The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	496091	561573	4599824	protease,tRNA,transposase	Acinetobacter_phage(10.0%)	55	NA	NA
WP_000169527.1|496091_496391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|496387_497254_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_047281862.1|497266_497509_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001286216.1|497484_498039_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000078349.1|504080_504839_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001300681.1|504846_505950_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|505959_507141_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000825639.1|508663_508885_-	membrane protein	NA	NA	NA	NA	NA
WP_001273238.1|509137_512242_-	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_000160334.1|512253_513411_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_001129518.1|513809_514472_+	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_001295275.1|514474_514654_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001258895.1|514737_515622_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
WP_000462905.1|515707_516004_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001219652.1|516029_516995_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_001145827.1|517323_518205_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001175728.1|518216_519668_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_000381173.1|519657_519900_-	YhdT family protein	NA	NA	NA	NA	NA
WP_000884639.1|520008_521358_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000354622.1|521368_521839_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_001148481.1|522816_523791_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001241469.1|523942_525883_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_000913396.1|526187_527231_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_000802511.1|527296_528400_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000179409.1|528399_528888_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000203105.1|528896_529490_+	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000123197.1|529479_530949_+	ribonuclease G	NA	NA	NA	NA	NA
WP_001253618.1|531016_534817_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000055909.1|535246_536692_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_000440317.1|536825_537755_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000051841.1|537937_538141_+	AaeX family protein	NA	NA	NA	NA	NA
WP_000854021.1|538148_539081_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000510965.1|539086_541054_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_001029013.1|541145_541418_+	barnase inhibitor	NA	NA	NA	NA	NA
WP_000695690.1|541473_541737_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001257846.1|542101_542572_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_001295272.1|543006_543945_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000497723.1|544007_545075_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|545164_546532_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_001295270.1|546685_547084_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001192332.1|547277_548405_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_000847559.1|548623_549052_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|549067_549460_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000257293.1|549854_550493_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000366129.1|550498_550996_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000467018.1|551038_552406_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000523845.1|552785_553577_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|553698_554592_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108454.1|554700_556191_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	6.4e-09
WP_000054239.1|556238_556928_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209011.1|556924_557800_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|557796_558261_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445111.1|558320_559448_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_001067008.1|559632_560349_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_010723085.1|560556_561573_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 2
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	1063818	1070957	4599824		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1063818_1064457_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1064548_1065715_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1065711_1066620_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001272547.1|1066785_1067583_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141337.1|1067633_1068290_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1068395_1070957_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	1444749	1457220	4599824	tail,integrase,transposase	Enterobacteria_phage(43.75%)	18	1441059:1441075	1459230:1459246
1441059:1441075	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1444749_1444950_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1445081_1445387_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1445386_1445749_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1445739_1446276_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1446403_1447228_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1447293_1447656_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|1448013_1448382_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|1448378_1448873_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1448872_1449148_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1449197_1449716_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1449742_1450183_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1450481_1450763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1450797_1452129_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000878218.1|1452992_1453859_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|1453855_1454155_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000915541.1|1454303_1454666_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1454818_1455976_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|1456287_1457220_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1459230:1459246	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	2273853	2293064	4599824	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2273853_2274009_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2274175_2274583_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2274666_2274897_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2275193_2275343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2275779_2276112_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2276314_2276620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2276644_2276884_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2276883_2277171_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2277242_2277398_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2277614_2277866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2277932_2278211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2278212_2279262_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2279275_2280028_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2280305_2280395_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2280449_2280662_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2280962_2281178_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2281931_2282147_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2282151_2282463_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2282459_2282993_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2282989_2283487_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2283849_2284062_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2284072_2284261_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2284263_2284329_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2284407_2284563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2284734_2284908_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2285059_2285470_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2285527_2285761_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|2286149_2286719_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|2286669_2287632_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2287631_2288207_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2288304_2288895_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2289211_2289445_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2289513_2289627_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2290231_2291515_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|2291603_2293064_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	2417648	2515951	4599824	lysis,integrase,tail,tRNA,transposase	Escherichia_phage(41.67%)	85	2494899:2494917	2525274:2525292
WP_000826416.1|2417648_2418857_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2419388_2420057_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2420358_2420952_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|2420948_2421941_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|2422064_2423045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|2423036_2423576_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2423638_2423863_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|2424002_2425658_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|2425882_2427226_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2427442_2428366_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|2428403_2430044_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2430442_2430592_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2430663_2430837_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2431081_2431612_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|2432842_2434282_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2434478_2435279_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|2435550_2439453_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|2439653_2440259_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|2440312_2441629_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|2441618_2443376_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890941.1|2443391_2444288_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177515.1|2444287_2444893_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000910026.1|2445063_2447370_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2447432_2448293_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_032313496.1|2448500_2450912_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|2452004_2453156_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|2453319_2454592_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|2457283_2457349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2457452_2458043_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2458024_2458975_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2459075_2460389_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2460415_2461621_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2461620_2462043_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2462032_2463460_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2463461_2464250_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2464249_2465017_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2465013_2466084_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2466091_2466589_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2466603_2467350_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2467358_2467646_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2467657_2468587_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2468871_2470917_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2471164_2473438_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2473495_2474995_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2475230_2476136_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2476307_2476634_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2476641_2476827_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2476823_2479463_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2479670_2480660_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2480770_2481193_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2481189_2481456_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2481729_2485254_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2485620_2486754_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2486894_2487329_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2488107_2488221_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2488289_2488523_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|2488839_2489430_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2489527_2490103_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|2490102_2493465_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|2493787_2494768_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2494899:2494917	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|2496533_2496893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2496873_2497137_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|2497274_2498732_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2498928_2499114_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2499201_2499762_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2499784_2500531_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2500537_2501395_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2501407_2501830_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2501852_2502149_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2502272_2502749_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|2503202_2503358_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2503354_2503843_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2504284_2504506_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2504505_2504676_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2504750_2505026_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2505127_2507728_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2507720_2508530_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2508586_2508781_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2508773_2508983_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2509061_2509277_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2509278_2510514_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2510565_2511501_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2511629_2513003_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2513480_2514464_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2514718_2515951_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2525274:2525292	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	2707255	2721636	4599824	tail,portal,integrase,plate	Escherichia_phage(26.32%)	25	2704631:2704644	2722662:2722675
2704631:2704644	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|2707255_2707987_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2708207_2708612_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|2708664_2708775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|2709311_2709635_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|2709737_2709902_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|2710135_2710969_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|2711075_2711630_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|2711701_2712196_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|2712195_2712798_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|2712769_2713183_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|2713184_2713814_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|2713817_2714402_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2714392_2715184_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2715110_2715584_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2715583_2715766_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2715777_2717145_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2717134_2717314_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2717489_2718047_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|2718090_2718291_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2718381_2719056_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2719230_2719539_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2719476_2719818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2719934_2720246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2720282_2720528_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2720508_2721636_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2722662:2722675	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	3312318	3356681	4599824	terminase,lysis,integrase,transposase,protease	Enterobacteria_phage(56.0%)	49	3335393:3335439	3356695:3356741
WP_001300563.1|3312318_3313431_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3313507_3313660_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|3314112_3315231_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3315296_3315545_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3315609_3315978_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3316071_3316725_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3316832_3318080_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|3318160_3319537_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3319638_3322782_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3322793_3324017_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3324032_3324365_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3324522_3325896_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3326052_3326736_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3326725_3328168_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3328317_3330555_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3330541_3333514_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3333514_3334405_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3334587_3335349_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3335393:3335439	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3335862_3336816_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3337065_3337815_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|3338717_3339344_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001027248.1|3339398_3340142_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|3340116_3340662_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|3341050_3341245_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3341409_3341616_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3341901_3342312_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3342602_3342896_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3342986_3343169_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3343385_3343883_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3343882_3344098_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3344670_3345738_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3345742_3346759_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3347156_3347540_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3347625_3347766_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3347762_3348125_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3348121_3348412_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3348404_3348575_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3348574_3349030_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3349026_3349128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3349244_3350042_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3350051_3350603_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3351067_3352594_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3352651_3352801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3352848_3353181_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000878218.1|3353491_3354358_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|3354354_3354654_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000145909.1|3354716_3354812_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3355134_3355398_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3355517_3356681_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3356695:3356741	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP031214	Escherichia coli strain C600 chromosome, complete genome	4599824	3528594	3581502	4599824	transposase	Shigella_phage(11.76%)	49	NA	NA
WP_000169527.1|3528594_3528894_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|3528890_3529757_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000556438.1|3529784_3531245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295337.1|3531768_3532743_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004027.1|3532849_3533701_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114620.1|3533697_3534525_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939375.1|3534521_3535289_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_001018417.1|3535301_3536264_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362028.1|3536879_3537437_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_120795375.1|3537416_3537536_-	protein YkiC	NA	NA	NA	NA	NA
WP_000860444.1|3537560_3538757_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085947917.1|3538916_3540190_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000012218.1|3540208_3540652_+	transferase	NA	NA	NA	NA	NA
WP_000596084.1|3540653_3541427_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|3541614_3541890_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842106.1|3541924_3543034_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_000419081.1|3543127_3543961_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096705.1|3544184_3544724_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000107627.1|3544825_3546037_-	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001013499.1|3546614_3547628_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3547624_3548575_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_000160710.1|3548571_3549381_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000121907.1|3549390_3550257_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|3550274_3551219_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001007407.1|3551220_3552885_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_001310587.1|3552961_3553909_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|3553985_3555068_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|3555190_3558265_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000749863.1|3560184_3561240_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3561527_3562631_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|3562642_3563896_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854672.1|3564467_3564809_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|3564829_3565147_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|3565165_3565387_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|3565395_3565872_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|3565887_3566346_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|3566443_3566683_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|3566759_3567227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|3567249_3567693_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|3567692_3567920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|3568323_3569145_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|3569236_3570100_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|3570428_3571322_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|3571742_3572894_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|3575240_3576257_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|3576464_3577868_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|3577854_3578787_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|3578895_3579942_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|3581163_3581502_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
