The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041379	Bacteroides intestinalis strain APC919/174 chromosome, complete genome	5785761	1025836	1034444	5785761		Synechococcus_phage(28.57%)	9	NA	NA
WP_007661536.1|1025836_1026757_+	hypothetical protein	NA	A0A0E3FQH0	Synechococcus_phage	34.7	5.7e-16
WP_115502381.1|1026780_1028262_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.9	2.3e-11
WP_007661534.1|1028269_1028986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115502380.1|1029131_1030175_+	4-phosphoerythronate dehydrogenase PdxB	NA	M1H502	Paramecium_bursaria_Chlorella_virus	27.1	9.6e-20
WP_007661531.1|1030289_1030865_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	2.1e-24
WP_004291965.1|1031014_1031251_+	acyl carrier protein	NA	A0A1P8VWH3	Flavobacterium_phage	35.6	7.4e-05
WP_007661518.1|1031270_1032536_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_044534109.1|1032542_1033418_+	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	30.1	8.6e-22
WP_022393277.1|1033433_1034444_-	6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	28.2	1.2e-11
>prophage 3
NZ_CP041379	Bacteroides intestinalis strain APC919/174 chromosome, complete genome	5785761	2825994	2904990	5785761	tRNA,transposase,protease,integrase	Bacillus_phage(18.18%)	57	2885870:2885929	2888328:2888484
WP_115502596.1|2825994_2826756_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_115502595.1|2826784_2827681_+	EamA family transporter	NA	NA	NA	NA	NA
WP_115502594.1|2827698_2828169_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_115502593.1|2828219_2828876_+	DUF3256 family protein	NA	NA	NA	NA	NA
WP_115502592.1|2828876_2829767_-	YitT family protein	NA	NA	NA	NA	NA
WP_115502591.1|2829915_2831028_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_115502590.1|2831029_2831731_-	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	36.9	1.2e-21
WP_115502589.1|2831766_2832384_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_115502588.1|2832390_2833788_-	RtcB family protein	NA	K4F7X0	Cronobacter_phage	34.1	4.1e-42
WP_044535591.1|2834314_2834695_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_115501675.1|2834676_2835678_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	30.4	6.4e-21
WP_115502587.1|2836137_2837019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007215389.1|2837142_2837958_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_115502586.1|2837990_2839163_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_167507379.1|2839492_2840365_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_115502585.1|2841273_2842056_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	40.0	1.1e-44
WP_115502584.1|2842042_2843623_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_115502583.1|2843869_2844931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115502582.1|2844936_2846154_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007212654.1|2846506_2847001_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.0	1.5e-26
WP_007212655.1|2847137_2847821_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021968389.1|2848055_2849168_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
WP_007212658.1|2849164_2849455_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_044533284.1|2849458_2850250_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_115502581.1|2850246_2850786_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_115502580.1|2850694_2852437_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.5	1.0e-21
WP_044534672.1|2852525_2852987_-	dCMP deaminase family protein	NA	H6WFU3	Cyanophage	46.9	1.0e-29
WP_115502579.1|2852991_2853510_-	DUF4847 domain-containing protein	NA	NA	NA	NA	NA
WP_115502578.1|2853506_2855564_-	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	22.4	1.4e-38
WP_115502577.1|2855747_2856758_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_115502706.1|2856897_2857335_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_115502576.1|2857558_2859112_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_044155130.1|2859169_2863480_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	3.6e-12
WP_007666569.1|2863556_2863871_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_007666554.1|2863892_2865299_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_115502575.1|2865327_2868534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115502705.1|2868627_2871957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115502704.1|2871989_2873816_-	rhamnogalacturonan lyase	NA	NA	NA	NA	NA
WP_115502574.1|2873848_2876854_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_007666550.1|2876954_2878793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007666549.1|2878804_2880133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115502573.1|2880306_2882610_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_115502572.1|2882637_2885997_-	TonB-dependent receptor	NA	NA	NA	NA	NA
2885870:2885929	attL	ACAGTACCCGAAACGGTTTTGCTTTGTGCGGCGGCTCCTATAGCCAATACCGAGAACAAA	NA	NA	NA	NA
WP_115502571.1|2886788_2887970_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_115502570.1|2888259_2891403_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2888328:2888484	attR	TTTGTTCTCGGTATTGGCTATAGGAGCCGCCGCACAAAGCAAAACCGTTTCGGGTACTGTAATTGATCAAACCGGTGAACCGGTTATTGGTGCCAATGTTCTGGTTAAAGGCACTACTAATGGTGTGATTACTGACTTGGATGGTCGATTTACTCTT	NA	NA	NA	NA
WP_115502569.1|2891431_2893522_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_167507380.1|2893778_2894459_-	SGNH/GDSL hydrolase family protein	NA	Q597U1	Lactobacillus_virus	39.9	1.1e-32
WP_115502567.1|2894495_2896574_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_115502566.1|2896817_2897453_+	DUF4450 domain-containing protein	NA	NA	NA	NA	NA
WP_044155128.1|2897449_2898871_+	glycoside hydrolase family 28 protein	NA	B6V2Q9	Bacillus_phage	24.5	1.8e-08
WP_021967045.1|2898928_2900056_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_021967044.1|2900182_2901460_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_044155385.1|2901577_2902243_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_044155126.1|2902418_2903018_+	MarC family protein	NA	NA	NA	NA	NA
WP_044534851.1|2903350_2903632_+	LysO family transporter	NA	NA	NA	NA	NA
WP_007666512.1|2903628_2904255_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_044534852.1|2904249_2904990_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP041379	Bacteroides intestinalis strain APC919/174 chromosome, complete genome	5785761	3756512	3765123	5785761		Vibrio_phage(33.33%)	10	NA	NA
WP_115502802.1|3756512_3757283_+	hypothetical protein	NA	A0A0E3Y6D2	Fusobacterium_phage	52.9	5.7e-38
WP_115502801.1|3757279_3758188_+	hypothetical protein	NA	H2A0A8	Bacteroides_phage	37.1	2.2e-49
WP_115502800.1|3758184_3758679_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	44.7	5.3e-21
WP_115502799.1|3758685_3759138_+	hypothetical protein	NA	A0A2I7QSJ1	Vibrio_phage	30.8	8.4e-05
WP_115502798.1|3759154_3759820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115502796.1|3760084_3761242_+	DEAD/DEAH box helicase	NA	A0A0S2MWK8	Cellulophaga_phage	36.9	2.3e-59
WP_115503003.1|3761247_3761715_+	recombinase	NA	NA	NA	NA	NA
WP_115502795.1|3762467_3763115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115502794.1|3763111_3763300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115502793.1|3763404_3765123_+	ParB N-terminal domain-containing protein	NA	A0A0F7L836	uncultured_marine_virus	29.3	9.9e-14
