The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	7623	78747	4948537	protease,transposase	Ralstonia_phage(30.0%)	55	NA	NA
WP_011407164.1|7623_8460_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8646_9453_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9729_10923_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11076_11748_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11832_12594_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12640_13063_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13066_13480_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13775_14543_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14553_14823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|14897_16358_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17004_18015_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18286_19489_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19630_21769_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|21979_22273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22304_22802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407171.1|23048_24029_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	9.1e-89
WP_011257025.1|24076_25243_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25389_25956_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27430_28639_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29266_30289_-	sugar kinase	NA	NA	NA	NA	NA
WP_011407175.1|31111_32080_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407176.1|32567_33704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215536.1|33700_34408_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_012443646.1|35009_36386_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39398_39641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39582_39906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40371_41352_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|41970_43260_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43699_44035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44309_44741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45089_46499_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041181902.1|46776_46992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47816_48077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48093_48426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48425_48884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49243_50458_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|50978_51776_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53491_54457_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54453_54732_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011407196.1|54875_56195_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|56312_57359_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|57499_57997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|58160_58793_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|58809_60972_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|61086_61272_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|61294_63898_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|63894_65784_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|65840_67598_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|67600_69835_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|69831_71415_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|71888_73517_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|73513_74878_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|75070_76012_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|76252_77977_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|77983_78747_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	109264	135480	4948537	transposase	Ralstonia_phage(50.0%)	23	NA	NA
WP_011258529.1|109264_110233_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407218.1|110445_111765_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|111953_112937_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011407220.1|113658_116031_+	HPr kinase	NA	NA	NA	NA	NA
WP_011257061.1|116906_118535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|119092_119476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|119472_119958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|119961_120324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|120440_121877_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|122118_122970_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|123429_123747_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|124052_124940_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|125646_126597_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|126710_126920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|126987_127248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|127300_127582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|127720_128779_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|128919_129867_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|130121_130433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|131899_132370_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|132539_133232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|133323_133722_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|134523_135480_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	170242	223683	4948537	tRNA,transposase	Acidithiobacillus_phage(33.33%)	25	NA	NA
WP_109182058.1|170242_171208_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|172643_173442_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464349.1|173680_175063_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
WP_011407263.1|176464_177493_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407264.1|177737_178265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|179087_181271_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|181282_184633_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011407268.1|184629_187746_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407278.1|194890_196210_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257184.1|196366_197887_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|197903_198182_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|198371_198710_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011407279.1|199322_201308_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011257188.1|202227_203040_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|203232_203844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|204260_205118_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_011257191.1|205355_207242_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_011407283.1|207807_209184_+|transposase	IS5-like element ISXoo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	7.8e-78
WP_094187715.1|209745_210508_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182356.1|213195_215349_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
WP_011257195.1|215345_217037_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_041181914.1|217033_217297_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
WP_011257196.1|217358_219560_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257197.1|219556_221245_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257198.1|221778_223683_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	277395	346566	4948537	tRNA,transposase,holin	Bacillus_phage(25.0%)	46	NA	NA
WP_011407314.1|277395_277710_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011257241.1|278457_278847_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|279054_279261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|279492_280461_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|280714_282877_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|283424_284729_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|284788_285391_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|285387_287292_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|296610_297426_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|297772_298735_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115892982.1|298839_299602_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|301401_302460_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|302470_302761_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|302750_303413_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|303409_303961_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|303972_304722_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|304721_305516_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|305900_306188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|306206_306764_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|306781_307747_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|308591_309548_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|309619_310382_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|310421_311220_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|311351_312566_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|312625_313456_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|313618_314854_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|316252_316681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|316691_317141_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|317121_317349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|317656_319411_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|320345_321108_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|321161_321746_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|321903_323286_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|323288_325688_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|325791_328434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|329181_332631_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|332823_333408_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|333884_334661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|334841_336143_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|336145_336505_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|336941_338423_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|338615_339581_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|340407_342570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|342696_344865_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407359.1|345502_346132_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011407360.1|346134_346566_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	355411	412276	4948537	tRNA,transposase	Pseudomonas_phage(16.67%)	43	NA	NA
WP_109182066.1|355411_356210_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|356269_357033_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|360986_361952_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|363012_364119_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|365912_366851_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_080493948.1|366969_367758_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446343.1|367721_368513_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|368530_369526_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|369562_370390_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011407379.1|370474_371476_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|371541_371814_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_042465424.1|372299_372887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|372883_373084_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|373144_374746_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|374777_375524_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|375520_376714_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|377123_378146_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|378285_379851_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|379861_380875_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|380864_381566_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|381749_384764_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_109181945.1|384937_385700_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257330.1|385969_386659_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257331.1|387083_389321_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_041181932.1|389529_391320_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_011257333.1|391419_391878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407393.1|392542_393535_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011407394.1|394807_395722_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407395.1|395849_396602_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_042464379.1|396835_399370_+	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407397.1|400026_400908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|400960_401812_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011407398.1|401813_402200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257344.1|402234_402384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257345.1|402661_404794_+	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011407399.1|405067_405334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840188.1|405416_406382_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_042464383.1|406394_406583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407401.1|406544_407015_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011257350.1|407705_409229_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_011257351.1|409287_409863_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012446316.1|410583_410808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257354.1|411271_412276_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	567196	616683	4948537	tRNA,transposase,integrase	Sinorhizobium_phage(14.29%)	42	575344:575360	613471:613487
WP_109181928.1|567196_568162_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407489.1|568629_569949_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|570478_570994_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|571396_573619_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257477.1|574084_575110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|575093_575696_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575344:575360	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|576026_576971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|577494_578871_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|578955_580857_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|581042_581258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|581364_582141_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|582302_582977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|582973_583747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|583970_584534_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|584544_587037_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|587219_588494_-	RDD family protein	NA	NA	NA	NA	NA
WP_011257490.1|589285_589759_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|589801_590944_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|591015_592152_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|592284_592797_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|593190_594114_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|594113_595427_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|595477_597199_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|597363_598641_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|598838_599663_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407501.1|599666_600722_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|600887_602354_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|602350_602854_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|602963_604097_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|604339_604861_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|605060_605975_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|606075_606516_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|606624_608499_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|608691_609012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|609640_610915_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_011257520.1|611048_611255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|611251_611524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|611520_611766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257523.1|611909_612038_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407512.1|613701_614937_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613471:613487	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|615005_615395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|615717_616683_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	764127	800446	4948537	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|764127_765447_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|765762_766947_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|767476_768790_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|768779_769598_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|769820_770762_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|770761_771508_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|771733_772789_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|772844_773732_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|773728_774286_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|774282_775191_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|775307_776711_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|776757_778104_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|778237_778969_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|778968_779598_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|779655_781743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|781739_783389_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|783504_784113_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|784663_785308_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|785304_786231_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|786233_787076_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|787161_788274_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|788443_789703_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|789764_790226_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|790368_792063_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|792174_792579_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|792710_793484_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|793494_793962_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|793958_794441_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|794999_796319_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|796476_797796_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|798008_798977_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|799126_800446_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	864933	908991	4948537	protease,transposase	Ralstonia_phage(25.0%)	38	NA	NA
WP_115892985.1|864933_865899_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|866289_866865_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|866977_867487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|867585_867780_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|867869_868847_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|869076_869517_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|869794_870739_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|870821_871565_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|871769_872009_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|872150_873386_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|873556_874912_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|874972_876046_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|876042_877002_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|876998_877352_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|877875_878349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|879369_879696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|879931_881530_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|881675_882572_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|882647_883802_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|883982_886574_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|886896_887034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|887306_888506_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407671.1|888955_889924_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011407672.1|890165_892382_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|892460_893459_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|893568_893751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464512.1|894730_897718_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|897892_898840_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|899343_899880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407677.1|899950_901270_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|901614_902577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011257778.1|902710_903271_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|903313_903796_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|903958_904435_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|904845_905745_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|905984_906371_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|907000_908128_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|908127_908991_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 9
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	914291	1077646	4948537	protease,transposase,integrase	Ralstonia_phage(22.22%)	115	1005825:1005843	1074757:1074775
WP_011257788.1|914291_915074_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407683.1|915184_916561_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_011257791.1|916804_917440_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|918066_918600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257793.1|918725_918923_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|918932_920045_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|920025_921360_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|921593_922514_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|922590_923907_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|924179_925559_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|925579_926236_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|926364_927018_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|927288_927750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|928809_929694_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|929814_931263_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|931330_931978_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|932794_933868_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|934198_935761_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|935757_936882_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|936957_937215_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|937198_938920_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|938963_939965_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|941241_943119_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|943544_945896_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|946006_946900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|946948_949915_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|950529_951678_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|951791_952328_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|952524_953007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|955282_956248_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|956244_956418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|956702_957194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|958873_960130_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|960289_960853_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|961219_962578_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|962577_963174_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|963320_964205_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|966186_966801_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|966883_967870_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|967985_968480_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|968724_970554_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|970572_971043_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|971965_973093_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|973193_974576_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|974823_976947_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|977475_977994_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|978700_979802_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|980317_981553_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|982166_983015_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|983146_983287_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|986846_988082_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|989064_990384_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182121.1|993113_994079_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|994380_995958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|996025_996789_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|999457_1000426_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1000686_1001148_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1001696_1001939_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1001932_1002696_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1002728_1003460_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1005279_1006032_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1005825:1005843	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1006033_1006999_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1007262_1008270_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1008413_1009175_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1012492_1013785_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1013877_1014504_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1014628_1015915_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1016058_1018530_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1018743_1019016_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1019847_1021818_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1022523_1023702_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1023698_1024466_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1024478_1025135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1025162_1025615_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1025623_1026358_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1026793_1027498_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011407730.1|1028323_1028953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1029845_1030046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757079.1|1030441_1033165_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
WP_069960070.1|1033232_1035383_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1035379_1037077_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|1037396_1039601_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_113186658.1|1039597_1041292_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1041288_1041552_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|1041613_1043821_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_011407737.1|1043817_1045497_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1045493_1045757_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1045818_1046376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1046458_1047424_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1047522_1048209_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1048319_1048724_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1048934_1049984_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1050004_1050754_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1050753_1051503_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1051502_1052534_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1052551_1052911_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1052935_1053433_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1053429_1053675_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1053671_1054118_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1054679_1056776_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1056782_1057103_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1057200_1057794_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1057895_1058246_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1058365_1058899_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1058895_1060848_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1060840_1061797_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1061802_1062756_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1062794_1064663_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1066178_1066694_+	peptide deformylase	NA	NA	NA	NA	NA
WP_041182379.1|1068441_1069188_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1069804_1071406_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1072394_1073630_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1074458_1075427_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1074757:1074775	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1075894_1076245_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1076326_1077646_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1116376	1158823	4948537	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|1116376_1117478_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1118908_1119532_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1119555_1119795_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1119844_1120726_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1120875_1121325_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1121475_1122123_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1122214_1122685_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1122681_1123272_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1123880_1124180_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1124176_1124398_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1124633_1125176_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1125186_1126527_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1127044_1127203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181925.1|1127234_1127998_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1128230_1129556_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1129754_1130102_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1130098_1132507_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1132685_1133843_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1133858_1134458_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1134454_1134850_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1134846_1135572_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1135681_1136542_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1136658_1137270_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1137450_1138248_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1138396_1138696_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1138824_1140996_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1141075_1141456_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1141476_1143630_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1143755_1144694_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1144765_1145008_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1145221_1146511_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1146888_1147539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1147848_1150278_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1150493_1151552_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1151551_1152310_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1152306_1152972_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1152968_1153502_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1153521_1155471_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1155541_1156340_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|1156482_1157718_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|1157788_1158823_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1198040	1229879	4948537	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
WP_109181945.1|1198040_1198803_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1198892_1199858_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1199967_1201287_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1201749_1202427_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1202506_1202896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1203109_1203997_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1204430_1205415_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1205588_1207676_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1207827_1208487_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1208567_1209365_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1209387_1209567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1209585_1209990_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1210023_1210383_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1210626_1211499_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1211571_1212798_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1213042_1213660_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|1215196_1216804_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1216800_1217226_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1217250_1217754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1219196_1219646_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|1222892_1224182_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407854.1|1224467_1227647_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|1228143_1229013_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1229034_1229706_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|1229702_1229879_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1396926	1464385	4948537	transposase	Ralstonia_phage(25.0%)	56	NA	NA
WP_011408397.1|1396926_1398111_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_075239694.1|1398202_1399555_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011407945.1|1399620_1400556_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_011407946.1|1400622_1401222_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011407947.1|1401256_1402117_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407948.1|1402134_1403175_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011258200.1|1403201_1404524_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011407949.1|1404523_1405678_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_125168743.1|1405955_1406222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181895.1|1406942_1407908_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258205.1|1409843_1410173_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_011258206.1|1410169_1410709_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258207.1|1410910_1412155_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_011258208.1|1412151_1413414_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011407952.1|1413413_1414178_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
WP_011407953.1|1414435_1415893_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407954.1|1415908_1416367_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1416538_1417006_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407955.1|1417110_1417329_+	peptidase	NA	NA	NA	NA	NA
WP_103057256.1|1417435_1417816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|1417933_1418530_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_011407957.1|1418585_1419128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407958.1|1419185_1419527_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_042464628.1|1419584_1420226_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258216.1|1420331_1420757_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_011258803.1|1421120_1422089_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011407961.1|1423951_1424812_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011407962.1|1424855_1425548_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011258220.1|1425911_1426949_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407963.1|1427062_1428193_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_027703695.1|1428464_1429139_+	YitT family protein	NA	NA	NA	NA	NA
WP_011407966.1|1429762_1430335_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_011258225.1|1431604_1432171_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_011407969.1|1432163_1432631_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_011258227.1|1432644_1433592_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_011258228.1|1434038_1434473_+	OsmC family protein	NA	NA	NA	NA	NA
WP_027703692.1|1434625_1435225_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011407971.1|1435510_1436392_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_011407973.1|1437489_1440099_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_011407974.1|1440082_1440541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258235.1|1440537_1441893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258236.1|1441873_1443280_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258237.1|1443596_1444391_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258238.1|1444575_1445574_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011258239.1|1445849_1446386_+	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_033013313.1|1446668_1448153_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.1e-13
WP_094187715.1|1450627_1451390_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181897.1|1451479_1452445_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|1452797_1453502_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1454039_1454264_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1454263_1456336_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1456567_1457425_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|1458460_1460863_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|1460917_1461778_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|1461846_1462425_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|1463416_1464385_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 13
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1469973	1530495	4948537	tRNA,transposase	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_094187715.1|1469973_1470737_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075245366.1|1471116_1471674_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1471723_1473832_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069964947.1|1473853_1475755_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_027704078.1|1475809_1476670_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|1476738_1477317_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1477780_1478014_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1478234_1478801_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1479003_1479591_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_162013049.1|1479943_1480378_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1480374_1482783_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1483127_1483589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1483835_1484726_-	pirin family protein	NA	NA	NA	NA	NA
WP_155523149.1|1484918_1485083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1485493_1486207_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1486310_1487060_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1487420_1487672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1488004_1490062_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1492009_1493131_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1493145_1493952_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1493956_1495240_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1495266_1495782_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1495792_1497949_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1498016_1500014_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1500032_1500362_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1500401_1500620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1500851_1504316_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1504718_1505261_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1505672_1506581_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1506926_1507725_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1507868_1508588_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1508743_1509778_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1509798_1510611_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1511346_1511730_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1511852_1513022_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1513016_1514075_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1514135_1514948_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1515463_1515847_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1515969_1517133_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1517163_1517976_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1518206_1518794_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1519092_1520049_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1520122_1520854_+	nitrilase	NA	NA	NA	NA	NA
WP_011258289.1|1522043_1523447_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1523460_1523967_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1524372_1524831_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1525608_1525812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408029.1|1527373_1527859_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1528086_1528302_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1528552_1529032_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1529163_1529592_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1529664_1530495_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1536844	1604348	4948537	transposase	Ralstonia_phage(17.65%)	46	NA	NA
WP_011258305.1|1536844_1538785_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1539001_1539556_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1539777_1541208_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|1541310_1542729_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|1543145_1543871_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1543969_1544380_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1544431_1545388_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1545631_1548013_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1550710_1551121_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1551420_1551603_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1551735_1552776_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1552848_1554294_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258802.1|1555824_1556793_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408046.1|1557143_1557689_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1557685_1559149_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1560609_1560864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1561266_1561800_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1561825_1562227_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1562195_1562576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1562572_1562815_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258329.1|1564183_1566088_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|1566351_1568748_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011408053.1|1568897_1569620_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1572539_1573040_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1572981_1574658_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1574804_1576070_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1576128_1577322_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1577318_1578008_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408058.1|1578113_1579583_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1579602_1580439_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1580464_1581568_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408060.1|1581564_1584621_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1584686_1585277_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1585408_1587241_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1587316_1588080_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1588122_1589442_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1590739_1595230_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|1595226_1595718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|1595769_1596738_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_125168747.1|1596886_1597186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168748.1|1597182_1597512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408064.1|1599027_1599396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1599565_1600534_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182041.1|1601225_1602182_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
WP_158645227.1|1602165_1602468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801881.1|1603028_1604348_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1641693	1778114	4948537	transposase,capsid,tRNA,head,portal,tail,terminase,integrase,plate,holin	Stenotrophomonas_phage(42.86%)	116	1697380:1697400	1754554:1754574
WP_109181906.1|1641693_1642491_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182403.1|1642636_1643092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408088.1|1643346_1644090_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011408089.1|1644201_1644705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408090.1|1644932_1645838_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_011408091.1|1645908_1646679_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011258392.1|1646702_1647167_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075240114.1|1647280_1647688_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012444462.1|1647684_1650651_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
WP_011258394.1|1650943_1651264_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011258395.1|1651276_1651537_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011258396.1|1651769_1652822_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003484323.1|1652913_1653183_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011408094.1|1653299_1654904_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_011408095.1|1655102_1656119_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_011258399.1|1656125_1658957_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|1659271_1659772_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|1659859_1660810_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1661323_1662259_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1662258_1664259_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011408098.1|1664261_1664888_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1664887_1665223_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_162013044.1|1665389_1667270_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012444470.1|1667494_1669741_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_041182048.1|1669764_1671384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408101.1|1671527_1676111_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
WP_162828837.1|1676115_1676700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181910.1|1678435_1679537_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.2e-41
WP_011258414.1|1681469_1684091_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.4e-30
WP_011258418.1|1686994_1688386_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011258422.1|1689776_1691333_+	membrane protein	NA	NA	NA	NA	NA
WP_011408111.1|1693916_1695155_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1695595_1695889_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|1696386_1697163_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|1697320_1699087_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
1697380:1697400	attL	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011258428.1|1699598_1700126_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703718.1|1700225_1700903_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011258430.1|1700992_1701721_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|1701835_1702360_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|1702517_1703102_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|1703301_1705209_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|1705337_1706375_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|1706427_1706886_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258435.1|1706897_1707677_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|1707833_1708283_+	protein TolR	NA	NA	NA	NA	NA
WP_011258437.1|1708272_1709313_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011408115.1|1709572_1710892_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|1710949_1711468_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011258440.1|1711474_1712293_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|1712335_1713019_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_011408120.1|1714252_1714963_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_011408121.1|1715197_1715404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057327.1|1717197_1717776_-	amino acid transporter	NA	NA	NA	NA	NA
WP_011408191.1|1720315_1721551_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1721601_1722365_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1722431_1723808_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1724186_1724861_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011258445.1|1725105_1726290_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.2	2.0e-122
WP_041182055.1|1726289_1726511_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	1.9e-18
WP_011408130.1|1726507_1726714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408131.1|1726710_1726983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182407.1|1726979_1727225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161795300.1|1727221_1727467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010364106.1|1727658_1728069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|1728294_1728573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|1728569_1728788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408134.1|1729096_1731793_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011258450.1|1731802_1732015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|1732011_1732290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408136.1|1732300_1732621_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
WP_053503015.1|1732623_1732881_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|1732952_1733390_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|1734050_1735037_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|1735033_1735435_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_011258455.1|1735447_1738318_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.2	6.4e-207
WP_011258456.1|1738350_1738464_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|1738472_1738775_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|1738820_1739330_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|1739360_1740527_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_011258460.1|1740538_1740898_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	1.2e-35
WP_011408138.1|1740894_1741458_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.3	8.2e-26
WP_011408139.1|1741518_1742097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408140.1|1742104_1743610_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.2	6.6e-54
WP_011408141.1|1743619_1744165_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	2.1e-50
WP_011408142.1|1744157_1745048_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	6.8e-83
WP_011408143.1|1745178_1746348_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_011258467.1|1746839_1747286_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	1.8e-36
WP_011408144.1|1747273_1747693_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	1.4e-38
WP_011408145.1|1747689_1748178_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.7	1.2e-25
WP_011408146.1|1748177_1748816_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_011408147.1|1748815_1749091_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	58.6	1.1e-20
WP_011408148.1|1749083_1749440_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	55.3	1.7e-21
WP_011258473.1|1749444_1749654_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
WP_011408149.1|1749653_1750121_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	2.0e-30
WP_011408150.1|1750220_1750940_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	3.4e-69
WP_011408151.1|1750943_1751960_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	4.2e-137
WP_011408152.1|1752006_1752849_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	2.0e-68
WP_011408153.1|1752970_1754755_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.6	4.7e-269
1754554:1754574	attR	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011408154.1|1754754_1755777_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	2.6e-139
WP_075251737.1|1755802_1756048_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	50.0	7.7e-13
WP_011408155.1|1755965_1756667_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.2	3.2e-104
WP_011408156.1|1756733_1757480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408157.1|1757476_1758184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408158.1|1758197_1758539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052285781.1|1758519_1759077_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
WP_011408160.1|1759025_1759427_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011408161.1|1760565_1761852_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.2	1.4e-81
WP_011408162.1|1762079_1762415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408164.1|1763121_1763526_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1763604_1764102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258487.1|1764240_1766037_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408166.1|1766593_1767139_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258489.1|1767240_1771362_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	1.9e-47
WP_011408167.1|1771582_1774225_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1775666_1777181_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|1777351_1778114_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	1931966	1991364	4948537	protease,transposase	Tupanvirus(18.18%)	52	NA	NA
WP_011408249.1|1931966_1933553_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_041182078.1|1933733_1935524_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|1935630_1936431_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1936461_1936839_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1936828_1937509_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1937505_1938405_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1938628_1939351_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1939499_1940222_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1940380_1941715_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1941889_1942387_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1942482_1943718_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1943946_1945323_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1945442_1946126_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1946142_1947177_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1947357_1948935_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1949052_1950057_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1950056_1950611_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1950696_1951449_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1951535_1951742_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_042464734.1|1953252_1953897_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1953886_1956388_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1956384_1957989_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1957985_1958219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1958215_1959238_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1959574_1959940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1959936_1960527_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1960624_1962334_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1962442_1962769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1962998_1963343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1963465_1964641_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1964796_1967625_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1967685_1968786_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1969254_1969782_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1970183_1970357_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1970517_1970772_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1970946_1971213_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1971403_1971970_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1973457_1974777_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1975169_1975355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1975544_1976921_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1977060_1977534_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1979205_1980255_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1980369_1980705_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1980993_1981284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1982174_1983293_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|1983513_1984725_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|1986647_1987103_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1987376_1987979_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1988014_1988623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1988682_1988877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1988946_1990317_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1990601_1991364_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2007406	2066504	4948537	coat,tRNA,protease,transposase	Acidithiobacillus_phage(25.0%)	44	NA	NA
WP_011258663.1|2007406_2009491_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|2009715_2010165_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|2010928_2011987_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|2012257_2013655_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|2013651_2014629_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|2014810_2016748_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|2017168_2017945_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|2017949_2018624_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|2020254_2021631_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|2021670_2022066_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|2022108_2023584_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|2024382_2024799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2024812_2024983_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|2028671_2029235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445197.1|2029707_2031051_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|2031191_2031794_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|2031867_2032314_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|2032391_2032658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258681.1|2034759_2036172_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|2036168_2036906_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|2036905_2039086_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2039925_2040885_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2041060_2044651_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2045108_2045849_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2045845_2047102_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2047140_2047932_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2047955_2048417_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2048413_2049427_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|2049826_2052193_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2052276_2053623_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2053649_2054840_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2054842_2055670_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2055666_2056428_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2056445_2057003_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2057183_2057906_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2057962_2058340_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2058467_2059346_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2059515_2060319_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2060694_2061420_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2061422_2061755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2061801_2062836_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2062832_2065184_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2065200_2065971_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2065979_2066504_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 18
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2117665	2244445	4948537	tRNA,transposase	Ralstonia_phage(17.39%)	92	NA	NA
WP_011408357.1|2117665_2118985_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2119319_2120246_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2120375_2120981_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2121319_2123089_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_027703751.1|2123085_2123688_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2123946_2124540_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2124738_2126175_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2126416_2127619_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2127661_2130490_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2130670_2131603_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2131599_2133099_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2133436_2133700_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2133979_2134480_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2134721_2136089_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|2139112_2139875_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2141327_2142731_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2142853_2143276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2143908_2144745_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_075242602.1|2144754_2145741_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|2145737_2146613_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2146609_2146972_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2146974_2147223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2147358_2147916_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2148007_2148973_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2148998_2150348_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2150340_2150577_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2150577_2151330_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2151663_2152509_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2152649_2153825_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2153838_2155149_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|2155145_2156132_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2156128_2157334_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2157720_2160474_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2160616_2161756_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2161752_2162748_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|2162836_2164018_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2164017_2164158_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2164529_2165975_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2166541_2169070_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2169280_2170079_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2171149_2171917_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2171918_2172266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2172424_2173393_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181928.1|2174745_2175711_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2176155_2177340_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2177394_2178870_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2179191_2179374_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2179522_2180722_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258803.1|2181582_2182551_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181930.1|2182830_2183629_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|2183854_2184820_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|2187049_2188015_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2189046_2190015_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181933.1|2191191_2192294_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2192480_2192948_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|2193308_2193968_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2194079_2195429_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2195578_2196377_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|2196816_2198136_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2198348_2199317_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2199380_2199965_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2200064_2201078_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296745.1|2201768_2202041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336051.1|2202447_2206047_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2206186_2206486_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2206489_2206684_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_115840167.1|2206952_2210759_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408411.1|2213942_2218070_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408412.1|2218358_2219678_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2221509_2222595_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2222922_2223621_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2223623_2224190_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2224201_2224879_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2224967_2226398_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|2226474_2227947_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2228092_2228680_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2228821_2230063_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011408423.1|2230271_2231690_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2231724_2232024_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011408425.1|2232020_2233892_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|2234181_2235195_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|2235194_2235626_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2235622_2236225_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2236217_2238155_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2238323_2238794_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2238790_2238961_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2238957_2239710_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2239804_2240500_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2240496_2241141_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2241367_2242516_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2242655_2243459_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2243479_2244445_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2342406	2474752	4948537	tRNA,protease,transposase	Xanthomonas_phage(57.89%)	113	NA	NA
WP_113084327.1|2342406_2343819_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.4	1.0e-40
WP_094187798.1|2344324_2345123_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2345436_2345763_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2345772_2346687_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2346683_2347979_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2347975_2349067_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2349063_2350191_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2350187_2350790_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2350786_2351521_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2351514_2352291_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2352280_2352901_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_011408490.1|2353486_2357341_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2357565_2357865_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2357868_2358063_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_145973245.1|2358330_2361714_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2362171_2362951_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2362992_2363091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2363844_2364030_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2364029_2364233_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2364368_2365442_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2365546_2365846_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2366209_2366449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2366555_2368040_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2368041_2368362_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2368358_2369543_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|2369597_2369768_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2370876_2371137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408500.1|2371336_2371720_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
WP_011408501.1|2371891_2372539_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|2372540_2373728_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|2373727_2374057_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|2374056_2375463_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|2375599_2375830_-	hypothetical protein	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|2375841_2376045_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|2376048_2376345_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_011408507.1|2376341_2377382_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
WP_134953795.1|2377368_2377554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408508.1|2377534_2377747_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_155296581.1|2377740_2377965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970101.1|2378059_2378689_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2378813_2378996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2379117_2379429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2379498_2380261_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|2380765_2381089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2381702_2382215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2382347_2383110_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325281.1|2384331_2388129_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2388397_2388592_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2388595_2388895_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964534.1|2389118_2392874_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2392963_2393726_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182100.1|2393957_2394152_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2394155_2394455_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069959856.1|2394679_2398696_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|2398914_2399091_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2399087_2399759_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2400784_2401030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2401013_2401970_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|2402384_2403353_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182129.1|2403497_2404463_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408522.1|2408848_2410033_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2410083_2410983_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2411149_2411656_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2412130_2412763_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2412762_2414619_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258970.1|2414615_2416034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2416057_2416522_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_069960087.1|2416518_2417319_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2417588_2418629_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2418625_2420395_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2420391_2420856_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2420859_2421522_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2421550_2423959_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2424212_2425178_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2426571_2427306_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2427298_2428540_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2428563_2429016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2428966_2429215_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2429325_2430108_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2430124_2430334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2430337_2432128_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2432162_2432549_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2432545_2432941_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2433000_2433267_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2433210_2434083_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2434211_2435309_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2435742_2437173_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2437169_2438177_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2438173_2438893_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2438995_2440912_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2440967_2441627_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2443253_2443457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2444472_2444853_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2445067_2448463_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2450028_2450791_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408544.1|2452686_2452920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2453086_2454061_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_042465545.1|2454824_2455034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408549.1|2457406_2458540_+	phospholipase A	NA	NA	NA	NA	NA
WP_011408550.1|2458968_2459421_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011259006.1|2459739_2461257_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_011259007.1|2461590_2463471_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011408551.1|2463659_2464439_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2464589_2465075_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_027703343.1|2467531_2467771_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259011.1|2468022_2468736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2470260_2470761_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757420.1|2470922_2471501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259015.1|2471592_2472093_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259016.1|2472159_2472993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2473043_2473358_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|2473541_2473730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408557.1|2474143_2474752_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 20
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2564865	2612961	4948537	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2564865_2566260_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2566261_2566519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2566515_2566821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2566817_2567144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2567870_2568533_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2568621_2569152_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2571375_2572647_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2572818_2574186_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2574489_2575935_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2575931_2576618_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2576590_2577610_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2577651_2578212_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2578232_2579189_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2579356_2580133_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2580616_2582752_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2582748_2582940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2584714_2585221_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2585261_2585789_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2585785_2586277_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2586300_2586876_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2586952_2587906_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2587994_2588867_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|2588863_2589709_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2589821_2590520_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2590683_2591466_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2591474_2591855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2591851_2592562_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2593872_2594421_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011257031.1|2594592_2595561_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408623.1|2596165_2597401_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2597964_2598285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2598624_2599875_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|2600063_2601083_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|2601270_2602362_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_011408627.1|2602474_2603449_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2603448_2604318_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2604340_2605171_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2605299_2606010_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2606142_2606550_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2606833_2607469_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2607539_2608859_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2609095_2610157_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408522.1|2610207_2611392_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2611641_2612961_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2619680	2691952	4948537	tRNA,protease,transposase	uncultured_Mediterranean_phage(33.33%)	52	NA	NA
WP_011259125.1|2619680_2620826_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2620895_2621966_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2622159_2622591_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2622714_2624211_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2624555_2625263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408645.1|2628588_2629710_-	phytase	NA	NA	NA	NA	NA
WP_011259142.1|2632588_2633221_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2633617_2634380_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2634660_2635692_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2635698_2637492_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_011408649.1|2637488_2637773_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2638004_2638502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2638548_2639055_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2639051_2639672_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2639912_2641817_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2641904_2642962_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2643059_2644379_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2644612_2645770_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2646046_2647012_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2646989_2648465_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|2648500_2648707_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2650281_2651250_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|2652164_2653133_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075245207.1|2653400_2653634_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2655514_2656735_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2657049_2658447_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2658457_2659675_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2659674_2660313_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2660383_2661244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2661240_2662029_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2662039_2663245_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2663263_2663689_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2663908_2664541_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2664565_2666938_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2667095_2668301_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2668621_2669953_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2669949_2670300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2670331_2670739_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2670735_2671062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2671093_2672470_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_042465563.1|2672706_2676873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|2676985_2677657_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2677721_2679650_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2679812_2682173_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2682456_2683425_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2683482_2684604_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2686031_2686784_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2686864_2687083_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011408664.1|2687363_2689646_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_005914463.1|2689789_2690110_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2690360_2690819_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011408666.1|2690815_2691952_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2773683	2803485	4948537	transposase	Ralstonia_phage(75.0%)	12	NA	NA
WP_115801909.1|2773683_2775003_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2775152_2776121_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_128896930.1|2776215_2776752_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_042464958.1|2776784_2782025_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
WP_011258802.1|2784245_2785214_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407175.1|2786632_2787601_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_125168757.1|2789225_2789705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2797829_2798222_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2798230_2798692_+	cytochrome c	NA	NA	NA	NA	NA
WP_041182155.1|2799196_2799457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2801214_2802180_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|2802186_2803485_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2807671	2844252	4948537	tRNA,transposase	Streptococcus_phage(28.57%)	32	NA	NA
WP_042465572.1|2807671_2808628_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	4.0e-41
WP_011259267.1|2809430_2809694_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|2809835_2810801_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259269.1|2811138_2811249_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011408713.1|2811469_2812735_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|2812715_2814629_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2814996_2816241_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2816405_2817560_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2817573_2817834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|2817833_2818199_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2818198_2819494_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|2819617_2820568_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408720.1|2821180_2822524_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011408721.1|2822563_2823664_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2823669_2824122_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2824363_2825605_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2825676_2826702_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2827014_2827509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|2827685_2829110_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2829607_2830045_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2830041_2831292_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2831359_2832421_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2832563_2833604_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|2833688_2833976_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2833972_2835322_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|2835321_2836161_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|2837059_2837822_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2837848_2838112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407587.1|2838833_2839868_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408734.1|2840311_2841631_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2841767_2842736_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|2842935_2844252_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2876083	2951155	4948537	tRNA,protease,transposase	Bacillus_virus(20.0%)	58	NA	NA
WP_011259328.1|2876083_2876962_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2877059_2877959_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2878046_2878787_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2878946_2879522_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2879695_2880667_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2880700_2881642_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2881641_2883519_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2883656_2885390_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2885442_2885943_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2885939_2887427_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011408752.1|2887451_2888519_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011408753.1|2888664_2890002_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011259340.1|2890297_2891560_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2891776_2892524_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2892840_2894676_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_011408756.1|2894947_2896039_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2897131_2897533_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2898396_2898576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2899177_2899468_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2899455_2899734_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2900218_2900407_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|2901179_2902364_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|2902944_2903910_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2908474_2908819_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2909029_2909356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2909388_2909829_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2909907_2910543_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259354.1|2910935_2911694_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2911686_2912946_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2912945_2913590_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2914119_2915106_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2917033_2918488_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2918911_2919898_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2920309_2920972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2921026_2921512_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2921511_2922030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2922124_2923003_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2922999_2924280_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2924295_2925297_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2925448_2926813_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2927067_2927478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2927633_2928464_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2928777_2930025_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2930170_2931664_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2931668_2933255_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2933251_2934454_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115892987.1|2934897_2936349_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2936582_2937968_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2938875_2940255_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2940254_2941571_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|2941653_2942952_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|2943259_2944540_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011408785.1|2944845_2945124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2945113_2947462_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2947458_2948304_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011408786.1|2948310_2950035_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_075242096.1|2950177_2950360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182012.1|2950392_2951155_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	2963807	3046559	4948537	transposase	Ralstonia_phage(41.67%)	55	NA	NA
WP_011408791.1|2963807_2964791_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011408792.1|2965239_2970264_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2970541_2971201_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2971215_2972520_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2972532_2975703_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_115892988.1|2976678_2977635_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182172.1|2979495_2982012_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2982008_2982965_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_011259402.1|2983123_2984866_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|2985043_2986321_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|2986879_2987848_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258188.1|2988147_2989116_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408802.1|2989410_2991756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|2991773_2992505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408803.1|2992536_2994879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2994903_2995632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|2995660_2998003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2998027_2998771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115892989.1|2998801_3001144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182173.1|3001168_3001906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115892990.1|3001931_3004766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259405.1|3004762_3005692_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011408809.1|3005700_3008463_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	6.6e-44
WP_011408811.1|3010028_3012620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|3012788_3013757_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011408812.1|3013819_3014209_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|3014369_3015323_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3015255_3015570_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|3015797_3017117_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|3018221_3018638_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|3018634_3019081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|3019323_3019959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082336054.1|3020057_3020681_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_011258529.1|3020845_3021814_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_125168758.1|3022470_3022971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|3023279_3026381_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|3027370_3027823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408823.1|3028077_3029883_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|3029884_3030232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408824.1|3030307_3031015_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.1e-51
WP_011408825.1|3031166_3031559_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|3031605_3032097_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|3032093_3032447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|3032535_3033276_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|3033282_3034257_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|3034258_3035041_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|3035037_3036060_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3036160_3036469_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3036465_3036831_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|3036864_3038874_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|3039041_3039296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075242680.1|3040974_3041664_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
WP_011408833.1|3041979_3042741_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|3042754_3045097_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_115840174.1|3045593_3046559_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3145471	3157246	4948537	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|3145471_3145771_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3145813_3146044_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3146287_3147037_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3147041_3147737_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3147922_3148222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3148609_3149014_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3149739_3149952_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3150091_3152740_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3152841_3153330_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3153632_3154667_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3154839_3155481_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3155569_3157246_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 27
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3239952	3356053	4948537	transposase,plate	Ralstonia_phage(54.55%)	79	NA	NA
WP_012444515.1|3239952_3241428_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_011408934.1|3241510_3244099_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3244155_3245268_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3245392_3245971_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3247457_3249545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465048.1|3251443_3254524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3257559_3258267_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|3258263_3259256_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3259252_3261712_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3261825_3262806_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3262814_3263843_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3264009_3264807_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3264869_3265667_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408943.1|3265727_3266054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408944.1|3266050_3268954_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3268950_3269673_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3269669_3270317_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011408947.1|3270313_3273772_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3273775_3275092_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3275093_3276431_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|3276427_3277819_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3277815_3278355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3278363_3280301_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3280565_3281024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3281409_3281904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3281969_3282467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3282655_3285361_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3285393_3286404_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3286367_3288245_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3288248_3288752_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3288739_3289573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3289608_3290112_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3290211_3291726_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3291718_3292225_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3293583_3294552_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_115892993.1|3294687_3296004_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115892994.1|3296174_3297410_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3297595_3298564_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3298615_3300532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3300556_3301294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3301324_3303667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3303684_3304431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3304459_3307294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3307951_3309781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408965.1|3309794_3310394_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_011408966.1|3310482_3310839_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011259617.1|3310835_3311258_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3311273_3311507_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011408968.1|3311533_3311794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182194.1|3312142_3313933_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011259619.1|3313965_3314952_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3315362_3319076_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3319601_3320365_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3320468_3321116_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3321337_3322099_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3322256_3323225_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3323358_3323724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3323782_3324214_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3324225_3325488_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3325471_3326764_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3327133_3327904_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3328660_3329896_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3331195_3331453_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3331892_3332876_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011257031.1|3333191_3334160_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408981.1|3334288_3335251_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3335500_3335659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3335690_3335870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3336234_3337200_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3338407_3339385_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3340193_3340388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3341781_3342144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3342127_3342697_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3342734_3343988_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3344193_3344571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3346499_3347735_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3348572_3349607_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408994.1|3350282_3352658_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_011408998.1|3354868_3356053_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.7e-41
>prophage 28
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3490717	3550995	4948537	tRNA,protease,transposase	Burkholderia_virus(14.29%)	50	NA	NA
WP_094187736.1|3490717_3491481_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3492504_3494871_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3494867_3495542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3495751_3496690_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3496812_3498162_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3498158_3499046_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3499363_3500170_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3500615_3501833_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3501938_3502907_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3503256_3503925_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3503921_3504695_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3505268_3507221_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3507901_3508927_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3509011_3510085_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3510077_3511181_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3511191_3512118_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3512198_3512849_+	SCO family protein	NA	NA	NA	NA	NA
WP_011409071.1|3512845_3513694_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3514244_3515828_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|3517250_3518468_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3518428_3518716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3518826_3519333_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3519454_3520855_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|3521117_3521693_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3521689_3522124_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|3522928_3523114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3523148_3523718_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3523810_3524662_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3526049_3528065_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3528335_3529034_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3529074_3529482_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3529919_3530882_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3532165_3533416_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3533423_3534668_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3534895_3535375_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3535485_3536022_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3536131_3536881_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3537088_3537580_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_128896934.1|3537592_3537820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409088.1|3538693_3540013_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3540156_3541863_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3541896_3543201_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3543232_3543493_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3543494_3544370_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3546204_3546669_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3546720_3546909_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3546881_3547202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3547198_3548566_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3548711_3549293_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3549549_3550995_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 29
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3570095	3620086	4948537	tRNA,transposase,integrase	Ralstonia_phage(33.33%)	38	3594203:3594262	3610873:3611536
WP_011409106.1|3570095_3572738_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3572810_3573422_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3573626_3574484_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3574739_3575189_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_011257570.1|3575545_3576781_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|3576808_3577774_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3577898_3578661_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3579271_3579565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3580038_3580272_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3580305_3581319_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3581286_3581478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3581568_3582888_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3582975_3584190_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3584335_3584863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840178.1|3584859_3585825_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3586065_3586828_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3587130_3589263_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3589813_3590782_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011258188.1|3590942_3591911_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115840192.1|3592055_3593021_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_052285784.1|3593067_3593400_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3593396_3594160_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3594203:3594262	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|3595031_3595829_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3595862_3596255_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3596345_3596738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3599076_3599496_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3601212_3602997_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3603187_3603388_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3603923_3604718_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3605019_3605778_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3605853_3607716_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3607773_3608115_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3608374_3608650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3611696_3612410_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3610873:3611536	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|3612470_3612893_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3613024_3613788_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3616861_3617773_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_115801902.1|3619120_3620086_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	3667536	3709475	4948537	transposase	Ralstonia_phage(44.44%)	30	NA	NA
WP_011407175.1|3667536_3668505_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3669525_3670560_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3670943_3671669_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3671800_3672262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3675708_3677829_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3678095_3678941_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3679932_3680901_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3681225_3683196_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3683624_3685022_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3685134_3685953_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|3686263_3689515_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_011259908.1|3689696_3691115_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3691124_3691775_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3691776_3692382_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3692531_3692753_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3692762_3693188_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3693679_3694477_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3695554_3696334_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3696548_3697178_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3697238_3697994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3698322_3699099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3699507_3701082_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3701330_3701597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|3701875_3705055_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011409174.1|3705054_3705729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|3705728_3706475_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_128896939.1|3706471_3707062_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258188.1|3707172_3708141_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_113063277.1|3708192_3708504_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258803.1|3708506_3709475_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 31
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4140004	4236288	4948537	transposase	Ralstonia_phage(22.22%)	66	NA	NA
WP_115840193.1|4140004_4141612_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4141773_4142037_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4142041_4142701_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4142887_4144252_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4144467_4145163_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4146109_4146733_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4146877_4147675_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4147768_4148419_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4148510_4149326_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4149375_4150113_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4152041_4153031_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4153153_4155727_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4155919_4156682_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4156755_4157724_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407175.1|4158344_4159313_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011409421.1|4159617_4159884_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4160815_4161614_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4163260_4164493_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4164532_4165495_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4165670_4166627_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4166838_4167807_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4168142_4168905_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4172315_4173281_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4173742_4173973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4174597_4176640_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4176641_4178540_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4178541_4179795_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4179791_4180397_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4180816_4181971_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4181973_4183002_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4182998_4184075_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4184115_4185393_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4185437_4186205_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4186419_4187586_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4190129_4193027_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409436.1|4193177_4195868_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4196149_4197106_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_011409439.1|4197596_4198832_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260311.1|4200267_4201452_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4201519_4202257_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4202425_4202941_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4203032_4204535_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4204538_4204979_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4204975_4206787_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|4207072_4207444_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4207594_4208647_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4208986_4209928_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4209948_4211286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4211457_4211838_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4211962_4212724_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4214972_4216376_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4216498_4217554_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4217726_4218581_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4218872_4221056_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_011260329.1|4221554_4222649_-	type II restriction enzyme	NA	NA	NA	NA	NA
WP_041182275.1|4222645_4224457_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260331.1|4224701_4225715_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4225729_4226428_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4226415_4226694_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4227759_4228965_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4229465_4230881_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4230877_4232017_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4233242_4233785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4233756_4235031_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4235030_4235249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|4235325_4236288_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4262257	4344326	4948537	protease,transposase	Erwinia_phage(18.18%)	56	NA	NA
WP_011260359.1|4262257_4263625_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4263735_4264287_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|4264802_4265720_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011409476.1|4265919_4266591_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4266587_4267442_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4267431_4267668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4267725_4268124_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4268496_4270632_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4270755_4271940_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011409480.1|4272265_4272697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4272779_4274873_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4274940_4275252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4275639_4276209_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4276317_4277283_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4277841_4278642_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4279192_4280107_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4280137_4280875_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4280905_4281958_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4281962_4282631_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4282782_4284720_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4285446_4286209_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|4286523_4288173_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4289563_4291051_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_011409490.1|4291258_4292719_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|4293953_4296578_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4296833_4299704_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011409493.1|4300251_4301181_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4301219_4302224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|4302466_4303230_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4304277_4305063_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4305316_4306990_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4307533_4307980_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4308310_4308595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4309189_4310101_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|4310346_4311342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4311435_4312812_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_041182283.1|4314032_4315679_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011409499.1|4316087_4317860_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409500.1|4318135_4319011_-	DMT family transporter	NA	NA	NA	NA	NA
WP_042465760.1|4319208_4320087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493954.1|4320286_4320682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4322126_4323218_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011409507.1|4325126_4327451_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409508.1|4327646_4329593_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4329967_4330159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4330549_4332133_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4332480_4333077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|4334425_4335274_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4335308_4336784_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4337374_4338304_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4338538_4339030_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4339026_4339698_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4340092_4340422_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4340630_4341557_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_115892996.1|4342345_4343144_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4343291_4344326_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 33
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4365231	4408019	4948537	tRNA,transposase	Ralstonia_phage(50.0%)	38	NA	NA
WP_109182021.1|4365231_4366197_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4366729_4367110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493654.1|4367312_4368215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4368286_4369582_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|4369711_4370236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4370661_4371927_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4371923_4372901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4373004_4373808_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4373983_4374793_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4374800_4375599_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4375641_4376259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4376383_4376959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4377170_4378490_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4378639_4379608_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409546.1|4379733_4380486_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4380523_4380964_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4381170_4381512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4381737_4382115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4382325_4382523_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011409548.1|4382829_4383576_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4383668_4384475_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4384698_4386111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4386107_4387205_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4387359_4388158_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4388211_4389010_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4389229_4390192_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4390639_4391403_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4391684_4392461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4392457_4393774_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4394290_4395526_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4395692_4396655_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4397199_4397481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4398041_4398476_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4398650_4399829_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4400824_4401787_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4404120_4406292_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4406519_4406876_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4406954_4408019_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 34
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4430969	4489482	4948537	tRNA,transposase	Acinetobacter_phage(30.0%)	45	NA	NA
WP_094187805.1|4430969_4431948_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_115893000.1|4432027_4432993_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_003483093.1|4433005_4433476_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4433818_4434034_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4434114_4434732_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4435280_4435673_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4435676_4436105_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4436290_4436944_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4437223_4437538_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4437697_4438492_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4438629_4439322_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4439642_4440359_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4440351_4441149_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4441285_4442323_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4442440_4443070_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4443221_4443803_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4445230_4446332_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4446936_4449168_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|4449357_4451070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260506.1|4451218_4452595_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187753.1|4454801_4455600_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4456584_4457553_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069960033.1|4457719_4458691_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4458883_4460068_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4460535_4461351_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4462109_4463426_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4463685_4464930_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4465022_4468271_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4468404_4471545_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4471834_4473202_-	VOC family protein	NA	NA	NA	NA	NA
WP_041182775.1|4473946_4474912_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|4475330_4476296_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4476758_4477229_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4477257_4477680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4477755_4478190_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4478299_4478815_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4478830_4479856_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4480178_4480775_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4481132_4482860_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4482909_4484352_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4484336_4485683_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4485873_4486623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4486724_4487336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4487440_4488664_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4489005_4489482_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 35
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4502349	4560274	4948537	transposase,integrase	Leptospira_phage(25.0%)	37	4502233:4502252	4516292:4516311
4502233:4502252	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260549.1|4502349_4503726_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4503736_4504270_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4504698_4505958_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4506096_4507404_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4509488_4510523_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4510873_4511419_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4511444_4511711_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4511885_4513724_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4513954_4514830_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011409614.1|4516947_4518090_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
4516292:4516311	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_011260560.1|4519216_4520116_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4521062_4523864_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4523940_4524231_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_113101711.1|4524588_4525691_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_075240612.1|4525796_4526387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128896947.1|4526527_4527433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409622.1|4527622_4530310_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|4533631_4537561_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|4539249_4539762_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_075244060.1|4539758_4539986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013372.1|4540270_4540618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409630.1|4540835_4542842_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4542838_4543270_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4543266_4543686_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011409632.1|4544171_4544918_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011409633.1|4545128_4545719_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409634.1|4545852_4546800_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011409635.1|4546842_4547712_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011409636.1|4547708_4548209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4551307_4551868_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|4551963_4554789_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4554950_4555469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4555468_4556389_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4556817_4557441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443879.1|4557450_4557642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465296.1|4557738_4558359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182033.1|4559308_4560274_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4637800	4781205	4948537	tRNA,transposase,tail	Arthrobacter_phage(18.75%)	90	NA	NA
WP_109182036.1|4637800_4638766_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4638866_4639292_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4639334_4640097_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4640159_4641191_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4642551_4643808_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4643804_4644695_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_011409687.1|4644691_4645087_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4645106_4645685_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_011409690.1|4646360_4647749_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4652534_4654619_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4654718_4656746_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4656988_4658599_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4658609_4659773_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4659901_4660522_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4660852_4661041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4661083_4661419_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4663043_4663355_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4664473_4664992_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4665263_4666982_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4667072_4667459_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4667520_4668846_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4668960_4670274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4670372_4671098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4671314_4671977_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4672055_4673150_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4674654_4677414_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4677666_4679256_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4679255_4681493_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4681781_4682690_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4682779_4684594_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4684979_4693805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4693903_4694701_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4695245_4695998_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4696057_4696957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4697108_4697864_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4697860_4698496_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4698511_4698739_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4698811_4699714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4699868_4700834_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|4700931_4701687_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|4701767_4702226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4702496_4703282_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4703908_4704814_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4704877_4705795_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4706398_4707736_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4707961_4709029_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4709204_4711400_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4711396_4713361_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4713372_4714632_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4714631_4716332_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4716334_4719049_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4719271_4720744_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4721721_4722777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4723004_4724423_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4724463_4725441_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4726857_4728159_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4728620_4731554_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4731652_4733140_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4733171_4734206_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4734622_4735420_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|4736726_4737683_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4739191_4740292_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4740357_4741479_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|4741488_4742565_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4742657_4743338_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182062.1|4743370_4744169_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4744297_4745617_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4745719_4746676_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4748142_4748601_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4748702_4749131_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011409739.1|4749377_4750241_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4753417_4753684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4753845_4754094_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4754302_4755061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4755057_4755753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4755851_4756184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4756655_4757090_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4757205_4757451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4757786_4758119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4758568_4759963_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4760900_4761191_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|4761208_4761490_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|4761584_4763837_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_082325367.1|4764024_4768092_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|4768088_4771502_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_075244278.1|4771618_4771840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4778415_4778961_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4779029_4779557_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4779615_4780152_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4780239_4781205_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP031460	Xanthomonas oryzae pv. oryzae strain JP01 chromosome, complete genome	4948537	4824356	4890431	4948537	protease,transposase	Staphylococcus_phage(25.0%)	55	NA	NA
WP_011258529.1|4824356_4825325_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115892997.1|4825872_4826974_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	1.2e-41
WP_012446412.1|4827474_4827621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409784.1|4827654_4827957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260799.1|4828102_4828906_-	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	34.3	4.7e-35
WP_011409785.1|4828967_4829996_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011260801.1|4830134_4831106_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011409786.1|4831338_4832193_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409787.1|4832285_4832858_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_027703413.1|4832879_4833074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409788.1|4833180_4833621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409789.1|4833783_4836285_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.4	6.0e-20
WP_011260806.1|4836973_4837447_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
WP_011409790.1|4837759_4839079_-	L-fuconate dehydratase	NA	NA	NA	NA	NA
WP_011260808.1|4839602_4840460_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011260809.1|4840630_4841401_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011409791.1|4841397_4842270_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011409792.1|4842266_4843277_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011260812.1|4843589_4844687_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012446420.1|4844820_4845024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409794.1|4845939_4846608_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011409795.1|4846869_4848813_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.2	1.3e-83
WP_011409796.1|4849110_4849464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409797.1|4849460_4850510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409798.1|4850596_4850914_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_011260819.1|4850910_4852638_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_011260820.1|4853245_4853947_-	ROK family protein	NA	NA	NA	NA	NA
WP_011409799.1|4854303_4855083_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_011409800.1|4855079_4855517_+	GFA family protein	NA	NA	NA	NA	NA
WP_011409801.1|4855578_4855830_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011260824.1|4855956_4856553_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011260825.1|4856571_4858143_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409802.1|4858319_4859948_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409803.1|4860170_4860809_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_011409805.1|4861877_4862237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002809459.1|4862421_4862658_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002809462.1|4862671_4862839_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011260829.1|4863271_4863739_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260830.1|4863735_4864971_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260831.1|4865842_4866898_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260832.1|4866890_4867562_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260833.1|4867659_4868967_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409807.1|4868983_4870402_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011409808.1|4870973_4872368_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011260838.1|4872715_4874902_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_012446438.1|4875077_4875302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182049.1|4875882_4876848_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409811.1|4877023_4878439_-	amino acid permease	NA	NA	NA	NA	NA
WP_075242296.1|4878929_4881254_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|4881659_4882022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|4882399_4882945_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_115892998.1|4884606_4885926_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260845.1|4886198_4887326_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4888181_4889522_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4889738_4890431_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
