979464_1979653_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408759.1|1980137_1980416_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041182647.1|1980403_1980694_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015463309.1|1981295_1981475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187731.1|1981976_1982774_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259345.1|1983190_1983592_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011408756.1|1984684_1985776_-	ribonuclease D	NA	NA	NA	NA	NA
WP_041182165.1|1986047_1987883_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_094187754.1|1988199_1988946_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259340.1|1989163_1990426_+	virulence factor	NA	NA	NA	NA	NA
WP_012444699.1|1990721_1992059_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	35.8	5.0e-37
WP_011408752.1|1992204_1993272_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_012444700.1|1993296_1994784_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_012444701.1|1994780_1995281_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_012444702.1|1995333_1997067_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259334.1|1997204_1999082_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_027703274.1|1999081_2000035_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011408749.1|2000068_2001040_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_027703272.1|2001213_2001789_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408747.1|2001948_2002689_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_012444705.1|2002776_2003676_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_012444706.1|2003773_2004652_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 19
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2037064	2096501	5026592	tRNA,transposase	Streptococcus_phage(25.0%)	42	NA	NA
WP_094187777.1|2037064_2037863_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2038850_2039819_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_115877362.1|2039955_2041275_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444728.1|2041498_2041987_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011259294.1|2042358_2042622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408729.1|2043493_2044333_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011259290.1|2044332_2045682_-	dihydroorotase	NA	NA	NA	NA	NA
WP_033013281.1|2045678_2045966_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075239838.1|2046050_2047079_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011259288.1|2047221_2048283_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_011259287.1|2048350_2049601_-	MFS transporter	NA	NA	NA	NA	NA
WP_012444735.1|2049597_2050035_-	SufE family protein	NA	NA	NA	NA	NA
WP_012444736.1|2050532_2051957_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_027703614.1|2052133_2052628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259283.1|2052940_2053966_+	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2054037_2055279_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011408722.1|2055520_2055973_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259280.1|2055978_2057079_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011259279.1|2057118_2058462_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_041182650.1|2059074_2060025_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408717.1|2060148_2061444_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011408716.1|2061443_2061809_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011259275.1|2061808_2062069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408715.1|2062082_2063237_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011408714.1|2063415_2064660_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011259272.1|2065027_2066941_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_012444741.1|2066921_2068187_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703617.1|2068407_2068518_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011259267.1|2068896_2069160_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_033013282.1|2069208_2070309_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_075239845.1|2070460_2072197_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_011408708.1|2072193_2073879_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_012444745.1|2074047_2075346_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801893.1|2075352_2076318_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_153296779.1|2078021_2078420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259261.1|2078840_2079302_-	cytochrome c	NA	NA	NA	NA	NA
WP_011259260.1|2079310_2079703_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_012444754.1|2084559_2087031_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.9	1.2e-47
WP_027703905.1|2087070_2087628_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_128415342.1|2087836_2088316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562584.1|2090424_2093823_-	avirulence protein	NA	NA	NA	NA	NA
WP_099051277.1|2095444_2096501_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2102702	2145077	5026592	tRNA,transposase	uncultured_Mediterranean_phage(28.57%)	29	NA	NA
WP_012444766.1|2102702_2103746_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2104025_2104789_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259142.1|2105404_2106037_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011259140.1|2108921_2110043_+	phytase	NA	NA	NA	NA	NA
WP_011258529.1|2113734_2114703_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011259129.1|2116869_2117577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408639.1|2117647_2117962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259128.1|2117921_2119418_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259127.1|2119541_2119973_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703908.1|2120152_2121223_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259125.1|2121292_2122438_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_011259124.1|2122569_2122923_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_012444775.1|2123119_2124964_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259122.1|2125058_2126027_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011408636.1|2126107_2126470_-	recombinase	NA	NA	NA	NA	NA
WP_115877363.1|2129088_2130477_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082325607.1|2130726_2131911_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_044756859.1|2131961_2133023_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115877355.1|2133259_2134579_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259117.1|2134649_2135285_-	ribonuclease T	NA	NA	NA	NA	NA
WP_012444782.1|2135568_2135964_-	RcnB family protein	NA	NA	NA	NA	NA
WP_011408630.1|2136096_2136807_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259114.1|2136935_2137766_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011259113.1|2137788_2138658_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_012444784.1|2138657_2139632_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_012444785.1|2139744_2140836_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_012444786.1|2141021_2142041_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	2.1e-48
WP_012444787.1|2142230_2143481_-	porin	NA	NA	NA	NA	NA
WP_094187715.1|2144314_2145077_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2234059	2381614	5026592	protease,transposase	Xanthomonas_phage(21.21%)	108	NA	NA
WP_041182545.1|2234059_2235016_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_041182656.1|2235628_2237005_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	7.1e-63
WP_011408569.1|2239557_2240736_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
WP_011408568.1|2240773_2241694_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011259034.1|2242309_2243677_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.9	9.9e-25
WP_011259033.1|2243680_2244166_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011259032.1|2244201_2245017_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	2.1e-30
WP_011259031.1|2245013_2245856_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011259030.1|2246034_2246415_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_012444846.1|2246411_2247926_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012444847.1|2248084_2248426_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_012444848.1|2248429_2249053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703351.1|2249287_2251243_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_027703350.1|2251676_2254289_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_075240030.1|2254281_2254539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408561.1|2254548_2256111_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
WP_027703349.1|2256355_2258212_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041182436.1|2259538_2261728_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_012444858.1|2261856_2263635_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_012444859.1|2264836_2265445_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011259018.1|2265861_2266050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2266233_2266548_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259016.1|2266598_2267432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444862.1|2267498_2267999_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703344.1|2268090_2268669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2268830_2269331_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011259011.1|2270855_2271569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703343.1|2271820_2272060_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259009.1|2274516_2275002_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_011408551.1|2275152_2275932_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012444869.1|2276120_2278001_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011259006.1|2278334_2279852_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_011408550.1|2280170_2280623_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011259000.1|2284314_2285289_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_027704049.1|2285455_2285689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704112.1|2289504_2290023_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.7	6.8e-27
WP_115877364.1|2291756_2293076_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_162828846.1|2293126_2293645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256634.1|2294104_2295229_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.6e-15
WP_012444882.1|2295225_2297454_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_041182659.1|2297535_2298750_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.2	6.9e-54
WP_012444885.1|2300534_2301554_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027703901.1|2301837_2303418_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_027703900.1|2304628_2304976_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012444889.1|2304972_2305503_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_012444890.1|2305513_2305927_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_012444891.1|2305923_2306649_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	3.1e-86
WP_012444892.1|2306667_2307972_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.2	8.3e-130
WP_026144156.1|2308235_2308592_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012444894.1|2309587_2312548_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_099051283.1|2313698_2314461_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444897.1|2314577_2317973_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_011258994.1|2318187_2318568_-	response regulator	NA	NA	NA	NA	NA
WP_012444899.1|2318835_2319012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703995.1|2319583_2319787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|2319829_2320592_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444902.1|2322229_2322889_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_012444903.1|2322944_2324861_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011258989.1|2324963_2325683_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258988.1|2325679_2326687_-	glucokinase	NA	NA	NA	NA	NA
WP_011408534.1|2326683_2328114_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258986.1|2328548_2329646_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408533.1|2329774_2330647_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_012444907.1|2330590_2330857_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011258985.1|2330916_2331312_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011258984.1|2331308_2331695_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_012444909.1|2331729_2333520_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_012444910.1|2333523_2333733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408532.1|2333749_2334532_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2334642_2334891_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_014503500.1|2334841_2335294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010378794.1|2335317_2336559_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011258980.1|2336551_2337286_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_041182661.1|2338679_2339645_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408527.1|2339898_2342307_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_011408526.1|2342335_2342998_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011258975.1|2343001_2343466_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011258974.1|2343462_2345232_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258973.1|2345228_2346269_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258972.1|2346560_2347340_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258971.1|2347336_2347801_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012444920.1|2347824_2349243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258969.1|2349239_2351096_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258968.1|2351095_2351728_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444921.1|2352202_2352709_-	glyoxalase	NA	NA	NA	NA	NA
WP_115877396.1|2352875_2353862_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.0e-36
WP_011407609.1|2353825_2355010_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_128415389.1|2359798_2360125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408520.1|2360824_2361496_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|2361492_2361669_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041182662.1|2361887_2365910_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2366133_2366433_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_012444931.1|2366436_2366631_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_041182663.1|2366899_2370196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239627.1|2371577_2371676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2372429_2372615_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2372614_2372818_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2372953_2374027_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2374131_2374431_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2374794_2375034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2375140_2376625_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2376626_2376947_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011258954.1|2376943_2378128_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	2.3e-54
WP_080493496.1|2378182_2378353_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2379461_2379722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|2380201_2380384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2380505_2380817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2380850_2381614_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2509600	2546779	5026592	transposase	Bacillus_virus(33.33%)	31	NA	NA
WP_115877397.1|2509600_2510566_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408430.1|2510586_2511390_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011408429.1|2511529_2512678_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408428.1|2512904_2513549_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011258853.1|2513545_2514241_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_012445013.1|2514335_2515088_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258852.1|2515084_2515255_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011258851.1|2515251_2515722_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408426.1|2515890_2517828_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258849.1|2517820_2518423_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011258848.1|2518419_2518851_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012445015.1|2518850_2519864_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012445016.1|2520153_2522025_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011408424.1|2522021_2522321_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011408423.1|2522355_2523774_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011258842.1|2523982_2525224_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_027703722.1|2525372_2525960_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_033013325.1|2526105_2527578_+	amino acid permease	NA	NA	NA	NA	NA
WP_012445020.1|2527654_2529085_+	amino acid permease	NA	NA	NA	NA	NA
WP_027703723.1|2529173_2529851_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_011408417.1|2529862_2530429_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_012445022.1|2530431_2531130_+	acireductone synthase	NA	NA	NA	NA	NA
WP_012445023.1|2531455_2532541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445025.1|2532988_2533582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258834.1|2533598_2534162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115877398.1|2535184_2536504_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2536716_2537685_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075239722.1|2538558_2539716_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_115877399.1|2539992_2540958_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115877367.1|2542529_2543849_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445035.1|2545543_2546779_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2664226	2781440	5026592	tRNA,transposase	Xanthomonas_phage(10.0%)	72	NA	NA
WP_115877368.1|2664226_2665189_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_113302692.1|2666389_2666773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115877369.1|2667239_2668559_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_129215609.1|2668602_2669148_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_041182672.1|2673508_2673835_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_109181928.1|2673828_2674794_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012445088.1|2674841_2675027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082356957.1|2680830_2685801_-	glutamate synthase	NA	NA	NA	NA	NA
WP_012445091.1|2686605_2688081_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.3e-99
WP_082356958.1|2689632_2693235_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182100.1|2693503_2693698_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2693701_2694001_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_041182674.1|2694224_2697980_+	avirulence protein	NA	NA	NA	NA	NA
WP_153296780.1|2698392_2698659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258825.1|2699349_2700363_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012445099.1|2700462_2701059_+	azoreductase	NA	NA	NA	NA	NA
WP_011258802.1|2701110_2702079_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115801888.1|2702291_2703611_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|2704050_2704848_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258822.1|2704998_2706348_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_012445101.1|2706459_2707119_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2707479_2707947_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_099051325.1|2708133_2709235_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_109182027.1|2711252_2712218_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258800.1|2716055_2717255_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2717403_2717586_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011408522.1|2719439_2720624_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109182067.1|2721687_2722653_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|2722653_2723407_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|2724111_2725326_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_012445118.1|2725597_2726566_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011257854.1|2726750_2727986_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012445119.1|2728038_2728806_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_012445121.1|2730033_2732562_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	3.1e-64
WP_041182915.1|2733128_2734574_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258788.1|2734945_2735086_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027703703.1|2735085_2736267_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258786.1|2736355_2737351_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011258785.1|2737347_2738487_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_012445124.1|2738629_2741383_+	methionine synthase	NA	NA	NA	NA	NA
WP_011258783.1|2741769_2742975_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_012445125.1|2742971_2743958_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258781.1|2743954_2745265_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_041182916.1|2745278_2746454_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027703705.1|2746594_2747440_-	transporter	NA	NA	NA	NA	NA
WP_011258778.1|2747773_2748526_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_011258777.1|2748526_2748763_-	protein SlyX	NA	NA	NA	NA	NA
WP_011258776.1|2748755_2750105_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	1.4e-79
WP_027703707.1|2750130_2751096_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408372.1|2751187_2751745_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_042464800.1|2751880_2752129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502778.1|2752131_2752494_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012445132.1|2752490_2753366_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_012445133.1|2753362_2754349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445134.1|2754358_2755189_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_027703710.1|2755821_2756244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|2756366_2757770_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_094187736.1|2759221_2759985_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258759.1|2763007_2764375_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_011258758.1|2764621_2765122_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_027703747.1|2765401_2765665_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_012445147.1|2766002_2767499_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258755.1|2767495_2768428_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012445148.1|2768608_2771437_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011258753.1|2771479_2772682_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258752.1|2772923_2774360_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258751.1|2774565_2775159_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_027703751.1|2775417_2776020_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011408359.1|2776016_2777786_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_011258748.1|2778124_2778730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408358.1|2778859_2779786_+	TolC family protein	NA	NA	NA	NA	NA
WP_115877370.1|2780120_2781440_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2805929	2873554	5026592	protease,coat,transposase	Bacillus_virus(28.57%)	54	NA	NA
WP_099051283.1|2805929_2806692_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703878.1|2806689_2807424_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258722.1|2807474_2809055_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703877.1|2809061_2810255_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445166.1|2810265_2811783_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012445167.1|2811779_2812220_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258718.1|2812341_2813193_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011408339.1|2813253_2815497_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	5.0e-82
WP_033013399.1|2815952_2816489_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012445169.1|2816584_2819002_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_011258714.1|2820381_2822508_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_027703366.1|2822938_2823991_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011258712.1|2824059_2825754_-	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_012445172.1|2826048_2827179_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011408335.1|2827183_2827684_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_011408334.1|2827680_2828037_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_012445174.1|2828499_2829696_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_041182680.1|2829712_2832322_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_012445176.1|2832318_2833095_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011408331.1|2833414_2833939_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011408330.1|2833947_2834718_+	molecular chaperone	NA	NA	NA	NA	NA
WP_012445179.1|2834734_2837086_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011258703.1|2837082_2838117_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_024710302.1|2838163_2838496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445181.1|2838498_2839224_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258701.1|2839615_2840419_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|2840588_2841467_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|2841594_2841972_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|2842028_2842751_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|2842931_2843489_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|2843506_2844268_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_014503921.1|2844264_2845092_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012445186.1|2845094_2846285_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_012445187.1|2846311_2847658_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445188.1|2847741_2850108_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_094187763.1|2850230_2851028_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258691.1|2851359_2852373_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2852369_2852831_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|2852854_2853646_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|2853684_2854941_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_041182085.1|2854937_2855678_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.2e-24
WP_011258686.1|2856135_2859726_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	2.0e-181
WP_011258685.1|2859901_2860861_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_027703353.1|2861700_2863881_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445193.1|2863880_2864618_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	4.5e-08
WP_011258681.1|2864614_2866027_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011408319.1|2866017_2867307_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_075244057.1|2867923_2868175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075244058.1|2868164_2868395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408317.1|2868472_2868919_-	membrane protein	NA	NA	NA	NA	NA
WP_011408316.1|2868992_2869595_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012445197.1|2869735_2871079_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_012445198.1|2871551_2872115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|2872588_2873554_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	2879168	2936706	5026592	tRNA,protease,transposase	Acidithiobacillus_phage(10.0%)	48	NA	NA
WP_041182681.1|2879168_2880545_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.7e-75
WP_041182682.1|2880664_2881879_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	1.4e-54
WP_011258670.1|2883528_2884203_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|2884207_2884984_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258668.1|2886256_2888194_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258667.1|2888375_2889353_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_012445208.1|2889349_2890747_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012445209.1|2891024_2892077_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	3.4e-65
WP_012445211.1|2892840_2893290_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011258663.1|2893514_2895599_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445212.1|2895795_2896392_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012445213.1|2896393_2896822_+	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_011258660.1|2897440_2898223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445216.1|2898308_2898677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|2898735_2899299_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445217.1|2899295_2900129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408297.1|2900354_2901353_+	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_027704227.1|2901349_2902600_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408295.1|2902599_2903484_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|2903480_2904776_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011258654.1|2904772_2905318_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011258653.1|2905314_2906097_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_012445221.1|2906114_2907185_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408290.1|2907347_2907695_-	RidA family protein	NA	NA	NA	NA	NA
WP_012445224.1|2908675_2911240_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011258647.1|2911863_2913234_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258646.1|2913303_2913498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258645.1|2913557_2914166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408284.1|2914201_2914804_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258643.1|2915077_2915533_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011258642.1|2916095_2917307_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408282.1|2917527_2918646_+	alkene reductase	NA	NA	NA	NA	NA
WP_080256652.1|2919536_2919827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408280.1|2920115_2920451_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_027704229.1|2920565_2921615_+	cation transporter	NA	NA	NA	NA	NA
WP_012445230.1|2921862_2923098_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_012445231.1|2923273_2923747_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012445232.1|2923886_2925263_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011258635.1|2925452_2925638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187731.1|2926617_2927416_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862279.1|2927532_2928852_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259046.1|2929064_2930033_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258631.1|2930289_2930556_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|2930730_2930985_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|2931145_2931319_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012445235.1|2931720_2932248_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|2932716_2933817_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011258626.1|2933877_2936706_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
>prophage 26
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3058564	3141686	5026592	tRNA,transposase,protease	Bacillus_phage(20.0%)	55	NA	NA
WP_012445306.1|3058564_3059392_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011407237.1|3059680_3060637_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_108744354.1|3060746_3060917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317522.1|3061619_3062003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445310.1|3062908_3064153_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|3064149_3064428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408200.1|3064505_3064907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|3065189_3065561_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_148562586.1|3066005_3066302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258527.1|3066544_3068008_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|3068143_3070486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408196.1|3070765_3072607_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_027703763.1|3072656_3075188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408193.1|3075805_3076006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445314.1|3076063_3076384_-	RebB family R body protein	NA	NA	NA	NA	NA
WP_011258521.1|3076763_3077867_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_080493519.1|3078008_3079967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703765.1|3080076_3080808_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_027703766.1|3080804_3081869_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_115862280.1|3086517_3087837_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182920.1|3087969_3089052_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445323.1|3089063_3089687_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258512.1|3089937_3090414_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|3090447_3091650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703400.1|3091657_3098584_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|3098697_3100734_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|3100773_3101304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258508.1|3101303_3101666_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|3101683_3102085_-	response regulator	NA	NA	NA	NA	NA
WP_011408182.1|3102334_3103285_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|3103281_3104157_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_048488826.1|3104450_3105401_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	48.5	1.5e-64
WP_012445327.1|3105363_3106083_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258503.1|3106096_3108124_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408178.1|3108323_3108848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445329.1|3108861_3111306_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408177.1|3111547_3113650_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_027703398.1|3113982_3115425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445331.1|3115756_3117943_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|3118232_3118313_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_027703397.1|3118396_3119296_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_012445333.1|3119292_3120045_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_012445334.1|3120041_3120320_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_012445335.1|3120316_3121435_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|3121497_3122010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703396.1|3122438_3123953_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_027703395.1|3125394_3128049_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445342.1|3128269_3132391_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|3132492_3133038_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258487.1|3133594_3135391_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408165.1|3135529_3136027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703393.1|3136105_3136510_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|3137140_3137815_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_094187715.1|3139636_3140399_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258442.1|3140450_3141686_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3155736	3217461	5026592	tRNA,transposase	Ralstonia_phage(33.33%)	39	NA	NA
WP_012445358.1|3155736_3157503_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445359.1|3157660_3158437_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_012445361.1|3158934_3159228_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012445363.1|3159668_3160907_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258422.1|3163490_3165047_-	membrane protein	NA	NA	NA	NA	NA
WP_011258418.1|3166437_3167829_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_082356965.1|3170733_3173355_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	5.2e-30
WP_012445373.1|3173611_3176446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099051287.1|3176492_3177255_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182692.1|3177288_3178026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445376.1|3178050_3180729_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.9	8.4e-28
WP_053077061.1|3180670_3181576_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011407237.1|3184281_3185238_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_148562587.1|3185274_3185520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704271.1|3185528_3186545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445380.1|3186612_3188448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3188461_3189061_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3189148_3189505_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3189501_3189924_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445384.1|3189939_3190173_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_103057594.1|3190223_3190460_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_027704270.1|3190808_3192593_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3192625_3193612_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_041182694.1|3194022_3197730_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3198255_3199019_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3199122_3199770_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3199991_3200753_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408974.1|3200852_3201218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3201276_3201708_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3201719_3202982_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011259626.1|3202965_3204258_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3204627_3205398_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011407913.1|3205735_3206950_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187715.1|3207096_3207860_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445394.1|3208330_3209566_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3210864_3211122_-	stress-induced protein	NA	NA	NA	NA	NA
WP_082356967.1|3211561_3212545_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	3.3e-99
WP_012445397.1|3212860_3213829_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_041182696.1|3216498_3217461_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3285862	3389879	5026592	capsid,portal,terminase,integrase,tRNA,head,holin,tail,plate,transposase	Stenotrophomonas_phage(48.84%)	102	3324176:3324222	3366611:3366657
WP_094187763.1|3285862_3286661_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051289.1|3286803_3287830_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_024743012.1|3289343_3289880_+	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_041182468.1|3292670_3293753_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445462.1|3293870_3294851_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011259690.1|3294960_3295422_-	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	40.0	6.3e-16
WP_011259691.1|3295456_3296251_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_011259692.1|3296255_3297050_-	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	36.0	6.0e-22
WP_011259693.1|3297086_3298283_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011409038.1|3298347_3299841_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011259695.1|3299858_3300908_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259696.1|3300904_3302047_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_094187837.1|3302114_3303191_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011259698.1|3303207_3304299_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_049756340.1|3304295_3305585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409041.1|3305679_3307134_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_027704192.1|3307377_3308817_-	GumC family protein	NA	NA	NA	NA	NA
WP_011259702.1|3308798_3309497_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_005995911.1|3310105_3310462_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002811076.1|3310442_3310742_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
WP_011259703.1|3310763_3313142_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012445467.1|3313250_3314246_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	1.0e-31
WP_012445468.1|3314500_3314860_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002811096.1|3314870_3315068_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080098376.1|3315316_3315859_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_011409044.1|3315907_3317812_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	2.0e-124
WP_153296782.1|3319492_3319630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443979.1|3319879_3321115_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011259712.1|3321424_3323446_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011259713.1|3323584_3324127_+	fimbrial protein	NA	NA	NA	NA	NA
3324176:3324222	attL	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_041182701.1|3325201_3325933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182926.1|3326069_3327053_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	1.7e-98
WP_012445479.1|3327126_3329961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445480.1|3329957_3330884_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_153296783.1|3331869_3332226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147213250.1|3332418_3332601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445481.1|3332636_3334016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712752.1|3334099_3334303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182702.1|3334299_3334740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445482.1|3334853_3335564_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.5	9.2e-107
WP_053503138.1|3335481_3335727_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_041182703.1|3335752_3336775_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	1.5e-139
WP_011408153.1|3336774_3338559_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.6	4.7e-269
WP_012445485.1|3338680_3339523_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	1.5e-68
WP_011258476.1|3339569_3340586_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	5.5e-137
WP_011258475.1|3340589_3341309_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_012445486.1|3341408_3341876_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258473.1|3341875_3342085_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
WP_011258472.1|3342089_3342446_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_041182704.1|3342438_3342714_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_011408146.1|3342713_3343352_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_012445489.1|3343351_3343840_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.4	4.2e-26
WP_012445490.1|3343836_3344256_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	3.7e-39
WP_012445491.1|3344243_3344690_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	4.1e-36
WP_012445492.1|3345181_3346351_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_012445493.1|3346481_3347372_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	52.7	2.0e-82
WP_041182705.1|3347364_3347910_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.0	1.2e-50
WP_012445495.1|3347919_3349425_+|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.6	1.3e-54
WP_041182706.1|3349432_3350011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445497.1|3350071_3350635_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	9.1e-25
WP_012445498.1|3350631_3350991_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	1.9e-36
WP_012445499.1|3351002_3352169_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	64.3	1.2e-135
WP_011258458.1|3352199_3352709_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_012445500.1|3352754_3353057_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	70.1	2.0e-26
WP_011258456.1|3353065_3353179_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_012445501.1|3353211_3356082_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.8	1.8e-206
WP_012445502.1|3356094_3356496_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.9	1.0e-38
WP_012445503.1|3356492_3357479_+	phage late control D family protein	NA	E5E3U4	Burkholderia_phage	53.1	4.7e-93
WP_012445504.1|3358086_3358518_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	36.4	1.5e-11
WP_041182707.1|3358590_3358851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182927.1|3358853_3359171_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	59.8	3.9e-25
WP_041182708.1|3359183_3359462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182709.1|3359679_3362364_+	toprim domain protein	NA	V9IQW5	Stenotrophomonas_phage	70.7	0.0e+00
WP_012445510.1|3362687_3362906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445511.1|3362902_3363181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047339974.1|3363170_3363443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182710.1|3363522_3363942_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	47.4	4.0e-17
WP_041182711.1|3363934_3364117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182712.1|3364109_3364382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|3364378_3364603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182713.1|3364599_3364872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182715.1|3365292_3366534_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.9	4.8e-119
WP_011259714.1|3366740_3367196_-	type IV pilin protein	NA	NA	NA	NA	NA
3366611:3366657	attR	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_011409047.1|3367202_3371186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259718.1|3371142_3371652_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_011259719.1|3371655_3372822_-	pilus assembly protein PilW	NA	NA	NA	NA	NA
WP_011259720.1|3372818_3373292_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_027703389.1|3373288_3373804_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	41.8	8.6e-06
WP_011259722.1|3373973_3375359_-	LOG family protein	NA	NA	NA	NA	NA
WP_041182716.1|3375465_3378660_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409048.1|3379417_3380017_-	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_011259725.1|3380013_3380757_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259726.1|3380753_3381074_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_011259727.1|3381195_3381774_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.1	5.5e-33
WP_011259728.1|3381915_3383061_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_012445523.1|3383057_3383561_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
WP_011259730.1|3383619_3383889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259731.1|3383885_3384773_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_011409052.1|3384836_3385877_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_011259733.1|3386255_3388370_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003485583.1|3388535_3388796_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_011259734.1|3388952_3389879_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 29
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3414052	3475357	5026592	tRNA,protease,transposase	Burkholderia_virus(12.5%)	49	NA	NA
WP_094187736.1|3414052_3414816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3415839_3418206_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3418202_3418877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3419086_3420025_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3420147_3421497_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3421493_3422381_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_012445542.1|3422700_3423507_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_012445544.1|3423952_3425170_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_033013162.1|3425275_3426244_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	1.1e-09
WP_011259764.1|3426572_3427241_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3427237_3428011_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075247512.1|3428584_3430537_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3431217_3432243_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3432327_3433401_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3433393_3434497_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3434507_3435434_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3435514_3436165_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3436161_3437010_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3437560_3439144_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_041182719.1|3441316_3442273_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_153296738.1|3442802_3443090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3443200_3443707_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|3443828_3445229_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3445491_3446067_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3446063_3446498_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|3447281_3447467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3447501_3448071_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3448163_3449015_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3450402_3452418_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3452688_3453387_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3453427_3453835_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_012445557.1|3454272_3455235_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3456527_3457778_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027704196.1|3457785_3459030_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3459257_3459737_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3459847_3460384_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3460493_3461243_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3461450_3461942_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3463055_3464375_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012445565.1|3464518_3466225_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_012445566.1|3466258_3467563_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3467594_3467855_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3467856_3468732_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3470566_3471031_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3471082_3471271_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069959944.1|3471243_3471564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445571.1|3471560_3472928_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3473073_3473655_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012445573.1|3473911_3475357_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 30
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3483452	3555128	5026592	tRNA,transposase	Ralstonia_phage(30.0%)	52	NA	NA
WP_099051291.1|3483452_3484250_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445578.1|3484549_3487663_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3489078_3489549_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445580.1|3490133_3490313_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_012445581.1|3490638_3491754_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3491765_3492182_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027703805.1|3492238_3493138_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3493134_3494163_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3494185_3494821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445585.1|3495334_3497977_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.8	3.6e-172
WP_011259826.1|3498049_3498661_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|3498865_3499723_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_027703806.1|3499978_3500428_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_041182721.1|3500727_3501693_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3501817_3502580_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3503190_3503484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3503957_3504191_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3504224_3505238_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012445591.1|3505205_3505397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115877373.1|3505487_3506807_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|3506894_3508109_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011258188.1|3508809_3509778_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182722.1|3509938_3510904_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3511144_3511907_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3512209_3514342_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258802.1|3514892_3515861_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115877400.1|3516005_3516971_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|3517017_3517350_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3517346_3518110_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3518981_3519779_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3519812_3520205_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3520295_3520688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048488803.1|3522921_3523428_+	hypothetical protein	NA	C8CLF4	Xylella_phage	66.0	3.5e-28
WP_012445601.1|3525172_3526957_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3527147_3527348_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3527883_3528678_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3528979_3529738_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3529813_3531676_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3531733_3532075_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3532334_3532610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070808022.1|3532748_3534125_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.1e-76
WP_011259859.1|3535657_3536371_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|3536431_3536854_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3536985_3537749_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3540822_3541734_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_033013519.1|3542249_3542387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182027.1|3543081_3544047_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182725.1|3544926_3547596_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.3	1.8e-240
WP_011259867.1|3547947_3551073_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
WP_041182726.1|3551069_3552140_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258802.1|3552640_3553609_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115877360.1|3553808_3555128_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3584853	3665091	5026592	plate,transposase	Tupanvirus(11.11%)	53	NA	NA
WP_012445627.1|3584853_3585855_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011259891.1|3586881_3588987_+	catalase	NA	A0A2K9L572	Tupanvirus	48.1	5.1e-137
WP_027703311.1|3589812_3591051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182727.1|3591278_3593420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259895.1|3594252_3594978_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3595109_3595571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3597685_3599806_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3600072_3600918_-	transporter	NA	NA	NA	NA	NA
WP_011259903.1|3602042_3604013_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_027704155.1|3604441_3605839_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3605951_3606770_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_012445640.1|3607080_3610332_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	1.8e-80
WP_011259908.1|3610513_3611932_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3611941_3612592_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259910.1|3612593_3613199_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_012445642.1|3613348_3613570_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012445643.1|3613579_3614005_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	44.0	1.5e-08
WP_143704854.1|3614399_3614594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409167.1|3615520_3616300_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3616514_3617144_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3617204_3617960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182729.1|3618288_3619065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182730.1|3619473_3621048_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_012445648.1|3621296_3621563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|3622833_3623790_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012445651.1|3625208_3626678_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.6	9.3e-29
WP_012445652.1|3626682_3627405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445654.1|3628104_3630486_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_012445655.1|3630564_3630873_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3630879_3631143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445656.1|3631452_3634926_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_041182733.1|3635065_3636064_+	Abi family protein	NA	NA	NA	NA	NA
WP_012445658.1|3636110_3637655_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	24.2	1.2e-13
WP_113341666.1|3637644_3639138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182734.1|3639171_3639480_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3639486_3639750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182735.1|3640481_3641237_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_041182736.1|3641530_3642553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082357010.1|3642562_3644578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182737.1|3645062_3646094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445666.1|3646102_3648964_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_053077061.1|3648982_3649888_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011259938.1|3652684_3653038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445669.1|3653088_3655821_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_012445670.1|3655906_3656998_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259941.1|3656961_3658797_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259942.1|3658799_3659288_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3659435_3659933_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259943.1|3660074_3661571_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011259944.1|3661574_3662075_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012445672.1|3662121_3662610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409206.1|3662996_3663605_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011259947.1|3663756_3665091_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 32
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	3861063	4003087	5026592	transposase	Xanthomonas_phage(21.05%)	101	NA	NA
WP_012445794.1|3861063_3862299_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3862720_3864109_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3864864_3865806_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3866119_3866884_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3867076_3868459_+	APC family permease	NA	NA	NA	NA	NA
WP_011258087.1|3868898_3870296_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012445797.1|3870858_3871257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3871401_3872406_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3872443_3873961_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_012445799.1|3874001_3875048_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041182936.1|3875058_3875811_-	SapC family protein	NA	NA	NA	NA	NA
WP_027703605.1|3876142_3879301_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445804.1|3880347_3882354_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3882573_3883020_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3885011_3886178_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3886179_3886752_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3886764_3887169_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_012445805.1|3887206_3887884_-	YjfK family protein	NA	NA	NA	NA	NA
WP_041182757.1|3887880_3888963_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3888988_3889762_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3889774_3890191_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3890371_3890971_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3891137_3891680_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011258068.1|3891676_3892789_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3893090_3893342_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|3893356_3894421_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_027703611.1|3894484_3894718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182758.1|3895892_3899609_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|3899877_3900072_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011407856.1|3900075_3900375_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_012445810.1|3900598_3905050_+	avirulence protein	NA	NA	NA	NA	NA
WP_012445811.1|3905318_3905513_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.0e-19
WP_041182759.1|3905516_3905816_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	9.3e-45
WP_115877376.1|3906039_3910167_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|3910385_3910562_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012445821.1|3910558_3911230_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012445822.1|3911251_3912121_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_027703880.1|3912617_3915797_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703881.1|3916082_3917372_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3920762_3921212_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3922654_3923158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258050.1|3923182_3923608_-	cytochrome c	NA	NA	NA	NA	NA
WP_011407842.1|3926756_3927374_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_012445828.1|3927620_3928847_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	3.1e-17
WP_011258047.1|3928919_3929792_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3931052_3931851_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407839.1|3931931_3932591_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011407838.1|3932742_3934830_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012445831.1|3935004_3935985_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_011407835.1|3936418_3937306_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_027704066.1|3937519_3937909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407833.1|3937988_3938666_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_011258803.1|3938880_3939849_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_027704076.1|3940288_3941608_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_115877377.1|3941717_3942683_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3942771_3943535_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3943922_3944924_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3945580_3945721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407587.1|3947471_3948506_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_012445839.1|3949910_3950684_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011258028.1|3950697_3951528_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3951598_3952375_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012445841.1|3952385_3953078_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3953077_3953692_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3954034_3954619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407820.1|3955921_3956287_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182938.1|3956386_3957748_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_041182767.1|3957765_3958464_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	6.4e-28
WP_011407815.1|3959130_3959970_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3959969_3960644_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_027703581.1|3960640_3962140_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_027703582.1|3962136_3962784_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011258012.1|3965052_3966228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182768.1|3966357_3969072_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_080256611.1|3969391_3970384_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012445854.1|3970386_3971103_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	9.2e-06
WP_011258007.1|3971921_3973922_-	transketolase	NA	NA	NA	NA	NA
WP_012445856.1|3974148_3975378_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3975626_3975944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3976239_3977997_-	membrane protein	NA	NA	NA	NA	NA
WP_041182769.1|3977993_3979811_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_012445858.1|3979807_3980815_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|3980811_3981273_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3981275_3982238_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012445859.1|3982258_3983278_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115877378.1|3983900_3984923_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3985068_3987018_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3987037_3987571_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3987567_3988233_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_012445864.1|3988229_3988988_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407795.1|3988987_3990046_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257992.1|3990261_3992691_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407794.1|3993000_3993651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407793.1|3994026_3995316_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3995529_3995772_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_012445867.1|3995843_3996782_-	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_012445868.1|3996907_3999061_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257987.1|3999081_3999462_-	RidA family protein	NA	NA	NA	NA	NA
WP_011257986.1|3999541_4001713_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011407791.1|4001841_4002141_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_099051298.1|4002288_4003087_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4062243	4126395	5026592	integrase,protease,transposase	Ralstonia_phage(21.43%)	50	4056127:4056144	4134436:4134453
4056127:4056144	attL	GCGCCGGCAGCGCCTGCG	NA	NA	NA	NA
WP_012445901.1|4062243_4063479_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407751.1|4064467_4066069_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|4066685_4067432_-	cellulase	NA	NA	NA	NA	NA
WP_113341642.1|4067904_4068663_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|4069179_4069695_-	peptide deformylase	NA	NA	NA	NA	NA
WP_027703699.1|4070016_4070439_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.8e-41
WP_012445908.1|4071210_4073079_-	membrane protein	NA	NA	NA	NA	NA
WP_011407746.1|4073117_4074071_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|4074076_4075033_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011257916.1|4075025_4076978_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|4076974_4077508_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|4077627_4077978_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|4078079_4078673_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|4078770_4079091_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257911.1|4079097_4081194_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257910.1|4081755_4082202_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|4082198_4082444_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|4082440_4082938_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|4082962_4083322_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011257906.1|4083339_4084371_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|4084370_4085120_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|4085119_4085869_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257903.1|4085889_4086939_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|4087149_4087554_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407739.1|4087664_4088351_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_115862289.1|4088449_4089415_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182772.1|4090374_4092072_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012445921.1|4092068_4094273_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	3.5e-19
WP_041182773.1|4094334_4094598_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_012445924.1|4094594_4096277_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012445925.1|4096273_4098421_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	1.2e-27
WP_012445926.1|4098486_4101207_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.7	2.4e-70
WP_012445927.1|4101602_4101803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407730.1|4102699_4103329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445930.1|4104155_4104860_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_012445931.1|4105295_4106030_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	1.1e-35
WP_011257888.1|4106038_4106491_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257887.1|4106518_4107175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257886.1|4107187_4107955_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_041182774.1|4107951_4109130_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_027704260.1|4109856_4111827_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|4112658_4112931_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_012445937.1|4113144_4115616_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_012445938.1|4115759_4117046_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|4117170_4117797_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|4117889_4119182_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|4122499_4123261_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|4123404_4124412_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_041182775.1|4124675_4125641_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|4125641_4126395_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
4134436:4134453	attR	CGCAGGCGCTGCCGGCGC	NA	NA	NA	NA
>prophage 34
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4174970	4291833	5026592	protease,transposase	Acinetobacter_phage(12.5%)	81	NA	NA
WP_099051299.1|4174970_4175733_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|4175727_4175970_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|4176518_4176980_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_115877360.1|4177261_4178581_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182777.1|4178792_4179686_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	3.1e-96
WP_094187728.1|4181066_4181865_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257834.1|4182106_4182721_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_012445978.1|4182803_4183790_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4183905_4184400_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4184644_4186474_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|4186492_4186963_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4187885_4189013_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4189113_4190496_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_012445979.1|4190743_4192867_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|4193395_4193914_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_103057209.1|4198110_4198959_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|4199090_4199231_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|4203688_4205008_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|4205753_4206677_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_094187763.1|4206864_4207662_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|4208583_4209346_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115877379.1|4209435_4210401_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|4210702_4212280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|4212347_4213111_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182779.1|4213177_4214383_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	6.9e-54
WP_099051302.1|4215754_4216552_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257831.1|4217524_4218409_-	membrane protein	NA	NA	NA	NA	NA
WP_027703752.1|4218555_4219152_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_033013335.1|4219151_4220510_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011257828.1|4220876_4221440_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_012446003.1|4221599_4222856_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_109181928.1|4223426_4224392_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446005.1|4224535_4225027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182120.1|4225311_4225485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182780.1|4225481_4226447_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|4228700_4229183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|4229379_4229916_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011257817.1|4230029_4231178_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_027703666.1|4231792_4234759_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|4234807_4235701_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041182781.1|4235811_4238163_-	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407693.1|4238588_4240466_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|4241742_4242744_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|4242787_4244509_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|4244492_4244750_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_011407691.1|4244825_4245950_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|4245946_4247509_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|4247839_4248913_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_012446015.1|4248949_4249735_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011257807.1|4249731_4250379_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|4250446_4251895_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|4252015_4252900_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115862292.1|4253873_4254839_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|4255007_4255469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|4255739_4256393_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182783.1|4256521_4257178_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257798.1|4257198_4258578_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|4258850_4260167_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_027704168.1|4260243_4261164_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_027704169.1|4261397_4262732_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011407685.1|4262712_4263825_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|4263834_4264032_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|4264157_4264691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182784.1|4265317_4265953_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011257788.1|4267683_4268466_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012446023.1|4268659_4271332_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	3.4e-77
WP_012446024.1|4271657_4272950_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	6.4e-74
WP_011257785.1|4273287_4273473_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_027703756.1|4273767_4274631_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|4274630_4275758_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|4276387_4276774_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_012446026.1|4277013_4277913_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|4278323_4278800_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|4278962_4279445_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_012446027.1|4279487_4280048_+	bacterioferritin	NA	NA	NA	NA	NA
WP_041182785.1|4280182_4281145_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
WP_012445794.1|4283570_4284806_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407676.1|4285051_4285588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182786.1|4286086_4287034_-	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_027703870.1|4287208_4290196_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187728.1|4291034_4291833_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4318541	4387308	5026592	tRNA,transposase	Enterobacteria_phage(12.5%)	46	NA	NA
WP_041182787.1|4318541_4319507_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182788.1|4319618_4321910_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4322037_4322712_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_011257745.1|4322708_4324553_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4324549_4325416_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4325435_4326068_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|4326070_4327105_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|4327119_4327410_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4333927_4334767_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012446059.1|4335377_4336535_+	phosphotransferase	NA	NA	NA	NA	NA
WP_027704104.1|4336570_4338733_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|4339108_4339684_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|4339789_4340518_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|4340934_4341774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|4341770_4344083_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_027704103.1|4344079_4344889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|4344878_4345532_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_012446064.1|4345515_4346637_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|4346633_4347485_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_012446065.1|4347481_4348117_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_012446066.1|4348113_4348530_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|4348526_4349036_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|4349045_4349477_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|4349744_4350962_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_041181968.1|4350961_4351141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257721.1|4351137_4352820_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_012446073.1|4355097_4358895_-	membrane protein	NA	NA	NA	NA	NA
WP_011257719.1|4359872_4363925_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
WP_011257718.1|4364323_4365121_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|4365572_4366544_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|4366970_4367438_+	RDD family protein	NA	NA	NA	NA	NA
WP_011407635.1|4367852_4368959_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011407634.1|4368955_4370038_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011257713.1|4370145_4371618_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257712.1|4371617_4371923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257711.1|4371963_4372389_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011257710.1|4372596_4375539_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
WP_027704099.1|4375546_4375849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099051304.1|4376475_4377577_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	6.5e-43
WP_075239157.1|4377759_4378077_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_115877380.1|4378127_4379447_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012446083.1|4379659_4380628_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115877381.1|4380764_4382084_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257702.1|4382403_4383444_+	pectate lyase	NA	NA	NA	NA	NA
WP_027704044.1|4383710_4385684_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_115877382.1|4385988_4387308_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4408213	4418841	5026592		Enterobacteria_phage(57.14%)	10	NA	NA
WP_011407616.1|4408213_4409560_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4409606_4411010_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_012446096.1|4411126_4412035_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011407614.1|4412031_4412589_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_012446097.1|4412585_4413473_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.9e-94
WP_011407612.1|4413528_4414584_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_012446098.1|4414809_4415556_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_012446099.1|4415555_4416497_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_012446100.1|4416719_4417538_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4417527_4418841_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
>prophage 37
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4546132	4592180	5026592	transposase	Staphylococcus_prophage(33.33%)	35	NA	NA
WP_115877386.1|4546132_4547452_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012446193.1|4550926_4551307_+	response regulator	NA	NA	NA	NA	NA
WP_011257545.1|4551275_4551542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446194.1|4551541_4552822_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_033013438.1|4553946_4555347_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115801902.1|4559573_4560539_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407487.1|4560723_4561056_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_041182799.1|4561061_4563386_+	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_011407485.1|4564219_4564666_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257470.1|4564764_4565250_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_011407484.1|4565282_4565690_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_010368143.1|4565725_4567093_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011257468.1|4567231_4567597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187861.1|4567593_4567986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407482.1|4568054_4568519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257466.1|4569464_4570406_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_027703754.1|4570552_4571068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257464.1|4571211_4571589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075239516.1|4572299_4573145_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_011257462.1|4573251_4573524_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_109182067.1|4574208_4575174_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446211.1|4575170_4575365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|4575824_4576781_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_099051307.1|4579267_4580382_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	2.5e-82
WP_075240159.1|4580588_4580819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082356982.1|4580826_4581843_-	DUF4915 domain-containing protein	NA	NA	NA	NA	NA
WP_041182801.1|4581925_4582270_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053077065.1|4582712_4583798_+	radical SAM protein	NA	NA	NA	NA	NA
WP_041182802.1|4583794_4584544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182803.1|4584634_4585576_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_041182804.1|4585821_4586652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161798564.1|4586689_4587904_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041182806.1|4587987_4589904_+	ATP-binding cassette domain-containing protein	NA	F2Y165	Organic_Lake_phycodnavirus	30.0	2.1e-12
WP_041182807.1|4589935_4590967_+	sulfotransferase	NA	NA	NA	NA	NA
WP_048488833.1|4591388_4592180_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4754216	4808717	5026592	tRNA,transposase	Tupanvirus(14.29%)	46	NA	NA
WP_011257354.1|4754216_4755221_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012446316.1|4755683_4755908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113160272.1|4756158_4756344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4756628_4757204_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012446318.1|4757262_4758786_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_027704121.1|4759476_4759947_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012446321.1|4759908_4760097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182811.1|4760109_4761075_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407399.1|4761157_4761424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257345.1|4761697_4763830_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4764107_4764257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407398.1|4764291_4764678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4764679_4765531_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_027703509.1|4765583_4766465_+	TolB-like protein	NA	NA	NA	NA	NA
WP_011257339.1|4767087_4769622_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407395.1|4769855_4770608_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4770735_4771650_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257334.1|4772922_4773915_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_041182812.1|4774135_4774384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257333.1|4774579_4775038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012446330.1|4775137_4776928_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_027703506.1|4777136_4779374_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4779798_4780488_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011407389.1|4780877_4783892_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4784075_4784777_+	SapC family protein	NA	NA	NA	NA	NA
WP_012446335.1|4784766_4785780_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_027703504.1|4785790_4787356_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	5.6e-40
WP_011257324.1|4787495_4788518_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4788927_4790121_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4790117_4790864_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_012446338.1|4790895_4792497_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4792557_4792758_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703502.1|4792754_4793342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4793545_4793707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4793827_4794100_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011407379.1|4794165_4795167_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_075240209.1|4795251_4796079_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4796115_4797111_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_012446343.1|4797128_4797920_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257312.1|4797883_4798672_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446345.1|4798790_4799729_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_012446347.1|4800155_4801391_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082356988.1|4801443_4802631_-|transposase	IS5-like element ISXoo14 family transposase	transposase	NA	NA	NA	NA
WP_099051310.1|4805234_4806336_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_094187715.1|4807096_4807859_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051311.1|4807919_4808717_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4817569	4869444	5026592	tRNA,transposase,holin	Staphylococcus_prophage(33.33%)	37	NA	NA
WP_011257289.1|4817569_4818001_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011257288.1|4818003_4818633_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_012446358.1|4819270_4821439_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_041182817.1|4821565_4823728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115877388.1|4824554_4825520_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182818.1|4827624_4827984_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4827986_4829288_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4829468_4830245_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|4830373_4831137_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407353.1|4831537_4832122_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_041182965.1|4832314_4835764_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_041182819.1|4836511_4839154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703802.1|4839257_4841657_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4841659_4843042_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4843199_4843784_+	gluconokinase	NA	NA	NA	NA	NA
WP_027703799.1|4844662_4846417_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	9.6e-81
WP_011257273.1|4846724_4846952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|4846932_4847382_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4847392_4847821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187728.1|4849288_4850087_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115877389.1|4850257_4851583_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115877382.1|4852034_4853354_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182821.1|4853466_4854423_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	3.4e-40
WP_109182027.1|4855267_4856233_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703982.1|4856250_4856808_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4856826_4857114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4857498_4858293_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_012446378.1|4858292_4859042_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4859053_4859605_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4859601_4860264_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_011257254.1|4860253_4860544_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4860554_4861613_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_099051312.1|4863411_4864175_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182823.1|4864279_4865242_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4865438_4866395_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011407325.1|4866646_4867462_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_099051333.1|4868342_4869444_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	3.7e-38
>prophage 40
NZ_CP031462	Xanthomonas oryzae pv. oryzae strain PX079 chromosome, complete genome	5026592	4949991	4995671	5026592	protease,transposase	Fowlpox_virus(12.5%)	33	NA	NA
WP_115877401.1|4949991_4950957_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182969.1|4951132_4952548_-	amino acid permease	NA	NA	NA	NA	NA
WP_012446442.1|4953038_4955363_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|4955768_4956131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|4956508_4957054_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_115877390.1|4958715_4960035_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260845.1|4960307_4961435_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_082357016.1|4961398_4962133_-	2OG-Fe(II) oxygenase	NA	V5UTP7	Synechococcus_phage	47.6	2.6e-16
WP_011409820.1|4962353_4963694_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4963910_4964603_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4964719_4965040_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4965039_4966032_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4966338_4967862_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_012446448.1|4967966_4969202_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027703884.1|4969362_4970019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012446450.1|4970169_4971981_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4972128_4972479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840389.1|4972657_4973977_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027703798.1|4975389_4976571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446454.1|4976668_4980100_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4980247_4980946_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011260862.1|4980929_4982402_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_027703796.1|4982398_4982986_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011260863.1|4982985_4984182_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|4984255_4984858_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_103057218.1|4985565_4986093_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4986089_4986656_+	FUSC family protein	NA	NA	NA	NA	NA
WP_027703794.1|4986931_4988293_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_011407587.1|4989088_4990123_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_012446461.1|4990195_4991410_+	phospholipase	NA	NA	NA	NA	NA
WP_012446463.1|4991659_4991866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703792.1|4991852_4992965_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_041182834.1|4994714_4995671_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	2.1e-42
