The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031368	Klebsiella pneumoniae strain KpvST101_OXA-48 chromosome, complete genome	5453528	779837	790724	5453528		Escherichia_phage(87.5%)	9	NA	NA
WP_032419001.1|779837_782945_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_032419002.1|782999_784265_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|784295_785384_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|785470_785731_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|786028_786889_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_140587718.1|786909_787671_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	9.4e-134
WP_002903955.1|787931_788834_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|788845_790111_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|790103_790724_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP031368	Klebsiella pneumoniae strain KpvST101_OXA-48 chromosome, complete genome	5453528	1499784	1509258	5453528	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023158537.1|1499784_1501506_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|1501550_1502252_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1502605_1502824_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_117008244.1|1502954_1505234_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.8e-165
WP_002896520.1|1505264_1505582_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1505907_1506129_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_117008243.1|1506205_1508146_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1508142_1509258_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 3
NZ_CP031368	Klebsiella pneumoniae strain KpvST101_OXA-48 chromosome, complete genome	5453528	2019027	2066174	5453528	tRNA,terminase,holin,head,integrase	Cronobacter_phage(25.0%)	70	2015981:2016026	2063246:2063291
2015981:2016026	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_032419291.1|2019027_2021505_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.6e-196
WP_032419292.1|2021491_2021887_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	3.6e-36
WP_032419293.1|2021883_2022354_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_117008211.1|2022353_2022773_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	2.6e-29
WP_074513099.1|2022942_2023113_+	ATP-NAD kinase	NA	NA	NA	NA	NA
WP_029884074.1|2023321_2023564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074513100.1|2023563_2026176_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	33.8	2.7e-79
WP_032415940.1|2026232_2026748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342743.1|2026822_2027035_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
WP_032426232.1|2027114_2027474_-	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	54.2	6.8e-34
WP_074513101.1|2027607_2028582_-	hypothetical protein	NA	A0A0M4REH5	Salmonella_phage	79.0	1.3e-79
WP_074513112.1|2028649_2028811_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_074513102.1|2028889_2029141_+	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	67.9	9.0e-25
WP_074513103.1|2029143_2029551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074513104.1|2029566_2029746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074513105.1|2029903_2030461_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	86.4	1.6e-85
WP_074513106.1|2030677_2031391_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.2e-63
WP_023339086.1|2032282_2032666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546891.1|2032662_2033031_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	2.9e-48
WP_073546892.1|2033082_2033637_-	hypothetical protein	NA	A0A2I7S010	Vibrio_phage	39.7	4.3e-35
WP_040229587.1|2033734_2034097_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	52.5	4.3e-28
WP_048336937.1|2034096_2034270_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
WP_004191534.1|2034269_2034650_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
WP_032419306.1|2034652_2034946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178847.1|2034955_2036053_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_012967726.1|2036064_2036496_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	6.2e-42
WP_047680688.1|2036499_2037885_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.2	2.7e-155
WP_047680685.1|2037897_2038080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077269087.1|2038144_2038759_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	43.9	1.6e-30
WP_073546894.1|2038831_2039836_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.0	1.8e-108
WP_032419309.1|2039762_2041232_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	1.2e-148
WP_032419310.1|2041244_2042717_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	6.9e-250
WP_032419311.1|2042716_2043319_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.7	3.1e-79
WP_032419312.1|2043756_2044107_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	7.6e-14
WP_032419505.1|2044103_2044601_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.0	4.8e-78
WP_012542609.1|2044578_2044848_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_032419313.1|2045067_2045607_-	HNH endonuclease	NA	A5PJ37	Escherichia_virus	46.1	2.1e-34
WP_060578954.1|2046045_2046735_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.0e-57
WP_060578953.1|2046731_2046872_-	YlcG family protein	NA	NA	NA	NA	NA
WP_060578952.1|2046868_2047510_-	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	8.4e-35
WP_060578951.1|2047506_2048145_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	65.1	2.8e-70
WP_023342724.1|2048137_2048308_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_064147790.1|2048307_2048763_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	1.5e-54
WP_140587755.1|2049079_2049295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267114.1|2049287_2049746_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	91.5	2.5e-28
WP_023339691.1|2050212_2050401_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_064147793.1|2050861_2051107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267115.1|2051103_2051550_-	hypothetical protein	NA	K7P858	Enterobacteria_phage	42.8	4.1e-20
WP_012542626.1|2051552_2051846_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_117008209.1|2051845_2053276_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.2	9.0e-186
WP_117008208.1|2053265_2054165_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.5	2.7e-87
WP_004139615.1|2054389_2054611_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_032431544.1|2054651_2054879_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
WP_032431543.1|2054947_2055670_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	62.8	4.7e-74
WP_020804196.1|2055692_2055812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|2056350_2056557_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_060568332.1|2056638_2056923_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	3.3e-39
WP_060578943.1|2056932_2057847_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	91.4	1.0e-158
WP_064147796.1|2057843_2058326_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	92.5	3.1e-74
WP_055316540.1|2058360_2058666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_055316537.1|2058662_2059319_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	2.7e-113
WP_032419331.1|2060665_2060938_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
WP_032419332.1|2060934_2061639_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
WP_040182114.1|2061635_2061854_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_072032585.1|2061855_2062191_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021441323.1|2062067_2063231_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_072032583.1|2063300_2063624_-	hypothetical protein	NA	NA	NA	NA	NA
2063246:2063291	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143017.1|2063662_2064529_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|2064530_2064743_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|2064788_2066174_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 4
NZ_CP031368	Klebsiella pneumoniae strain KpvST101_OXA-48 chromosome, complete genome	5453528	4715063	4760605	5453528	holin,integrase,terminase,tail	Salmonella_phage(45.45%)	56	4707469:4707484	4759121:4759136
4707469:4707484	attL	GCTGGCTGGAGAGAAA	NA	NA	NA	NA
WP_032418525.1|4715063_4716530_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
WP_004151979.1|4716597_4718175_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032418526.1|4718366_4719620_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
WP_032418527.1|4719881_4720544_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
WP_032418529.1|4720540_4721143_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
WP_023285452.1|4721139_4721646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009485474.1|4721642_4721801_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
WP_009485475.1|4721793_4722087_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|4722196_4722445_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_032418530.1|4722495_4723518_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
WP_004144292.1|4723527_4724427_-	endonuclease	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
WP_004164029.1|4724423_4724723_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|4725089_4725671_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|4725825_4726059_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_136409359.1|4726205_4726415_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	76.8	2.0e-25
WP_004207253.1|4726414_4727182_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|4727178_4727964_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_032418534.1|4728083_4728431_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
WP_032419436.1|4728623_4729025_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
WP_025860565.1|4729096_4729306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418536.1|4729302_4729557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419437.1|4729556_4729820_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
WP_032418538.1|4730513_4730753_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_032418539.1|4730752_4731091_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
WP_032418540.1|4731165_4731423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418541.1|4731500_4732085_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
WP_032418542.1|4732081_4733557_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	2.4e-279
WP_032413826.1|4733599_4733971_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
WP_071890493.1|4734021_4734222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004225268.1|4734558_4734747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|4734768_4734972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|4734975_4736655_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|4736651_4736957_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|4737238_4737637_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|4737649_4738657_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|4738666_4739059_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|4739051_4739330_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|4739378_4739990_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_032418543.1|4739989_4742467_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
WP_032418545.1|4742468_4742939_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
WP_025860587.1|4742931_4743429_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
WP_032418548.1|4743441_4746186_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	39.7	3.9e-97
WP_032418549.1|4746185_4749575_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	2.4e-120
WP_025368005.1|4749584_4750199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071844733.1|4750234_4750387_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
WP_032418553.1|4750816_4751005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140587822.1|4751156_4751801_-	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	58.9	4.3e-71
WP_057193984.1|4752318_4753170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409245.1|4753383_4753680_-	hypothetical protein	NA	T1SA06	Salmonella_phage	62.7	1.2e-23
WP_140587824.1|4754777_4756295_+	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	34.9	1.6e-15
WP_032418557.1|4756349_4756625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418558.1|4756737_4757142_+	membrane protein	NA	T1SA79	Salmonella_phage	82.6	2.1e-55
WP_032418559.1|4757128_4757434_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	4.6e-39
WP_032418560.1|4757423_4758053_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	1.5e-92
WP_032418561.1|4758049_4758550_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	90.0	1.1e-69
WP_009309501.1|4758736_4760605_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
4759121:4759136	attR	TTTCTCTCCAGCCAGC	NA	NA	NA	NA
>prophage 5
NZ_CP031368	Klebsiella pneumoniae strain KpvST101_OXA-48 chromosome, complete genome	5453528	5294571	5428639	5453528	protease,plate,terminase,holin,tRNA,tail,head,portal,integrase,capsid	Enterobacteria_phage(22.58%)	151	5347334:5347352	5385081:5385099
WP_000059623.1|5294571_5295834_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.8e-74
WP_002911729.1|5296401_5297319_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_032418726.1|5297425_5298376_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_064147810.1|5298454_5299396_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004141160.1|5299774_5300695_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911718.1|5300835_5301225_+	RidA family protein	NA	NA	NA	NA	NA
WP_002911599.1|5301890_5302688_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_004184758.1|5302983_5303976_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_032418728.1|5303977_5304205_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
WP_077261142.1|5304237_5304516_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	44.9	6.7e-13
WP_050598702.1|5304512_5305421_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.6	9.8e-45
WP_055314381.1|5305413_5306490_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.1e-147
WP_032418730.1|5306617_5307403_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
WP_032418731.1|5307402_5307702_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
WP_032418732.1|5307789_5308707_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
WP_032408726.1|5309153_5309801_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|5309905_5310103_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|5310128_5310590_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|5310827_5311007_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_032418734.1|5310996_5311965_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
WP_032418735.1|5312170_5312995_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
WP_032418736.1|5313004_5313382_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
WP_032418737.1|5313394_5314375_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
WP_032418738.1|5314388_5314967_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
WP_032418739.1|5315118_5315358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057182115.1|5315528_5315828_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
WP_032418741.1|5315824_5316364_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
WP_032418742.1|5316360_5316708_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_032418743.1|5316704_5316980_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	70.3	3.9e-05
WP_032418744.1|5316930_5317125_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
WP_022065473.1|5317482_5317728_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_032419453.1|5318239_5318590_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_004884285.1|5318721_5319216_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_032418747.1|5319212_5320943_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_021313630.1|5320952_5321138_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
WP_004899640.1|5321137_5322367_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_004884313.1|5322353_5323007_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_021313628.1|5323021_5324230_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_077254151.1|5324256_5324472_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.9e-07
WP_021313626.1|5324468_5324789_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_032408655.1|5324797_5325136_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_019705270.1|5325132_5325582_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_140587838.1|5325578_5325926_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	3.6e-32
WP_021313623.1|5325982_5326687_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_029497345.1|5326717_5327122_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
WP_032418748.1|5327124_5327430_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
WP_016530182.1|5327503_5327737_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032418749.1|5327797_5331184_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
WP_023301979.1|5331204_5331678_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_021313618.1|5331664_5332150_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
WP_021313617.1|5332159_5332540_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_032418750.1|5332536_5335620_+	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
WP_032419560.1|5337943_5338234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124036758.1|5338444_5340181_-	hypothetical protein	NA	A0A2H5BNQ4	Klebsiella_phage	76.7	7.1e-262
WP_032418751.1|5340304_5340883_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
WP_004892499.1|5340933_5341356_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_004216505.1|5341767_5342007_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	7.5e-21
WP_032418752.1|5342009_5342336_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	1.6e-26
WP_002911596.1|5342939_5344085_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004148893.1|5344476_5344743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|5344623_5344905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|5344947_5345655_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_032418753.1|5345698_5347132_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.7	2.0e-100
WP_032419454.1|5347112_5347607_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	9.7e-31
5347334:5347352	attL	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_004184683.1|5347581_5348493_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_136409390.1|5348676_5349588_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032418754.1|5349702_5351382_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	3.1e-20
WP_004151458.1|5351681_5351906_-	YodD family protein	NA	NA	NA	NA	NA
WP_004141144.1|5352030_5352228_+	protein DsrB	NA	NA	NA	NA	NA
WP_002911561.1|5352260_5352884_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_004175397.1|5353259_5353691_+	lipoprotein	NA	NA	NA	NA	NA
WP_004189225.1|5353732_5355220_-	alpha-amylase	NA	NA	NA	NA	NA
WP_004141135.1|5355420_5356221_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004180445.1|5356316_5357303_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_002911547.1|5357318_5357987_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_004151455.1|5357983_5358736_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
WP_002911542.1|5359053_5359776_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_002911541.1|5359843_5360068_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_002911539.1|5360529_5361186_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_002911538.1|5361182_5363015_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002911537.1|5363072_5363621_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032418755.1|5364194_5365202_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
WP_050598706.1|5365198_5366065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418756.1|5366081_5366711_-	membrane protein	NA	NA	NA	NA	NA
WP_077261143.1|5366720_5367149_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	38.5	1.0e-07
WP_032418759.1|5367421_5367625_+	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	6.4e-05
WP_050598721.1|5367847_5368045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418760.1|5368061_5368460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418761.1|5368469_5368742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418762.1|5368810_5369035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418763.1|5369031_5369610_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	3.2e-33
WP_032418764.1|5369618_5369846_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.0	5.5e-05
WP_032418765.1|5369842_5370037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418766.1|5370029_5370983_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.3	3.6e-82
WP_032418767.1|5371297_5372314_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.1	1.9e-97
WP_032418768.1|5372306_5374901_+	replication protein	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.2e-196
WP_032418769.1|5375097_5376099_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_032418771.1|5376833_5377880_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	5.8e-142
WP_032418772.1|5377879_5379601_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	6.2e-226
WP_032418773.1|5379761_5380595_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
WP_032418774.1|5380619_5381669_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	5.7e-105
WP_032418775.1|5381716_5382616_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.5e-87
WP_032418776.1|5382718_5383216_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.2e-60
WP_032418777.1|5383215_5383416_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	6.7e-15
WP_032418778.1|5383406_5383688_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.1e-18
WP_032418779.1|5383684_5384236_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	9.2e-30
WP_050598707.1|5384232_5384628_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032418780.1|5384772_5385231_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	6.2e-32
5385081:5385099	attR	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_032418781.1|5385227_5385869_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	1.5e-44
WP_032418782.1|5385868_5386447_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.6	5.1e-63
WP_032418783.1|5386443_5386812_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	2.3e-29
WP_032418784.1|5386798_5387698_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	6.2e-92
WP_032418785.1|5387690_5388287_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	46.3	1.5e-41
WP_032418786.1|5388291_5390451_+	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	1.6e-16
WP_032418787.1|5391670_5392828_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
WP_032418788.1|5392955_5393444_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
WP_032418789.1|5393455_5396395_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
WP_101972624.1|5396375_5396552_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
WP_032418790.1|5396548_5396848_-	hypothetical protein	NA	B9A7B2	Serratia_phage	73.7	3.1e-32
WP_032418791.1|5396902_5397418_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_032418792.1|5397417_5398599_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
WP_032418793.1|5398752_5399907_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	4.2e-178
WP_044785060.1|5399951_5400200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004180444.1|5400586_5401468_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_023316206.1|5401566_5402235_+	YecA family protein	NA	NA	NA	NA	NA
WP_004151453.1|5402259_5403471_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004175410.1|5403662_5403902_+	YecH family protein	NA	NA	NA	NA	NA
WP_004141101.1|5403937_5404435_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_020956668.1|5404492_5404672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911524.1|5406535_5406787_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_004175412.1|5406824_5408387_-	MFS transporter	NA	NA	NA	NA	NA
WP_004148869.1|5408401_5408560_+	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_140587840.1|5408630_5409140_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_071890473.1|5409233_5409437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911518.1|5410034_5411015_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032418795.1|5411077_5412592_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	4.1e-11
WP_002911507.1|5412606_5413587_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002911505.1|5413748_5414537_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004175414.1|5414511_5415936_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_002911500.1|5415959_5416388_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_002911499.1|5416741_5418325_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184668.1|5418329_5419469_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_004151452.1|5419530_5421264_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|5421499_5422069_+	VOC family protein	NA	NA	NA	NA	NA
WP_032418796.1|5422145_5422889_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023316208.1|5422970_5423975_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|5423971_5424715_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|5424754_5425150_-	membrane protein	NA	NA	NA	NA	NA
WP_002911483.1|5425202_5426021_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_004145564.1|5426017_5426584_-	hydrolase	NA	NA	NA	NA	NA
WP_002911479.1|5426851_5428639_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 1
NZ_CP031369	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence	292699	123339	228344	292699	transposase,bacteriocin,integrase	Stx2-converting_phage(11.54%)	96	134032:134053	185113:185134
WP_004152296.1|123339_123618_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004152294.1|123886_124438_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_004199332.1|124758_125037_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|125253_125331_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|125323_126181_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_009486390.1|126815_127004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093087.1|127625_129821_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|129817_131134_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|131137_133447_-	ATPase	NA	NA	NA	NA	NA
134032:134053	attL	AGACGGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_003846917.1|135152_136406_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|136457_139532_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|139653_140736_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152285.1|140958_141174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152284.1|141196_142207_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427619.1|142610_143615_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_071527925.1|143912_144155_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|144485_144779_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|144877_145645_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|145645_146602_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|146598_147597_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|147593_148496_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|148540_150865_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|150950_151904_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|151900_152422_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118231.1|153524_153692_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|153976_155104_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|155100_155694_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|155690_156539_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_140587871.1|156538_157459_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_140587889.1|157471_159073_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|159117_160065_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|160072_161806_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_140587873.1|165639_165975_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.5	8.2e-58
WP_020956879.1|165971_166358_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_110097746.1|166905_167196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140587875.1|167220_167922_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.1e-131
WP_077467014.1|167962_168196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000845048.1|168164_169178_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|169333_169807_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000679427.1|169990_170338_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|170331_171171_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|171100_171280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|171298_171571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|172986_174192_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|174202_174508_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|174523_174706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|174734_175499_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|175689_176046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|175991_176576_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|176575_177814_-	MFS transporter	NA	NA	NA	NA	NA
WP_023063803.1|177810_178725_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|178846_179551_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_140587891.1|179575_180052_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_004026609.1|181153_181732_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_000301240.1|181818_182394_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_011251320.1|182478_183720_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_011251321.1|184056_184692_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004144375.1|186423_187284_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
185113:185134	attR	AGACGGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_077250518.1|188125_191083_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004210220.1|191096_191624_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004210218.1|191736_192750_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004225018.1|192955_193951_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004215186.1|194286_195234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004215188.1|195349_195811_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004225020.1|195829_196012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004215174.1|196999_199225_+	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004225022.1|199273_200173_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004213078.1|200162_200453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213077.1|200804_201011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213076.1|201000_201294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213075.1|201309_202443_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004213073.1|203050_203281_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213072.1|203277_203721_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004213938.1|206018_206294_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004213936.1|206221_206425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213934.1|206515_207436_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_011251327.1|207484_207976_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_004213932.1|208038_208314_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004902152.1|208397_208826_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_004213927.1|208863_209424_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213925.1|209465_209726_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_004213924.1|210392_212594_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_140587877.1|212675_213896_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_004213920.1|213896_215621_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_004213919.1|215753_216977_+	MFS transporter	NA	NA	NA	NA	NA
WP_071591911.1|217326_217533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213918.1|217674_217869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145290.1|218729_219239_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_004213915.1|219788_220106_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004902159.1|220342_220729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902162.1|220826_222026_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_084456086.1|222496_223204_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032412871.1|223866_224865_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004213250.1|224870_225827_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004213252.1|225848_226676_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_004213850.1|227420_228344_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
>prophage 1
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	0	4917	210661	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001067855.1|2631_3336_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_053897648.1|3360_4917_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
>prophage 2
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	11113	11998	210661		Salmonella_phage(100.0%)	1	NA	NA
WP_004186900.1|11113_11998_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
>prophage 3
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	21418	22663	210661		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004181767.1|21418_22663_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
>prophage 4
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	30052	34832	210661	transposase	Cafeteria_roenbergensis_virus(25.0%)	5	NA	NA
WP_025368600.1|30052_31852_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.6	2.2e-27
WP_025368601.1|32142_32391_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181778.1|32380_32665_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_025368602.1|32894_34121_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	79.3	1.7e-156
WP_040120489.1|34406_34832_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	51.5	1.8e-33
>prophage 5
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	75725	76973	210661		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004181813.1|75725_76973_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	23.0	1.4e-12
>prophage 6
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	90071	96886	210661		Burkholderia_phage(33.33%)	11	NA	NA
WP_004196710.1|90071_90650_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|90640_90955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842846.1|91079_91490_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	59.2	5.0e-41
WP_004196726.1|91674_92034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|92264_92708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062826756.1|92749_92953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|92961_93222_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004883130.1|93254_93689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058842845.1|93777_94107_+	hypothetical protein	NA	A0A060D1I0	Salmonella_phage	62.2	5.7e-11
WP_004883137.1|94178_95594_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004883140.1|95683_96886_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	37.7	1.8e-33
>prophage 7
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	100938	107329	210661		Enterobacteria_phage(66.67%)	10	NA	NA
WP_004883151.1|100938_101559_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	46.5	4.8e-51
WP_004181834.1|101625_101844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883155.1|101879_102152_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_004181835.1|102430_102742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883156.1|102753_103071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117089966.1|103100_103490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057774872.1|103866_104355_+	hypothetical protein	NA	K7PM35	Enterobacteria_phage	34.0	3.0e-08
WP_057774875.1|104907_105555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368632.1|105577_105823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883182.1|106084_107329_+	site-specific DNA-methyltransferase	NA	A0A1U9WRT4	Mycobacterium_phage	25.3	2.9e-07
>prophage 8
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	111460	114314	210661		Bacillus_phage(50.0%)	2	NA	NA
WP_004026443.1|111460_112252_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
WP_004181841.1|113225_114314_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
>prophage 9
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	121018	135447	210661		Salmonella_phage(28.57%)	22	NA	NA
WP_004026417.1|121018_121339_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_058842858.1|121419_121734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|121854_122106_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_058842859.1|122271_122490_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	3.4e-20
WP_040209848.1|122582_123080_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
WP_004197241.1|123076_123265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|123742_123970_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004197234.1|123966_124611_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_058842860.1|124611_124935_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	2.0e-13
WP_004197228.1|125027_125414_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004197183.1|125693_125909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032451279.1|127564_127759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197220.1|128060_128267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|128350_128623_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_004883232.1|128903_129191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197199.1|129644_130169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197222.1|130232_131000_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
WP_074942239.1|131256_131442_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	65.3	9.2e-11
WP_058842861.1|131451_131901_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	40.7	1.0e-18
WP_040222755.1|131970_132579_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.6	2.6e-25
WP_043907016.1|132866_133322_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004197197.1|134205_135447_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 10
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	140935	142810	210661		Bacillus_phage(100.0%)	1	NA	NA
WP_016947078.1|140935_142810_+	DEAD/DEAH box helicase	NA	A0A127AW80	Bacillus_phage	27.1	5.2e-08
>prophage 11
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	146315	149579	210661		Pseudomonas_phage(33.33%)	4	NA	NA
WP_004152765.1|146315_147800_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_084456096.1|147715_147895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181893.1|147885_148308_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
WP_004181894.1|148307_149579_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	3.9e-140
>prophage 12
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	157516	159429	210661		Clostridioides_phage(50.0%)	2	NA	NA
WP_004181907.1|157516_158290_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	5.1e-10
WP_004181908.1|158292_159429_-	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.0	4.4e-10
>prophage 13
NZ_CP031372	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence	210661	200544	207320	210661	transposase	Tupanvirus(33.33%)	5	NA	NA
WP_011251272.1|200544_201546_-	TGS domain-containing protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
WP_077252464.1|203526_203808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|204027_204213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|204261_205446_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|205844_207320_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
>prophage 1
NZ_CP031373	Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_6, complete sequence	43670	24456	32607	43670	transposase	Escherichia_phage(50.0%)	10	NA	NA
WP_014839983.1|24456_25071_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_001516695.1|25389_26046_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_140587915.1|26413_26605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140587917.1|26571_27255_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	3.9e-131
WP_112029270.1|27747_28461_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	9.2e-123
WP_140587919.1|29478_30183_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
WP_004199403.1|30216_30573_-	hypothetical protein	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
WP_001549892.1|30575_30815_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|30901_31564_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|31944_32607_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
