The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	5560	84688	4697691	tRNA,transposase,protease	Ralstonia_virus(20.0%)	55	NA	NA
WP_044757272.1|5560_6901_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_011409859.1|7059_7917_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011409856.1|10642_11743_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011260886.1|11872_12658_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011260885.1|13032_13989_-	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_069960064.1|14251_15418_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_069960063.1|15536_15857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960119.1|17770_19081_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757270.1|19106_20276_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
WP_012446478.1|21308_21494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005921785.1|22390_22612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407756.1|23723_25043_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409850.1|25434_25836_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044757268.1|25832_26342_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_113079208.1|26322_26664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|26677_27385_+	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_049756351.1|27381_28134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960059.1|30485_31598_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069960058.1|31584_31791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242371.1|33606_33927_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_011409838.1|34040_35402_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_011409837.1|35677_36244_-	FUSC family protein	NA	NA	NA	NA	NA
WP_113055205.1|36240_36864_-	TolC family protein	NA	NA	NA	NA	NA
WP_069960057.1|37119_37563_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182832.1|37738_38341_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_011409833.1|38414_39611_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011409832.1|39610_40198_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011409831.1|40194_41667_+	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_011409830.1|41650_42349_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409829.1|42496_45928_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_042465377.1|46025_47207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840187.1|48619_49939_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409826.1|50117_50468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409825.1|50615_52427_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011260853.1|52577_53234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409824.1|53394_54630_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011409823.1|54734_56258_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011260850.1|56564_57557_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409822.1|57556_57877_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011409821.1|57993_58686_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409820.1|58902_60243_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011260845.1|61098_62226_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409815.1|65478_66024_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_041182970.1|66401_66764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242296.1|67169_69494_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_011409811.1|69984_71400_+	amino acid permease	NA	NA	NA	NA	NA
WP_109182049.1|71575_72541_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012446438.1|73121_73346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260838.1|73521_75708_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_011409808.1|76055_77450_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011409807.1|78021_79440_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011260833.1|79456_80764_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260832.1|80861_81533_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260831.1|81525_82581_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260830.1|83452_84688_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	123107	302092	4697691	tail,tRNA,transposase	Arthrobacter_phage(13.04%)	115	NA	NA
WP_011258529.1|123107_124076_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011409781.1|124224_124692_+	type III effector HopPtoH like protein	NA	NA	NA	NA	NA
WP_011409779.1|126568_127606_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409777.1|129299_130145_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|130304_131510_+	aminotransferase	NA	NA	NA	NA	NA
WP_011409775.1|131562_131895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409774.1|131943_132681_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_042465359.1|132677_134150_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011260784.1|134436_135618_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|135689_136973_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_011260782.1|136969_137956_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|138000_139278_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|139274_139895_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_011260779.1|140037_143745_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_113079143.1|144836_145754_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|146106_146739_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_011409767.1|146754_147231_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|147234_147807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260772.1|147803_149819_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|150117_150546_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|150665_151469_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|151528_152518_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409765.1|152931_155004_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|155198_155810_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|156963_157770_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|157906_158704_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|158925_160335_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|160612_160951_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443742.1|160973_162416_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|162686_163742_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|163734_165162_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_012443745.1|165660_166263_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
WP_027704180.1|166333_166966_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_109182045.1|167248_168214_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|168301_168838_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|168896_169424_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|169492_170038_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_075244278.1|176613_176835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409752.1|176951_180365_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_082325367.1|180361_184429_+	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409750.1|184616_186869_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_011260747.1|186963_187245_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011260746.1|187262_187553_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_027703652.1|188490_189885_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260743.1|190334_190667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960049.1|191002_191248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|191363_191798_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011409745.1|192269_192602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|192700_193396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409743.1|193392_194151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|194359_194608_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042465346.1|194769_195036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960048.1|198212_199076_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011409738.1|199322_199751_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011260733.1|199852_200311_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465802.1|201777_202734_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011409735.1|202836_204156_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182041.1|204284_205082_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|205115_205796_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_011409734.1|205888_206965_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|206974_208096_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_075242372.1|208161_209262_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_115840186.1|209278_210042_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|210769_211726_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187716.1|213031_213830_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|214246_215281_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409728.1|215312_216800_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|216898_219832_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465333.1|220293_221595_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409725.1|223011_223989_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_011260712.1|224029_225448_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011260711.1|225675_226731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|227708_229181_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260708.1|229403_232118_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|232120_233821_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|233820_235080_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011409723.1|235091_237056_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409722.1|237052_239248_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|239423_240491_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259480.1|240716_242054_-	xylose isomerase	NA	NA	NA	NA	NA
WP_011260702.1|242657_243575_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011409720.1|243638_244544_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011409719.1|245170_245956_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|246226_246685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242173.1|246765_247521_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|247618_248584_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|248738_249641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|249713_249941_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409714.1|249956_250592_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|250588_251344_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011260693.1|251495_252395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|252454_253207_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_109182038.1|253750_254549_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153303324.1|254647_263473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409709.1|263858_265673_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_011409708.1|265762_266671_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409707.1|266959_269197_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409706.1|269196_270786_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409705.1|271038_273798_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409702.1|275302_276397_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409701.1|276475_277138_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011260682.1|277354_278080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260681.1|278178_279492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260680.1|279606_280932_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260679.1|280993_281380_+	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011409700.1|281470_283189_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011409699.1|283460_283979_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_075242289.1|285097_285409_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011260672.1|287033_287369_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_011409694.1|287930_288551_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260670.1|288679_289843_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011260669.1|289853_291464_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260668.1|291706_293734_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260667.1|293833_295918_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409690.1|300703_302092_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	388178	438971	4697691	integrase,transposase	Leptospira_phage(28.57%)	33	432149:432168	446208:446227
WP_109182033.1|388178_389144_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_042465296.1|390093_390714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443879.1|390810_391002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260591.1|391011_391635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|392063_392984_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260589.1|392983_393502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409641.1|393663_396489_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011409640.1|396584_397145_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409636.1|400243_400744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409635.1|400740_401610_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011409634.1|401652_402600_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011409633.1|402733_403324_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_075240651.1|403534_404287_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|404772_405192_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_012443890.1|405188_405620_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409630.1|405616_407623_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_129215547.1|407771_408188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075244060.1|408472_408700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409629.1|408696_409209_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_011409626.1|410897_414827_-	avirulence protein	NA	NA	NA	NA	NA
WP_011409622.1|418148_420836_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_125168769.1|421025_421931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168768.1|421990_422662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113101711.1|422767_423869_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_011409617.1|424227_424518_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_011260561.1|424594_427396_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011260560.1|428343_429243_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011409614.1|430369_431512_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
432149:432168	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260557.1|433629_434505_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011260556.1|434735_436574_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|436748_437015_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|437040_437586_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011407587.1|437936_438971_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
446208:446227	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
>prophage 4
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	444733	517493	4697691	tRNA,transposase	Acinetobacter_phage(23.08%)	57	NA	NA
WP_011260549.1|444733_446110_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_011260548.1|446344_446503_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011409607.1|446567_447578_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260546.1|447806_449477_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|449795_450179_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260544.1|450400_451303_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409605.1|451299_453795_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260542.1|453802_455434_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011260541.1|455430_456594_-	Fic family protein	NA	NA	NA	NA	NA
WP_011260540.1|456665_457682_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|457783_458104_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011409604.1|458489_458951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260538.1|458977_459454_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|459795_461019_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|461123_461735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409603.1|461836_462586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260534.1|462776_464123_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260533.1|464107_465550_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260532.1|465599_467327_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|467684_468281_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_011409602.1|468603_469629_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260529.1|469644_470160_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|470269_470704_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011409601.1|470779_471202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|471230_471701_-	thioesterase	NA	NA	NA	NA	NA
WP_069964616.1|472163_473129_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182775.1|473547_474513_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409598.1|475257_476625_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|476914_480055_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011260521.1|480188_483437_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_011260520.1|483529_484774_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409596.1|485033_486350_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|487108_487924_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409594.1|488391_489576_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_069960033.1|489768_490740_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011407175.1|490906_491875_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_094187777.1|492859_493657_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260506.1|495865_497242_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_011409586.1|497390_499103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409585.1|499292_501524_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_094187806.1|502127_503230_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409581.1|504657_505239_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_011260499.1|505390_506020_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409580.1|506137_507175_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260497.1|507311_508109_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409579.1|508101_508818_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_115840185.1|509138_509831_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011260494.1|509968_510763_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011409578.1|510922_511237_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260492.1|511518_512172_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011260491.1|512357_512786_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005990700.1|512789_513182_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260490.1|513730_514348_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_027703893.1|514428_514644_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003483093.1|514986_515457_+	bacterioferritin	NA	NA	NA	NA	NA
WP_115840195.1|515469_516435_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187805.1|516513_517493_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
>prophage 5
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	540457	582165	4697691	tRNA,transposase	Moraxella_phage(50.0%)	37	NA	NA
WP_011260469.1|540457_541522_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_011409563.1|541600_541957_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|542184_544356_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_069960023.1|546689_547652_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409559.1|548647_549826_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011260461.1|550000_550435_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|550995_551277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408623.1|551870_553106_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011409554.1|553622_554939_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|554935_555712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840184.1|555993_556756_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|557204_558167_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|558386_559184_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|559238_560036_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260454.1|560191_561289_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_012444005.1|561285_562698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409549.1|562921_563728_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_113079160.1|563820_564567_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|564873_565071_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|565281_565659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|565884_566226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260447.1|566432_566873_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409546.1|566910_567663_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011257031.1|567788_568757_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181902.1|568906_570226_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409543.1|570437_571013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465763.1|571137_571755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182023.1|571797_572595_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260442.1|572603_573413_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_012444011.1|573588_574392_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011409539.1|574495_575473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|575469_576735_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409538.1|577160_577685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|577814_579110_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_080493654.1|579181_580084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260435.1|580286_580667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182021.1|581199_582165_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	603044	685066	4697691	transposase,protease	Erwinia_phage(18.18%)	55	NA	NA
WP_011407587.1|603044_604079_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_094187728.1|604226_605024_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444032.1|605813_606740_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_011409516.1|606948_607278_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_011260410.1|607672_608344_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011260409.1|608340_608832_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260408.1|609066_609996_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011409514.1|610586_612062_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011409513.1|612096_612945_+	amino acid lyase	NA	NA	NA	NA	NA
WP_027704189.1|614293_614890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|615237_616821_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_011409509.1|617211_617403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260402.1|617777_619724_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_041182286.1|619919_622244_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260398.1|624146_625238_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_027703846.1|627277_628156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409500.1|628353_629229_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011260394.1|629504_631277_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_041182283.1|631685_633332_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011260392.1|634552_635929_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_011409498.1|636022_637018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|637263_638175_+	magnesium transporter	NA	NA	NA	NA	NA
WP_012444053.1|638769_639054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409497.1|639384_639831_+	autotransporter	NA	NA	NA	NA	NA
WP_011260388.1|640374_642048_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_027704042.1|642301_643087_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_094187782.1|644134_644897_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409494.1|645140_646145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182280.1|646183_647113_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011260383.1|647660_650531_-	insulinase family protein	NA	NA	NA	NA	NA
WP_011409492.1|650786_653411_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260380.1|654645_656094_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409489.1|656301_657789_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_011260378.1|659179_660829_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_094187780.1|661142_661906_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260377.1|662632_664570_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_011260376.1|664721_665390_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260375.1|665394_666447_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011409485.1|666477_667215_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011409484.1|667245_668160_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011260372.1|668710_669511_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011260371.1|670069_671035_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260370.1|671143_671713_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011409482.1|672100_672412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|672479_674573_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409480.1|674655_675087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409479.1|675412_676597_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_027703683.1|676720_678856_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409478.1|679199_679598_+	YbaN family protein	NA	NA	NA	NA	NA
WP_011409477.1|679655_679892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260363.1|679881_680736_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409476.1|680732_681404_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_011409475.1|681603_682521_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011260360.1|683036_683588_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011260359.1|683698_685066_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
>prophage 7
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	711035	806149	4697691	transposase	Ralstonia_phage(17.65%)	66	NA	NA
WP_011409456.1|711035_711998_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011409455.1|712292_713567_+	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_125168765.1|713538_714081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260336.1|715306_716446_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011260335.1|716442_717858_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260334.1|718358_719564_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011409453.1|720629_720908_+	YbeD family protein	NA	NA	NA	NA	NA
WP_011260332.1|720895_721594_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011260331.1|721608_722622_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_155296183.1|722622_722772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182275.1|722866_724678_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260329.1|724674_725769_+	type II restriction enzyme	NA	NA	NA	NA	NA
WP_053504163.1|726267_728451_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.4	1.8e-81
WP_053504164.1|728742_729609_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_053504165.1|729770_730826_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.7e-80
WP_053504166.1|730948_732352_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.1	1.2e-131
WP_012444115.1|734600_735362_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409446.1|735486_735867_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_075239460.1|736038_737376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260319.1|737396_738338_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_011260318.1|738677_739730_-	oxidoreductase	NA	NA	NA	NA	NA
WP_011260317.1|739880_740252_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011409443.1|740537_742349_+	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260315.1|742345_742786_+	response regulator	NA	NA	NA	NA	NA
WP_011260314.1|742789_744292_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260313.1|744383_744899_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011409442.1|745067_745805_-	pteridine reductase	NA	NA	NA	NA	NA
WP_103057228.1|745872_747057_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409439.1|748492_749728_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011409437.1|750218_751175_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_011409436.1|751456_754147_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260306.1|754297_757195_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_075242688.1|757191_759588_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011409433.1|759721_760888_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011409432.1|761102_761870_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|761914_763192_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409431.1|763232_764309_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260300.1|764305_765334_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409430.1|765336_766491_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260298.1|766910_767516_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011260297.1|767512_768766_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011409429.1|768767_770666_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011409428.1|770667_772710_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_012444134.1|773334_773565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182027.1|774026_774992_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|778401_779165_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|779500_780469_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407237.1|780680_781637_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_115840183.1|781812_782775_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|782814_784047_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_094187728.1|785693_786491_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409421.1|787423_787690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011257031.1|788423_789392_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182012.1|789464_790228_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182588.1|790420_792994_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_082325341.1|793116_794112_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	5.4e-97
WP_011409416.1|796040_796778_-	endonuclease	NA	NA	NA	NA	NA
WP_011260284.1|796827_797643_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409415.1|797734_798385_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260283.1|798478_799276_-	cytochrome c4	NA	NA	NA	NA	NA
WP_011409413.1|799420_800044_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409411.1|800990_801686_-	VIT family protein	NA	NA	NA	NA	NA
WP_011260279.1|801901_803266_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_075242321.1|803452_804112_-	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_075242322.1|804116_804380_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_115840193.1|804541_806149_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1113706	1124537	4697691	transposase	Burkholderia_phage(28.57%)	8	NA	NA
WP_069960108.1|1113706_1114663_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011409252.1|1116063_1117149_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_011409251.1|1117145_1118216_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_113079227.1|1118223_1118919_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
WP_011260010.1|1118915_1119365_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_041182486.1|1119694_1122649_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	5.3e-257
WP_027703308.1|1123120_1123303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465718.1|1123733_1124537_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
>prophage 9
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1173926	1221580	4697691	plate,transposase	uncultured_Caudovirales_phage(40.0%)	33	NA	NA
WP_011258188.1|1173926_1174895_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011259966.1|1175803_1176487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115858612.1|1176553_1178479_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.8	1.5e-34
WP_041182243.1|1178475_1179300_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011259963.1|1179292_1179889_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_113079229.1|1179888_1182120_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259961.1|1182100_1182490_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_125168764.1|1184503_1185079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242365.1|1185053_1186031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840179.1|1186027_1188745_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_113079215.1|1188755_1189544_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011409207.1|1189543_1190878_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011409206.1|1191029_1191638_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033005590.1|1192024_1192513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1192559_1193060_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1193063_1194560_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1194701_1195199_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1195346_1195835_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_069959967.1|1195837_1197673_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259940.1|1197636_1198728_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259939.1|1198813_1201543_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259938.1|1201573_1201927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325328.1|1202019_1204782_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
WP_113079154.1|1204723_1205629_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082325327.1|1205647_1208515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409198.1|1208518_1209544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325325.1|1211508_1212531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325324.1|1212442_1214386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409194.1|1214390_1215410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325323.1|1215321_1217259_+	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_041182737.1|1217267_1218299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325322.1|1218210_1220649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|1220623_1221580_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
>prophage 10
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1237844	1282420	4697691	transposase	Ralstonia_phage(50.0%)	32	NA	NA
WP_011258803.1|1237844_1238813_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_113079192.1|1238815_1239106_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258529.1|1239220_1240189_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011409176.1|1240314_1240848_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011409175.1|1240844_1241591_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_011409174.1|1241590_1242265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407756.1|1242348_1243668_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1243867_1244836_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409173.1|1244901_1248081_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011409172.1|1248359_1248626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|1248874_1250449_-	protein kinase	NA	NA	NA	NA	NA
WP_041182227.1|1250857_1251634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704159.1|1251962_1252718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409168.1|1252778_1253408_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409167.1|1253622_1254402_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_094187731.1|1255478_1256277_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409165.1|1256768_1257194_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_011259911.1|1257203_1257425_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409164.1|1257574_1258180_+	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259909.1|1258181_1258832_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259908.1|1258841_1260260_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259907.1|1260441_1263693_+	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_027704156.1|1264003_1264822_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259904.1|1264934_1266332_-	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_011259903.1|1266760_1268731_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011257031.1|1269055_1270024_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_027704154.1|1271015_1271861_+	transporter	NA	NA	NA	NA	NA
WP_027704153.1|1272127_1274248_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409154.1|1277694_1278156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259895.1|1278287_1279013_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407587.1|1279396_1280431_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011407175.1|1281451_1282420_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
>prophage 11
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1329870	1378572	4697691	integrase,tRNA,transposase	Ralstonia_phage(33.33%)	37	1338421:1338480	1355091:1355754
WP_115801902.1|1329870_1330836_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|1332183_1333095_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|1336168_1336931_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445603.1|1337063_1337486_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011409129.1|1337546_1338260_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
1338421:1338480	attL	GGGCAGTCTCAAGATTCAAGTGCAACACGTGATTTGAGTGCTGCGATTTCTTCCTCCATT	NA	NA	NA	NA
WP_011259856.1|1341306_1341582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409127.1|1341841_1342183_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259854.1|1342240_1344103_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_011259853.1|1344178_1344937_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409125.1|1345238_1346033_-	thiazole synthase	NA	NA	NA	NA	NA
WP_011259851.1|1346568_1346769_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012445601.1|1346959_1348744_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_075239728.1|1350460_1350880_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_027704094.1|1353218_1353611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1353701_1354094_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_094187763.1|1354126_1354925_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1355796_1356559_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1355091:1355754	attR	GGGCAGTCTCAAGATTCAAGTGCAACACGTGATTTGAGTGCTGCGATTTCTTCCTCCATTGCCTCGCTTGGTGTCTTCCATCCGAGCGTCTGACGAGGGCGGGTATTCATCAGCAGTGCGATGTGATTGAGATACTCTTGGCTGACAGTGGACAGGTCGGCGCCCTTGGGCAGGAATTGGCGCAGCAGGCCGTTGGTGTTCTCGTTACTTCCCCGCTGCCACGGCGCATGTGGATCAGCGAACCACACGTCGATGTTCAATCCTTGCATCAGCTCGGCGTAGCACGTGAGCTCGGTACCGCGATCGTAGGTCAGACTTGTCCGCATTGAGGCCGGCAGTTTCTTCATTTGCCGGGTAAACCCTTCCAGCGCATCTGCGGCCGTGCAGCCATCCATGCGGCACAGCACGACAAAGCGCGTCTTGCGTTCCACCAACGTGCCCACGCAAGAACGATTGAATGCGCCCTTGATCAAGTCGCCTTCCCAATGACCTGGGACCAAGCGCGTCTGCACTTCTTCGGGGCGATGCACAATCCGCAACTCCTCCGGCACCCAGCTGCGTGTGGCCGCCGTTGTACGCCGTCATCCGCGTTTGGGCTTGTGCTGACGCAGGGCCTGGACCAGTTCCTTCTTCAAGCCCCCACGCGGATGCGCGTAGATGCTAG	NA	NA	NA	NA
WP_048488802.1|1356556_1356889_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115840192.1|1356935_1357901_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1358045_1359014_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011258529.1|1359205_1360174_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011409116.1|1360724_1362857_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_094187771.1|1363158_1363922_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115840178.1|1364162_1365128_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011259834.1|1365124_1365652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182217.1|1365797_1367012_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_115801901.1|1367099_1368419_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259831.1|1368509_1368701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409111.1|1368668_1369682_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1369715_1369949_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_027704065.1|1370422_1370716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|1371325_1372089_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|1372213_1373179_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409108.1|1373478_1373928_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|1374183_1375041_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011259826.1|1375245_1375857_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409106.1|1375929_1378572_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
>prophage 12
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1397672	1457984	4697691	tRNA,transposase,protease	Clostridium_phage(14.29%)	50	NA	NA
WP_011259808.1|1397672_1399118_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011409095.1|1399374_1399956_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_042465665.1|1400101_1401469_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_069963878.1|1401465_1401786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445570.1|1401758_1401947_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_027704198.1|1401998_1402463_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_011409091.1|1404297_1405173_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011259802.1|1405174_1405435_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409090.1|1405466_1406771_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_069963877.1|1406804_1408511_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409088.1|1408654_1409974_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_125168763.1|1410847_1411075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259797.1|1411087_1411579_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011259796.1|1411786_1412536_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_027704197.1|1412645_1413182_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259794.1|1413292_1413772_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011409085.1|1413999_1415244_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011409084.1|1415251_1416502_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409082.1|1417785_1418748_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409081.1|1419185_1419593_+	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_012445555.1|1419633_1420332_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011259787.1|1420602_1422618_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_011259785.1|1424005_1424857_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259784.1|1424949_1425519_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259783.1|1425553_1425739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409078.1|1426585_1427020_-	HIT family protein	NA	NA	NA	NA	NA
WP_012445553.1|1427016_1427592_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011259780.1|1427854_1429255_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409076.1|1429376_1429883_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_153296738.1|1429993_1430281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057205.1|1430241_1431459_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_041182211.1|1432881_1434465_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_027703264.1|1435015_1435864_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_011259773.1|1435860_1436511_-	SCO family protein	NA	NA	NA	NA	NA
WP_011259772.1|1436591_1437518_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259771.1|1437528_1438632_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011409070.1|1438624_1439698_+	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259769.1|1439782_1440808_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_075241401.1|1441488_1443441_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259765.1|1444014_1444788_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_011259764.1|1444784_1445453_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011409068.1|1445795_1446764_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259762.1|1446869_1448087_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|1448532_1449339_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259760.1|1449656_1450544_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011259759.1|1450540_1451890_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259758.1|1452012_1452951_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011409066.1|1453160_1453835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|1453831_1456198_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187736.1|1457221_1457984_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1534532	1697076	4697691	plate,transposase	Ralstonia_phage(50.0%)	104	NA	NA
WP_011409034.1|1534532_1535615_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011409032.1|1538405_1538942_-	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_042465093.1|1540448_1541480_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011409028.1|1542068_1542389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409027.1|1542723_1543323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259680.1|1543319_1544243_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_042465653.1|1544322_1544532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409025.1|1545258_1545501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409022.1|1547012_1547501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113081225.1|1550413_1552036_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011409017.1|1552400_1552679_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_011259671.1|1552702_1553776_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_042465086.1|1554254_1555871_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_011409015.1|1556075_1556792_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409014.1|1556949_1557888_+	hydroxyproline-2-epimerase	NA	NA	NA	NA	NA
WP_113055126.1|1557887_1559150_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259666.1|1559146_1559392_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011409013.1|1559363_1560698_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259664.1|1560694_1561603_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_011259663.1|1561813_1563430_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011409012.1|1563426_1564626_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011409011.1|1564743_1566576_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011409010.1|1566572_1568438_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011409009.1|1568500_1570087_+	amino acid permease	NA	NA	NA	NA	NA
WP_011409008.1|1570076_1572416_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409006.1|1574129_1574426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259652.1|1574632_1576204_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	37.4	5.2e-70
WP_113079131.1|1576667_1579025_+	Tat pathway signal protein	NA	NA	NA	NA	NA
WP_011409003.1|1579546_1582363_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	3.1e-49
WP_011409002.1|1582601_1586966_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_033013184.1|1586962_1588549_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_011259647.1|1588870_1591216_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704011.1|1596064_1598440_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_011407587.1|1599115_1600150_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408991.1|1600987_1602223_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408989.1|1604151_1604529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259640.1|1604734_1605988_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408988.1|1606025_1606595_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011408987.1|1606578_1606941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465070.1|1608334_1608529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408985.1|1609337_1610315_-	siroheme synthase	NA	NA	NA	NA	NA
WP_109181928.1|1611522_1612488_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|1612852_1613032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296740.1|1613063_1613222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408981.1|1613471_1614434_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1614562_1615531_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115840177.1|1615846_1616830_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_011408979.1|1617269_1617527_+	stress-induced protein	NA	NA	NA	NA	NA
WP_011259629.1|1618826_1620062_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408977.1|1620818_1621589_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011408976.1|1621958_1623251_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011259625.1|1623234_1624497_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408975.1|1624508_1624940_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408974.1|1624998_1625364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1625497_1626466_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408973.1|1626623_1627385_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012445389.1|1627606_1628254_+	response regulator	NA	NA	NA	NA	NA
WP_094187765.1|1628357_1629120_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465057.1|1629646_1633360_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_027704269.1|1633770_1634757_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_027704270.1|1634789_1636574_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_069960235.1|1636922_1637183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408967.1|1637209_1637443_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_012445383.1|1637458_1637881_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445382.1|1637877_1638234_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445381.1|1638321_1638921_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_042465054.1|1638934_1640764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|1641421_1644256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|1644284_1645031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|1645048_1647391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|1647421_1648159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408960.1|1648183_1650100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1650151_1651120_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260830.1|1651305_1652541_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069964543.1|1652711_1654028_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1654163_1655132_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_024711387.1|1656490_1656997_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027703472.1|1656989_1658504_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011259605.1|1658603_1659107_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259604.1|1659142_1659976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259603.1|1659963_1660467_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259602.1|1660470_1662348_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011408954.1|1662311_1663322_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011408953.1|1663354_1666060_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_027703476.1|1666248_1666746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|1666811_1667306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408952.1|1667693_1668152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|1668416_1670354_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408951.1|1670362_1670902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959924.1|1670898_1672290_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408949.1|1672286_1673624_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011408948.1|1673625_1674942_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_113079225.1|1674945_1678404_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_041182189.1|1678400_1679048_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011259593.1|1679044_1679767_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_027703483.1|1679763_1682667_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_113079223.1|1682663_1682990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182188.1|1683162_1684191_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011259590.1|1684199_1685180_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259589.1|1685293_1687753_-	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011408941.1|1687749_1688742_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013236.1|1688738_1689446_-	response regulator	NA	NA	NA	NA	NA
WP_042465048.1|1692481_1695562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|1695978_1697076_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1790082	1801857	4697691	tRNA	Pseudomonas_phage(22.22%)	12	NA	NA
WP_011408886.1|1790082_1791759_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
WP_011408885.1|1791847_1792489_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408884.1|1792661_1793696_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_012444556.1|1793998_1794487_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011259507.1|1794588_1797237_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_003481884.1|1797376_1797589_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_103057240.1|1798314_1798719_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_012444559.1|1799106_1799406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408881.1|1799591_1800287_+	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_011259505.1|1800291_1801041_+	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011259504.1|1801284_1801515_+	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259503.1|1801557_1801857_+	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
>prophage 15
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1838214	1901483	4697691	tRNA,transposase	uncultured_Caudovirales_phage(42.86%)	39	NA	NA
WP_094187715.1|1838214_1838977_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408860.1|1839387_1840104_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011259464.1|1840343_1841468_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_012444585.1|1841467_1841911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259463.1|1841919_1845162_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011408858.1|1845158_1845635_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259461.1|1845651_1846572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408857.1|1846568_1848308_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_115840175.1|1849055_1850075_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|1850108_1851065_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408855.1|1851359_1851737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959908.1|1851897_1852599_-|transposase	transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_041182178.1|1855405_1856353_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503214.1|1856606_1857731_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_011408850.1|1857935_1859453_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	3.8e-86
WP_011408849.1|1859594_1860731_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_011259451.1|1861095_1863273_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408848.1|1863284_1864154_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259449.1|1864330_1866013_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_011259446.1|1866662_1869431_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1869578_1869827_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1869823_1870234_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_011259443.1|1870299_1872891_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259442.1|1873244_1874060_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011408846.1|1874715_1876959_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259440.1|1877067_1878144_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011259439.1|1878140_1878737_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011408845.1|1878733_1879600_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_012444601.1|1879858_1882252_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.8e-09
WP_011259437.1|1882336_1882660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187763.1|1882902_1883701_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408841.1|1884549_1885032_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408840.1|1885167_1885953_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408839.1|1886922_1889184_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011259431.1|1889577_1891839_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_069959907.1|1892431_1894507_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_042465628.1|1895191_1897303_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_044756755.1|1898031_1900278_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_115840174.1|1900517_1901483_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	1907780	1989103	4697691	transposase	Ralstonia_phage(27.27%)	53	NA	NA
WP_011408830.1|1907780_1908035_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011408829.1|1908202_1910212_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|1910245_1910611_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259421.1|1910607_1910916_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_042465006.1|1911016_1912039_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259419.1|1912035_1912818_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011408827.1|1912819_1913794_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259417.1|1913800_1914541_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_027703781.1|1914629_1914983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408826.1|1914979_1915471_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011408825.1|1915517_1915910_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_044756757.1|1916061_1916769_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_125168759.1|1916844_1917192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|1917193_1918999_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|1919253_1919706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|1920695_1923797_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168758.1|1924105_1924606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1925262_1926231_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011259411.1|1926730_1927366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259410.1|1927608_1928055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259409.1|1928051_1928468_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011408815.1|1929572_1930892_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|1931119_1931434_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_157724569.1|1931366_1932320_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182637.1|1932480_1932870_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_082325566.1|1932909_1935399_+	avirulence protein	NA	NA	NA	NA	NA
WP_069964551.1|1936964_1939727_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_069964550.1|1939735_1940665_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_115840173.1|1940661_1943496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1943526_1944270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|1944294_1946637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|1946665_1947394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959892.1|1947411_1949757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409735.1|1949996_1951316_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1951528_1952497_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444645.1|1953163_1954441_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_069963855.1|1954618_1956361_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011259401.1|1956519_1957476_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_059317461.1|1957472_1959989_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011408798.1|1960149_1961145_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109181969.1|1961851_1962817_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259395.1|1963792_1966963_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011408794.1|1966975_1968280_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408793.1|1968294_1968954_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408792.1|1969231_1974256_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408791.1|1974704_1975688_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011259389.1|1975812_1976799_-	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_113079202.1|1976832_1980927_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.9e-55
WP_011408789.1|1981068_1982373_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_011408788.1|1982543_1983398_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408787.1|1983564_1986702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259384.1|1986762_1988115_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_109182012.1|1988339_1989103_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2003146	2064237	4697691	tRNA,transposase,protease	Bacillus_virus(22.22%)	49	NA	NA
WP_115840172.1|2003146_2004535_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408779.1|2005041_2006244_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011408778.1|2006240_2007827_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408777.1|2007831_2009325_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_075240820.1|2009470_2010718_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408774.1|2011031_2011862_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011408773.1|2012017_2012428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408772.1|2012682_2014047_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011259367.1|2014198_2015200_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011259366.1|2015215_2016496_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011408770.1|2016492_2017371_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011408769.1|2017465_2017984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2017983_2018469_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011259362.1|2018523_2019186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408767.1|2019597_2020584_-	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011408766.1|2021007_2022462_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011259357.1|2024397_2025384_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011259356.1|2025913_2026558_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259355.1|2026557_2027817_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259354.1|2027809_2028568_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011259353.1|2028961_2029597_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259352.1|2029675_2030116_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011408764.1|2030148_2030475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465594.1|2030685_2031030_-	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|2035594_2036560_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408760.1|2037140_2038325_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_080256628.1|2039097_2039286_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408759.1|2039770_2040049_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703932.1|2040036_2040327_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004541336.1|2040587_2040785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015463309.1|2040928_2041108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2041971_2042373_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_041182166.1|2043465_2044557_-	ribonuclease D	NA	NA	NA	NA	NA
WP_041182165.1|2044828_2046664_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_094187754.1|2046980_2047727_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959887.1|2047944_2049207_+	virulence factor	NA	NA	NA	NA	NA
WP_041182164.1|2049502_2050840_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_094187715.1|2050923_2051686_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959886.1|2051801_2052869_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_075243426.1|2052893_2054381_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011259336.1|2054377_2054878_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_012444702.1|2054930_2056664_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259334.1|2056801_2058679_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408750.1|2058678_2059620_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011408749.1|2059653_2060625_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011259331.1|2060798_2061374_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408747.1|2061533_2062274_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259329.1|2062361_2063261_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011259328.1|2063358_2064237_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 18
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2096068	2137990	4697691	tRNA,transposase	Streptococcus_phage(25.0%)	36	NA	NA
WP_109181979.1|2096068_2097385_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2097584_2098553_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408734.1|2098689_2100009_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444728.1|2100232_2100721_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011259294.1|2101092_2101356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2101381_2102145_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408729.1|2103043_2103883_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011408728.1|2103882_2105232_-	dihydroorotase	NA	NA	NA	NA	NA
WP_011408727.1|2105228_2105516_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075242610.1|2105600_2106641_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011259288.1|2106783_2107845_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_011259287.1|2107912_2109163_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408724.1|2109159_2109597_-	SufE family protein	NA	NA	NA	NA	NA
WP_012444736.1|2110094_2111519_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_027703614.1|2111695_2112190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259283.1|2112502_2113528_+	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2113599_2114841_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011408722.1|2115082_2115535_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408721.1|2115540_2116641_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408720.1|2116680_2118024_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_041182650.1|2118636_2119587_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408717.1|2119710_2121006_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011408716.1|2121005_2121371_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011259275.1|2121370_2121631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408715.1|2121644_2122799_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011408714.1|2122963_2124208_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011259272.1|2124575_2126489_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408713.1|2126469_2127735_-	MFS transporter	NA	NA	NA	NA	NA
WP_011259269.1|2127955_2128066_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_115840191.1|2128403_2129369_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259267.1|2129510_2129774_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_082325289.1|2130576_2131533_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_075239845.1|2132132_2133869_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_011408708.1|2133865_2135551_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_082323190.1|2135719_2137018_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801893.1|2137024_2137990_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2235779	2333208	4697691	tRNA,transposase,protease	uncultured_Mediterranean_phage(28.57%)	73	NA	NA
WP_011259189.1|2235779_2236916_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011408665.1|2236912_2237371_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005914463.1|2237621_2237942_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011259186.1|2238085_2240368_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_002813418.1|2240648_2240867_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_042465566.1|2240947_2241700_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011408662.1|2243127_2244249_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259181.1|2244306_2245275_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011259180.1|2245558_2247919_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259179.1|2248081_2250010_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_027703232.1|2250074_2250746_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259177.1|2250858_2255025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2255261_2256638_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259175.1|2256669_2256996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2256992_2257400_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011408659.1|2257431_2257782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259173.1|2257778_2259110_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011259172.1|2259430_2260636_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259171.1|2260793_2263166_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259170.1|2263190_2263823_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2264042_2264468_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259169.1|2264486_2265692_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011408658.1|2265702_2266491_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259167.1|2266487_2267348_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259166.1|2267418_2268057_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011408657.1|2268056_2269274_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259164.1|2269284_2270682_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259163.1|2270996_2272217_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_075245207.1|2274097_2274331_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|2274598_2275567_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|2276481_2277450_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_162013043.1|2279024_2279231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2279266_2280742_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_109181957.1|2280719_2281685_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2281961_2283119_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181956.1|2283352_2284672_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181955.1|2284769_2285826_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408651.1|2285914_2287819_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_011259148.1|2288059_2288680_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011259147.1|2288676_2289183_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_027703974.1|2289229_2289727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444765.1|2289958_2290243_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408648.1|2290239_2292033_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_011259143.1|2292039_2293071_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2293350_2294114_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259142.1|2294510_2295143_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041182147.1|2295293_2295761_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259140.1|2298033_2299155_+	phytase	NA	NA	NA	NA	NA
WP_011259129.1|2302544_2303252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408638.1|2303596_2305093_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259127.1|2305216_2305648_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703908.1|2305834_2306905_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259125.1|2306974_2308120_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_011259124.1|2308251_2308605_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259123.1|2308801_2310646_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259122.1|2310740_2311709_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011408636.1|2311789_2312152_-	recombinase	NA	NA	NA	NA	NA
WP_109181954.1|2314839_2316159_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408760.1|2316408_2317593_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_042464912.1|2317643_2318705_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408631.1|2318941_2320261_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259117.1|2320331_2320967_-	ribonuclease T	NA	NA	NA	NA	NA
WP_011259116.1|2321250_2321658_-	RcnB family protein	NA	NA	NA	NA	NA
WP_011408630.1|2321790_2322501_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259114.1|2322629_2323460_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_069959865.1|2323482_2324352_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_069959864.1|2324351_2325326_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011408626.1|2325438_2326530_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_011408625.1|2326717_2327737_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011259109.1|2327925_2329176_-	porin	NA	NA	NA	NA	NA
WP_041182144.1|2329515_2329836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408623.1|2330399_2331635_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|2332239_2333208_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 20
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2453037	2518864	4697691	transposase,protease	Bacillus_phage(30.0%)	54	NA	NA
WP_011408557.1|2453037_2453646_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044756845.1|2453976_2454165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2454348_2454663_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756844.1|2454713_2455547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756843.1|2455613_2456114_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044757420.1|2456205_2456784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2456945_2457446_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011259011.1|2458970_2459684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703343.1|2459935_2460175_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259009.1|2462631_2463117_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_011408551.1|2463267_2464047_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012444869.1|2464235_2466116_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_044756840.1|2466449_2467967_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_075239088.1|2468103_2468739_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_044756838.1|2469167_2470301_-	phospholipase A	NA	NA	NA	NA	NA
WP_115840171.1|2470623_2471706_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_113081228.1|2472005_2472887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2473650_2474625_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_011408544.1|2474791_2475025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2476919_2477683_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408539.1|2479248_2482644_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_011258994.1|2482858_2483239_-	response regulator	NA	NA	NA	NA	NA
WP_027703995.1|2484254_2484458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408535.1|2486084_2486744_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011258990.1|2486799_2488716_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011258989.1|2488818_2489538_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258988.1|2489534_2490542_-	glucokinase	NA	NA	NA	NA	NA
WP_011408534.1|2490538_2491969_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258986.1|2492402_2493500_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408533.1|2493628_2494501_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_012444907.1|2494444_2494711_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011258985.1|2494770_2495166_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011258984.1|2495162_2495549_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258983.1|2495583_2497374_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_012444910.1|2497377_2497587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408532.1|2497603_2498386_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2498496_2498745_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_014503500.1|2498695_2499148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010378794.1|2499171_2500413_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011258980.1|2500405_2501140_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_109181948.1|2502533_2503499_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408527.1|2503752_2506161_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_011408526.1|2506189_2506852_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011258975.1|2506855_2507320_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011258974.1|2507316_2509086_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258973.1|2509082_2510123_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258972.1|2510414_2511194_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258971.1|2511190_2511655_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258970.1|2511678_2513097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258969.1|2513093_2514950_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258968.1|2514949_2515582_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011408524.1|2516056_2516563_-	glyoxalase	NA	NA	NA	NA	NA
WP_041182131.1|2516729_2517629_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408522.1|2517679_2518864_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
>prophage 21
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2523250	2597220	4697691	tRNA,transposase	Ralstonia_phage(20.0%)	54	NA	NA
WP_041182129.1|2523250_2524216_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2524360_2525329_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407237.1|2525743_2526700_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408520.1|2527954_2528626_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|2528622_2528799_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069959856.1|2529017_2533034_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2533258_2533558_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2533561_2533756_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_109181946.1|2533986_2534750_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115840170.1|2534839_2538595_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2538818_2539118_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_041182100.1|2539121_2539316_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_162828807.1|2542871_2543093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187728.1|2546259_2547057_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258822.1|2547207_2548557_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_011408403.1|2548668_2549328_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2549688_2550156_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_109181933.1|2550342_2551444_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_011258803.1|2552621_2553590_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011258802.1|2553781_2554750_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258800.1|2555610_2556810_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2556958_2557141_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011408398.1|2557462_2558938_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011408397.1|2558992_2560177_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|2560621_2561587_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2562939_2563908_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408388.1|2564066_2564414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258793.1|2564415_2565183_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_109181926.1|2566253_2567051_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258790.1|2567262_2569791_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_042464810.1|2570357_2571803_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_042464808.1|2572174_2572315_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408383.1|2572314_2573496_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258786.1|2573584_2574580_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057265.1|2574576_2575716_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011408381.1|2575858_2578612_+	methionine synthase	NA	NA	NA	NA	NA
WP_011408380.1|2578998_2580204_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408379.1|2580200_2581187_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408378.1|2581183_2582494_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_041182423.1|2582507_2583683_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042464805.1|2583823_2584669_-	transporter	NA	NA	NA	NA	NA
WP_042464803.1|2585002_2585755_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_011258777.1|2585755_2585992_-	protein SlyX	NA	NA	NA	NA	NA
WP_011408374.1|2585984_2587334_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_027703707.1|2587359_2588325_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408372.1|2588416_2588974_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_042464800.1|2589109_2589358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408371.1|2589360_2589723_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258772.1|2589719_2590595_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_075242602.1|2590591_2591578_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258770.1|2591587_2592424_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_042464794.1|2593056_2593479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|2593601_2595005_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_109181925.1|2596456_2597220_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2669884	2725472	4697691	coat,transposase,protease	Acidithiobacillus_phage(25.0%)	42	NA	NA
WP_011408331.1|2669884_2670409_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011408330.1|2670417_2671188_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258704.1|2671204_2673556_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011258703.1|2673552_2674587_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_041182086.1|2674633_2674966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|2674968_2675694_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258701.1|2676069_2676873_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|2677042_2677921_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|2678048_2678426_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|2678482_2679205_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|2679385_2679943_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|2679960_2680722_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|2680718_2681546_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|2681548_2682739_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011408324.1|2682765_2684112_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445188.1|2684195_2686562_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_069959820.1|2686961_2687975_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2687971_2688433_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|2688456_2689248_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|2689286_2690543_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011408322.1|2690539_2691280_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_011408321.1|2691737_2695328_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011258685.1|2695503_2696463_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_042464756.1|2697302_2699483_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258682.1|2699482_2700220_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_011258681.1|2700216_2701629_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012445196.1|2703730_2703997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408317.1|2704074_2704521_-	membrane protein	NA	NA	NA	NA	NA
WP_011408316.1|2704594_2705197_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012445197.1|2705337_2706681_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011258676.1|2707153_2707717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2711411_2711582_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011408313.1|2711595_2712012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325258.1|2712810_2714292_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.7	3.7e-102
WP_011408311.1|2714334_2714730_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082323429.1|2714769_2716146_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011258670.1|2717776_2718451_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|2718455_2719232_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_069959816.1|2719652_2721590_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011408306.1|2721771_2722749_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011408305.1|2722745_2724143_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408304.1|2724413_2725472_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2745036	2804434	4697691	transposase,protease	Tupanvirus(18.18%)	52	NA	NA
WP_109181916.1|2745036_2745798_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408285.1|2746083_2747454_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258646.1|2747523_2747718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258645.1|2747777_2748386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408284.1|2748421_2749024_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258643.1|2749297_2749753_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_103057305.1|2751675_2752887_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408282.1|2753107_2754226_+	alkene reductase	NA	NA	NA	NA	NA
WP_075239156.1|2755116_2755407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408280.1|2755695_2756031_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011408279.1|2756145_2757195_+	cation transporter	NA	NA	NA	NA	NA
WP_011408277.1|2758866_2759340_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012445232.1|2759479_2760856_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011258635.1|2761045_2761231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181915.1|2761623_2762943_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182418.1|2764430_2764997_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011258631.1|2765187_2765454_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|2765628_2765883_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|2766043_2766217_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_041182081.1|2766618_2767146_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|2767614_2768715_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011258626.1|2768775_2771604_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011408270.1|2771759_2772935_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011408269.1|2773057_2773402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258624.1|2773631_2773958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408268.1|2774066_2775776_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011408267.1|2775873_2776464_+	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011258621.1|2776460_2776826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|2777162_2778185_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258619.1|2778181_2778415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408264.1|2778411_2780016_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011408263.1|2780012_2782514_+	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_014504008.1|2782503_2783148_+	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_003488188.1|2784658_2784865_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_011408258.1|2784951_2785704_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_011408257.1|2785789_2786344_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408256.1|2786343_2787348_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408255.1|2787465_2789043_-	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408254.1|2789223_2790258_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041182416.1|2790274_2790958_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408252.1|2791077_2792454_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_011257310.1|2792682_2793918_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258607.1|2794013_2794511_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011408251.1|2794685_2796020_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011408250.1|2796178_2796901_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011258604.1|2797049_2797772_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011258603.1|2797995_2798895_-	GTPase Era	NA	NA	NA	NA	NA
WP_011258602.1|2798891_2799572_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258601.1|2799561_2799939_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258600.1|2799969_2800770_-	signal peptidase I	NA	NA	NA	NA	NA
WP_041182078.1|2800876_2802667_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011408249.1|2802847_2804434_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
>prophage 24
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	2898422	2978366	4697691	tRNA,transposase	Bacillus_phage(18.18%)	53	NA	NA
WP_011258802.1|2898422_2899391_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408202.1|2900296_2901541_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|2901537_2901816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408200.1|2901893_2902295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|2902577_2902949_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_075243684.1|2902945_2903242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408198.1|2903413_2903716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258527.1|2903952_2905416_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|2905551_2907894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408196.1|2908173_2910015_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_113079198.1|2910064_2912596_-	type III secretion system effector protein XopK	NA	NA	NA	NA	NA
WP_113051296.1|2913213_2913414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408191.1|2913756_2914992_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258521.1|2915491_2916595_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408189.1|2916736_2918695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258519.1|2918719_2919451_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011258518.1|2919447_2920512_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011408185.1|2925133_2926216_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258513.1|2926227_2926851_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258512.1|2927101_2927578_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|2927611_2928814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113079163.1|2928821_2935763_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|2935876_2937913_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|2937952_2938483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258508.1|2938482_2938845_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|2938862_2939264_-	response regulator	NA	NA	NA	NA	NA
WP_044756943.1|2939513_2940464_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|2940460_2941336_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258505.1|2941630_2942545_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011408180.1|2942541_2943261_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011408179.1|2943274_2945302_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408178.1|2945501_2946026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959810.1|2946039_2948484_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|2948725_2950828_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_042465507.1|2951160_2952603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464698.1|2952920_2955107_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|2955396_2955477_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_011258497.1|2955560_2956460_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|2956456_2957209_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011408173.1|2957205_2957484_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408172.1|2957480_2958599_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|2958661_2959174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2959484_2960248_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182063.1|2960418_2961933_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_011408167.1|2963374_2966017_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959809.1|2966237_2970359_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|2970460_2971006_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959808.1|2971561_2973358_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408165.1|2973496_2973994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408164.1|2974072_2974477_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|2975107_2975782_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_069959795.1|2976160_2977537_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_094187715.1|2977603_2978366_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3040938	3188036	4697691	tRNA,transposase	Ralstonia_phage(19.23%)	117	NA	NA
WP_011258399.1|3040938_3043770_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408095.1|3043776_3044793_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_011408094.1|3044991_3046596_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_003484323.1|3046712_3046982_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011258396.1|3047073_3048126_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_011258395.1|3048358_3048619_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011258394.1|3048631_3048952_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012444462.1|3049244_3052211_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
WP_075242206.1|3052207_3052615_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258392.1|3052728_3053193_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_011408091.1|3053216_3053987_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011408090.1|3054057_3054963_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_011408089.1|3055190_3055694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408088.1|3055805_3056549_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_041182403.1|3056803_3057259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181906.1|3057403_3058202_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408086.1|3058244_3058826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464672.1|3058886_3059801_+	arginyltransferase	NA	NA	NA	NA	NA
WP_027703288.1|3059754_3061086_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011258382.1|3061390_3062992_-	membrane protein	NA	NA	NA	NA	NA
WP_027703287.1|3063437_3064514_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_011408082.1|3064609_3065083_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_011408081.1|3065318_3067754_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	22.5	2.6e-12
WP_027703286.1|3068302_3068851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182043.1|3069076_3069835_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_011408078.1|3069879_3071658_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_011258376.1|3071654_3073022_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_011258374.1|3073271_3073652_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_027703285.1|3073626_3074151_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_011258372.1|3074153_3074960_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_011408077.1|3074967_3075963_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_011258370.1|3076083_3076965_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_011408076.1|3077122_3078778_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.0	9.3e-94
WP_011408075.1|3079209_3079506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258368.1|3079825_3080701_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_011258367.1|3080725_3081895_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_011258366.1|3082128_3083742_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408074.1|3084072_3085464_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703281.1|3085536_3085743_+	DUF2559 family protein	NA	NA	NA	NA	NA
WP_011408072.1|3086322_3088056_-	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
WP_042464666.1|3088090_3089617_-	membrane protein	NA	NA	NA	NA	NA
WP_027703278.1|3089586_3090246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408069.1|3090226_3091816_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_011408068.1|3091950_3092376_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011408067.1|3092730_3093990_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011258358.1|3093996_3094860_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011258357.1|3094873_3095482_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_115801881.1|3095552_3096872_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158645227.1|3097432_3097735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182041.1|3097718_3098675_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
WP_011258802.1|3099366_3100335_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408064.1|3100504_3100873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168748.1|3102388_3102718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168747.1|3102714_3103014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|3103162_3104131_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_125168746.1|3104182_3104674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408063.1|3104670_3109161_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_109181904.1|3110458_3111778_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3111820_3112583_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258344.1|3112659_3114492_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_011258343.1|3114623_3115214_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011408060.1|3115279_3118336_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258341.1|3118332_3119436_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258340.1|3119461_3120298_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011408058.1|3120317_3121787_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408057.1|3121892_3122582_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408056.1|3122578_3123772_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011258336.1|3123830_3125096_-	potassium transporter	NA	NA	NA	NA	NA
WP_075241746.1|3125242_3126919_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258334.1|3126860_3127361_-	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_011408053.1|3130280_3131003_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011408052.1|3131152_3133549_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258329.1|3133812_3135717_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_113055161.1|3136393_3137056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|3137084_3137327_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|3137672_3138074_-	membrane protein	NA	NA	NA	NA	NA
WP_011258324.1|3138099_3138633_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258323.1|3139035_3139290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408047.1|3140750_3142214_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011408046.1|3142210_3142756_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011258802.1|3143106_3144075_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258317.1|3145605_3147051_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258316.1|3147123_3148164_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408042.1|3148296_3148479_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258314.1|3148778_3149189_-	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408040.1|3151836_3154218_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182034.1|3154461_3155418_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408038.1|3155469_3155880_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|3155978_3156704_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_012444398.1|3157120_3158539_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011408037.1|3158641_3160072_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|3160293_3160848_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|3161064_3163005_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011408036.1|3163180_3163819_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258301.1|3166052_3167228_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408033.1|3167373_3168165_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258299.1|3168310_3168526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053503314.1|3168525_3169293_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_053503313.1|3169354_3170185_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_053503312.1|3170257_3170686_+	cytochrome c	NA	NA	NA	NA	NA
WP_014503861.1|3170817_3171297_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_014503862.1|3171546_3171762_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_113079221.1|3171989_3172475_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|3174036_3174240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|3175017_3175476_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|3175881_3176388_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258289.1|3176401_3177805_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_069960180.1|3177873_3178977_-	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_075242217.1|3178998_3179730_-	nitrilase	NA	NA	NA	NA	NA
WP_011407237.1|3179803_3180760_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408021.1|3181058_3181646_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011408020.1|3181876_3182689_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408019.1|3182719_3183883_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408018.1|3184041_3184425_-	membrane protein	NA	NA	NA	NA	NA
WP_011408017.1|3184940_3185753_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408016.1|3185813_3186872_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408015.1|3186866_3188036_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
>prophage 26
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3413515	3487167	4697691	transposase	Xanthomonas_phage(36.36%)	48	NA	NA
WP_011257854.1|3413515_3414751_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3415172_3416561_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3417316_3418258_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3418571_3419336_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3419528_3420911_+	APC family permease	NA	NA	NA	NA	NA
WP_011407879.1|3421365_3422763_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011407877.1|3423325_3423724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3423868_3424873_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3424910_3426428_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_011407876.1|3426468_3427515_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|3427525_3428278_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407874.1|3428609_3431768_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407873.1|3432814_3434821_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3435040_3435487_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3437466_3438633_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3438634_3439207_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3439219_3439624_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_012445805.1|3439661_3440339_-	YjfK family protein	NA	NA	NA	NA	NA
WP_011407867.1|3440335_3441418_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3441443_3442217_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3442229_3442646_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3442826_3443426_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3443592_3444135_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011407865.1|3444131_3445244_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3445545_3445797_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011407863.1|3445811_3446876_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_011407860.1|3448347_3452064_+	avirulence protein	NA	NA	NA	NA	NA
WP_012445814.1|3452332_3452527_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	8.8e-20
WP_011408408.1|3452530_3452830_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|3457770_3457965_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011407858.1|3457968_3458268_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	1.4e-45
WP_115858607.1|3458491_3461500_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|3461718_3461895_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011258056.1|3461891_3462563_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011258055.1|3462584_3463454_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011407854.1|3463950_3467130_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407853.1|3467415_3468705_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3471951_3472401_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3473843_3474347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258050.1|3474371_3474797_-	cytochrome c	NA	NA	NA	NA	NA
WP_042464589.1|3474793_3476401_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011407842.1|3477937_3478555_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258048.1|3478799_3480026_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011258047.1|3480098_3480971_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3482231_3483030_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407839.1|3483110_3483770_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011407838.1|3483921_3486009_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_113081219.1|3486183_3487167_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
>prophage 27
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3491740	3554148	4697691	transposase	Planktothrix_phage(25.0%)	50	NA	NA
WP_115801876.1|3491740_3492706_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109181945.1|3492794_3493558_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3493945_3494947_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3495603_3495744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445839.1|3498817_3499591_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011258028.1|3499604_3500435_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3500505_3501282_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258026.1|3501292_3501985_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3501984_3502599_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3502941_3503526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407821.1|3503522_3504839_-	TonB family protein	NA	NA	NA	NA	NA
WP_011407820.1|3504828_3505194_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182938.1|3505293_3506655_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407818.1|3506672_3507371_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_011407815.1|3508037_3508877_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3508876_3509551_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_011407813.1|3509547_3511047_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069960293.1|3511043_3511691_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_042464577.1|3511866_3513825_+	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_011407810.1|3513959_3515135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464574.1|3515254_3517969_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407808.1|3518288_3519281_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011258009.1|3519283_3520000_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011258007.1|3520818_3522819_-	transketolase	NA	NA	NA	NA	NA
WP_041182384.1|3523038_3524268_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3524516_3524834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3525129_3526887_-	membrane protein	NA	NA	NA	NA	NA
WP_082325235.1|3526883_3528686_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|3528682_3529690_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|3529686_3530148_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3530150_3531113_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011258000.1|3531133_3532153_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115840164.1|3532775_3533810_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|3533880_3535116_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3535258_3536056_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3536127_3538077_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3538096_3538630_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3538626_3539292_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257994.1|3539288_3540047_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407795.1|3540046_3541105_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257992.1|3541320_3543750_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407794.1|3544059_3544710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407793.1|3545087_3546377_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3546590_3546833_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011257989.1|3546904_3547843_-	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011407792.1|3547968_3550122_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257987.1|3550142_3550523_-	RidA family protein	NA	NA	NA	NA	NA
WP_011257986.1|3550602_3552774_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011407791.1|3552902_3553202_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_099051298.1|3553349_3554148_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3574119	3645140	4697691	integrase,transposase	Bacillus_phage(22.22%)	58	3629994:3630009	3645054:3645069
WP_109182097.1|3574119_3575222_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011257960.1|3575950_3578260_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_011407775.1|3578457_3579831_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011407774.1|3580121_3581294_+	porin	NA	NA	NA	NA	NA
WP_011407773.1|3581615_3584261_+	response regulator	NA	B5LWN0	Feldmannia_species_virus	28.1	4.4e-13
WP_011407772.1|3584576_3585926_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.5e-62
WP_011257955.1|3585922_3586702_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011257953.1|3586693_3587596_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407771.1|3587904_3588543_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011257951.1|3588539_3589394_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011257949.1|3589594_3590233_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011407770.1|3590272_3591322_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011407769.1|3591321_3592707_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	8.3e-11
WP_011407768.1|3592699_3593401_-	response regulator	NA	NA	NA	NA	NA
WP_011407767.1|3593656_3594850_+	porin	NA	NA	NA	NA	NA
WP_011257945.1|3595077_3596406_+	CitMHS family transporter	NA	NA	NA	NA	NA
WP_011407766.1|3596517_3597258_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_011407765.1|3597498_3598530_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407764.1|3598770_3600102_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407763.1|3600371_3602816_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407762.1|3602850_3604767_+	amylosucrase	NA	NA	NA	NA	NA
WP_011407761.1|3604933_3605614_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011257938.1|3605766_3607029_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_011257937.1|3607028_3608120_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011257936.1|3608273_3609545_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011407760.1|3609544_3610183_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011407759.1|3610505_3611177_+	methyltransferase	NA	NA	NA	NA	NA
WP_011257933.1|3611478_3612255_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011257932.1|3612315_3613242_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_011407757.1|3613573_3613909_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|3613952_3615272_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075241901.1|3615353_3615704_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011258188.1|3616171_3617140_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257570.1|3617968_3619204_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407751.1|3620192_3621794_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|3622410_3623157_-	cellulase	NA	NA	NA	NA	NA
WP_103057268.1|3623629_3624388_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|3624904_3625420_-	peptide deformylase	NA	NA	NA	NA	NA
WP_012445908.1|3626935_3628804_-	membrane protein	NA	NA	NA	NA	NA
WP_011407746.1|3628842_3629796_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|3629801_3630758_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
3629994:3630009	attL	CTGCTCGCACTGCTGC	NA	NA	NA	NA
WP_011257916.1|3630750_3632703_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|3632699_3633233_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|3633352_3633703_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3633804_3634398_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|3634495_3634816_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257911.1|3634822_3636919_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257910.1|3637480_3637927_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|3637923_3638169_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|3638165_3638663_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|3638687_3639047_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011257906.1|3639064_3640096_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|3640095_3640845_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|3640844_3641594_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011407740.1|3641614_3642664_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|3642874_3643279_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407739.1|3643389_3644076_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_109182094.1|3644174_3645140_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
3645054:3645069	attR	CTGCTCGCACTGCTGC	NA	NA	NA	NA
>prophage 29
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3675682	3736317	4697691	transposase,protease	Bacillus_virus(12.5%)	39	NA	NA
WP_011257881.1|3675682_3676969_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|3677093_3677720_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|3677812_3679105_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|3682422_3683184_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|3683327_3684335_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_109181948.1|3684598_3685564_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182091.1|3685564_3686318_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|3688137_3688869_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182012.1|3688901_3689664_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257866.1|3689658_3689901_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|3690449_3690911_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257031.1|3691171_3692140_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_094187735.1|3694808_3695571_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|3695639_3697217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182121.1|3697518_3698484_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|3699546_3700470_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182089.1|3701215_3702535_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|3703517_3704753_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_012445986.1|3708312_3708453_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|3708584_3709433_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_011257570.1|3710046_3711282_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_115801872.1|3711796_3712899_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011407706.1|3713605_3714124_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011257842.1|3714652_3716776_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257841.1|3717023_3718406_+	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257840.1|3718506_3719634_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011407704.1|3720556_3721027_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257837.1|3721045_3722875_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011257836.1|3723119_3723614_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257835.1|3723729_3724716_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257834.1|3724798_3725413_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257831.1|3727394_3728279_-	membrane protein	NA	NA	NA	NA	NA
WP_027703752.1|3728425_3729022_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257829.1|3729021_3730380_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011257828.1|3730746_3731310_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257827.1|3731469_3732726_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_012446005.1|3734405_3734897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182120.1|3735181_3735355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|3735351_3736317_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3775038	3802644	4697691	transposase,protease	Acidithiobacillus_phage(11.11%)	21	NA	NA
WP_115840190.1|3775038_3776415_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
WP_011257788.1|3776525_3777308_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407682.1|3777501_3780174_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
WP_011407681.1|3780499_3781792_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_011257785.1|3782129_3782315_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011257784.1|3782608_3783472_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|3783471_3784599_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|3785228_3785615_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|3785854_3786754_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|3787164_3787641_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|3787803_3788286_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011257778.1|3788328_3788889_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011407678.1|3789022_3789985_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011407677.1|3790329_3791649_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407676.1|3791719_3792256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181973.1|3792759_3793707_-	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_042464512.1|3793881_3796869_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_103057250.1|3797848_3798031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407673.1|3798140_3799139_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011407672.1|3799217_3801434_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407671.1|3801675_3802644_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
>prophage 31
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3825700	3901049	4697691	tRNA,transposase	Ralstonia_phage(20.0%)	48	NA	NA
WP_069963827.1|3825700_3826666_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407656.1|3826777_3829069_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|3829196_3829871_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_011257745.1|3829867_3831712_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|3831708_3832575_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|3832594_3833227_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|3833229_3834264_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|3834278_3834569_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|3842604_3843444_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|3844054_3845212_+	phosphotransferase	NA	NA	NA	NA	NA
WP_011407649.1|3845247_3847410_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|3847785_3848361_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|3848466_3849195_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|3849611_3850451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|3850447_3852760_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011407647.1|3852756_3853566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|3853555_3854209_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407645.1|3854192_3855314_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3855310_3856162_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011257726.1|3856158_3856794_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_011257725.1|3856790_3857207_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|3857203_3857713_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3857722_3858154_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3858421_3859639_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_041181968.1|3859638_3859818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257721.1|3859814_3861497_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_011409190.1|3862377_3863334_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
WP_069959728.1|3864832_3868630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257719.1|3869607_3873660_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
WP_011257718.1|3874058_3874856_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|3875310_3876282_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|3876708_3877176_+	RDD family protein	NA	NA	NA	NA	NA
WP_011258579.1|3877607_3878576_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407635.1|3878750_3879857_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011407634.1|3879853_3880936_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011257713.1|3881043_3882516_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257712.1|3882515_3882821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257711.1|3882861_3883287_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011257710.1|3883494_3886437_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
WP_115801870.1|3887373_3888475_+|transposase	IS3-like element ISXo17 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	7.2e-42
WP_011257706.1|3888663_3888978_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_094187731.1|3889629_3890428_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257702.1|3892017_3893058_+	pectate lyase	NA	NA	NA	NA	NA
WP_027704044.1|3893324_3895298_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_109182081.1|3895602_3896922_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|3897071_3898040_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182080.1|3898252_3899572_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182079.1|3899729_3901049_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	3917944	3975919	4697691	transposase	Enterobacteria_phage(25.0%)	52	NA	NA
WP_113081224.1|3917944_3919291_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.5e-33
WP_011257680.1|3919337_3920741_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407615.1|3920857_3921766_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011407614.1|3921762_3922320_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407613.1|3922316_3923204_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3923259_3924315_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|3924540_3925287_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|3925286_3926228_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|3926450_3927269_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|3927258_3928572_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407609.1|3929101_3930286_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109182077.1|3930601_3931921_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257669.1|3932007_3933060_-	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
WP_011257668.1|3933065_3934229_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024744691.1|3934219_3934510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407606.1|3934530_3935457_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011407605.1|3936488_3937565_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
WP_011257666.1|3937599_3938400_-	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
WP_011257665.1|3938446_3939640_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_011407603.1|3939730_3941101_-	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
WP_003484103.1|3941342_3941561_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257662.1|3941902_3942793_-	membrane protein	NA	NA	NA	NA	NA
WP_011407602.1|3942789_3943173_-	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_011407601.1|3943271_3944405_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_042464484.1|3944743_3945370_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011257658.1|3945413_3946403_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_019301777.1|3946564_3946690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407600.1|3946782_3948165_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
WP_027703598.1|3948577_3948931_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011407598.1|3949123_3949459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407597.1|3949573_3950248_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_011407596.1|3950572_3951055_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011257653.1|3951051_3951450_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011407595.1|3951761_3952412_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011407594.1|3952553_3953633_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011407593.1|3953978_3954494_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_011257649.1|3954493_3955702_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_041181965.1|3955815_3956637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407591.1|3956810_3958835_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_011407590.1|3958878_3959982_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_011257645.1|3960117_3960534_+	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_103057232.1|3960620_3962468_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_011257643.1|3962464_3963571_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_011258803.1|3963746_3964715_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011407588.1|3964887_3965412_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011407587.1|3965628_3966663_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_094187804.1|3966778_3967542_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257639.1|3967574_3968150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257638.1|3968381_3968855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407585.1|3969236_3971066_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
WP_011407584.1|3971273_3972545_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_115840163.1|3974953_3975919_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	4064845	4128599	4697691	integrase,tRNA,transposase	Staphylococcus_phage(25.0%)	53	4050707:4050723	4090252:4090268
4050707:4050723	attL	ACATGCGCGAAATGGGC	NA	NA	NA	NA
WP_094187728.1|4064845_4065643_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075239431.1|4067287_4067602_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011257535.1|4067611_4067833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257534.1|4068253_4068466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443985.1|4068804_4069542_+	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011407521.1|4069552_4072210_+	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|4072206_4072881_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011407520.1|4072877_4073543_+	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|4073627_4075769_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407518.1|4075858_4077127_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_027703875.1|4077126_4078563_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407516.1|4078573_4079296_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_109181928.1|4080534_4081500_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|4081822_4082212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407512.1|4082280_4083516_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407508.1|4085451_4085697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|4085693_4085966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257520.1|4085962_4086169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|4086302_4087577_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_011407506.1|4088205_4088526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4088718_4090593_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
4090252:4090268	attR	GCCCATTTCGCGCATGT	NA	NA	NA	NA
WP_011257505.1|4090701_4091142_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407504.1|4091242_4092157_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4092356_4092878_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4093120_4094254_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_042465436.1|4094363_4094867_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257500.1|4094863_4096330_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011407501.1|4096495_4097551_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257498.1|4097554_4098379_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257497.1|4098576_4099854_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257496.1|4100018_4101740_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4101790_4103104_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4103103_4104027_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011257493.1|4104420_4104933_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4105065_4106202_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4106273_4107416_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4107458_4107932_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4107972_4108695_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257488.1|4108736_4110011_+	RDD family protein	NA	NA	NA	NA	NA
WP_011257487.1|4110193_4112686_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4112696_4113260_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4113483_4114257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407496.1|4114253_4114928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|4115089_4115866_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4115972_4116188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407494.1|4116373_4118275_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011407493.1|4118359_4119736_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_069959708.1|4120254_4121199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959707.1|4121529_4122132_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_103057279.1|4122115_4123141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407490.1|4123609_4125832_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4126234_4126750_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_115840162.1|4127279_4128599_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	4286080	4342944	4697691	tRNA,transposase	Tupanvirus(16.67%)	44	NA	NA
WP_011257354.1|4286080_4287085_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012446316.1|4287548_4287773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4288493_4289069_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011257350.1|4289127_4290651_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_011407401.1|4291341_4291812_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042464383.1|4291773_4291962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840188.1|4291974_4292940_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407399.1|4293022_4293289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257345.1|4293562_4295695_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4295972_4296122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407398.1|4296156_4296543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4296544_4297396_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011407397.1|4297448_4298330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464379.1|4298986_4301521_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407395.1|4301754_4302507_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4302634_4303549_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407393.1|4304821_4305814_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011257333.1|4306478_4306937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181932.1|4307036_4308827_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_011257331.1|4309035_4311273_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4311697_4312387_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_109181945.1|4312655_4313419_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407389.1|4313592_4316607_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4316790_4317492_+	SapC family protein	NA	NA	NA	NA	NA
WP_011257326.1|4317481_4318495_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041181930.1|4318505_4320071_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011407386.1|4320210_4321233_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011407385.1|4321642_4322836_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4322832_4323579_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407383.1|4323610_4325212_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4325272_4325473_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042465424.1|4325469_4326057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4326260_4326422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4326542_4326815_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011407379.1|4326880_4327882_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_075242284.1|4327966_4328794_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4328830_4329826_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_012446343.1|4329843_4330635_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080493948.1|4330598_4331387_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_042465421.1|4331505_4332444_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_042464374.1|4334237_4335344_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|4336404_4337370_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187782.1|4341323_4342086_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182066.1|4342146_4342944_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	4351790	4419967	4697691	holin,tRNA,transposase	Ralstonia_phage(22.22%)	43	NA	NA
WP_011257289.1|4351790_4352222_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011257288.1|4352224_4352854_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_042464365.1|4353491_4355660_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407357.1|4355786_4357949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182027.1|4358775_4359741_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257284.1|4359933_4361415_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_011257283.1|4361851_4362211_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4362213_4363515_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4363695_4364472_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407353.1|4364948_4365533_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011257279.1|4365725_4369175_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407351.1|4369922_4372565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407350.1|4372668_4375068_-	NdvB protein	NA	NA	NA	NA	NA
WP_011407349.1|4375070_4376453_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4376610_4377195_+	gluconokinase	NA	NA	NA	NA	NA
WP_109182012.1|4377247_4378011_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407346.1|4378889_4380644_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_011257273.1|4380951_4381179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|4381159_4381609_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4381619_4382048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407798.1|4383445_4384681_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_109182063.1|4384842_4385674_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|4385733_4386948_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182062.1|4387079_4387877_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4388455_4389424_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407336.1|4389911_4390868_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182061.1|4391712_4392678_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703982.1|4392695_4393253_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4393271_4393559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4393943_4394738_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4394737_4395487_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4395498_4396050_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4396046_4396709_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_011257254.1|4396698_4396989_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4396999_4398058_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_109182012.1|4399856_4400620_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182297.1|4400724_4401687_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011407325.1|4402033_4402849_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_011257245.1|4412167_4414072_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4414068_4414671_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011407318.1|4414730_4416035_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011257243.1|4416582_4418745_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011258802.1|4418998_4419967_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 36
NZ_CP031458	Xanthomonas oryzae pv. oryzae strain JL28 chromosome, complete genome	4697691	4475777	4619632	4697691	tRNA,transposase	Ralstonia_phage(35.29%)	98	NA	NA
WP_011257198.1|4475777_4477682_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_011257197.1|4478215_4479904_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257196.1|4479900_4482102_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_041181914.1|4482163_4482427_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
WP_011257195.1|4482423_4484115_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_041182356.1|4484111_4486265_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
WP_113081221.1|4486332_4489056_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	5.3e-70
WP_011407283.1|4489460_4490837_-|transposase	IS5-like element ISXoo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	7.8e-78
WP_011257191.1|4491402_4493289_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_011257190.1|4493526_4494384_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_011257189.1|4494800_4495412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257188.1|4495604_4496417_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011407279.1|4497336_4499322_-	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011257186.1|4499934_4500273_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011257185.1|4500462_4500741_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257184.1|4500757_4502278_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011407278.1|4502434_4503754_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407268.1|4510898_4514015_+	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407267.1|4514011_4517362_+	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_042464354.1|4517373_4519557_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407264.1|4520379_4520907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057315.1|4520882_4520978_+	xylosidase	NA	NA	NA	NA	NA
WP_011407263.1|4521151_4522180_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_082325201.1|4523581_4524964_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
WP_094187801.1|4525202_4526000_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257163.1|4528561_4530043_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011257162.1|4530237_4534710_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257161.1|4534911_4535292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464345.1|4535348_4536602_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.9e-38
WP_011407253.1|4536903_4537209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465397.1|4538308_4539499_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011257157.1|4539812_4540598_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_042464342.1|4540608_4543197_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407249.1|4543369_4544527_+	ROK family protein	NA	NA	NA	NA	NA
WP_011407248.1|4544717_4546862_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464339.1|4547350_4549177_-	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407245.1|4549173_4551669_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_011407244.1|4551846_4552509_+	hemolysin III	NA	NA	NA	NA	NA
WP_011407243.1|4552575_4552806_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075239626.1|4552829_4553231_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_027703668.1|4553683_4553935_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011257146.1|4555810_4557121_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257145.1|4557133_4558291_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011407239.1|4558303_4558993_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
WP_011407238.1|4560216_4561464_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756192.1|4561655_4562126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|4562100_4563057_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257041.1|4563858_4564257_-	host attachment protein	NA	NA	NA	NA	NA
WP_011257042.1|4564348_4565041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|4565210_4565681_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011407233.1|4567147_4567459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407232.1|4567713_4568661_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407231.1|4568801_4569860_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|4569998_4570280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|4570332_4570593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|4570660_4570870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407229.1|4570983_4571934_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_011257052.1|4572640_4573528_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011257053.1|4573833_4574151_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011407227.1|4574610_4575462_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011407226.1|4575703_4577140_+	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407225.1|4577256_4577619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|4577622_4578108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|4578104_4578488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257061.1|4579045_4580674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181898.1|4581549_4583958_-	serine kinase	NA	NA	NA	NA	NA
WP_011407219.1|4584679_4585663_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_115840160.1|4585851_4587171_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|4587383_4588352_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407217.1|4590052_4590499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257071.1|4590495_4592481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257072.1|4592895_4593366_-	protein HpaB	NA	NA	NA	NA	NA
WP_011257073.1|4593420_4593702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257074.1|4593782_4594025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257075.1|4594034_4594973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257076.1|4594969_4595797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257077.1|4595793_4596054_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_011407215.1|4596058_4596703_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_042464329.1|4596689_4597643_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_042464327.1|4597735_4598377_-	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_011257081.1|4598376_4600314_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_011407212.1|4600307_4601387_-	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_011257083.1|4601601_4602057_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407211.1|4602090_4602483_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_011257085.1|4602484_4603246_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_011257086.1|4603253_4603883_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_011257087.1|4603867_4604569_+	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_011257088.1|4604558_4605887_+	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_011257089.1|4605879_4606389_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_011257090.1|4606385_4607216_+	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_011257091.1|4607298_4609116_+	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_011257092.1|4609854_4610274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257093.1|4610649_4611213_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	4.4e-11
WP_011257094.1|4611676_4613230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|4615446_4615788_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_041182843.1|4615972_4618531_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|4618549_4618810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|4618869_4619632_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
