The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	0	2496	2280611		Bacillus_phage(50.0%)	2	NA	NA
WP_002229267.1|437_1820_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.1	2.1e-51
WP_002229261.1|1986_2496_-	cyclophilin	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	36.8	2.9e-14
>prophage 2
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	6441	8409	2280611		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_002213965.1|6441_8409_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.4	6.5e-110
>prophage 3
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	13765	14731	2280611	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_002248700.1|13765_14731_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	3.0e-36
>prophage 4
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	22670	23969	2280611		Pandoravirus(100.0%)	1	NA	NA
WP_061732549.1|22670_23969_+	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	30.9	1.4e-57
>prophage 5
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	30347	37896	2280611		Synechococcus_phage(40.0%)	7	NA	NA
WP_002217546.1|30347_31319_+	ADP-heptose synthase	NA	M4QF80	Synechococcus_phage	29.6	6.6e-15
WP_002219492.1|31355_32591_+	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	31.2	2.9e-47
WP_002225406.1|32592_33624_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002227458.1|33752_34757_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	33.0	1.9e-25
WP_002227457.1|34833_36375_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.4	1.5e-101
WP_021437362.1|36491_36584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033909723.1|37281_37896_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	48.1	1.1e-34
>prophage 6
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	41567	44609	2280611	protease	Agrobacterium_phage(50.0%)	3	NA	NA
WP_002236494.1|41567_43859_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	2.8e-165
WP_002221161.1|43860_44163_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_002217533.1|44405_44609_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	78.8	3.4e-22
>prophage 7
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	47724	56928	2280611		Pseudomonas_phage(40.0%)	9	NA	NA
WP_014581495.1|47724_49425_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	7.4e-70
WP_014581494.1|49856_51218_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.7	2.2e-24
WP_041917667.1|51390_51714_+	periplasmic protein	NA	NA	NA	NA	NA
WP_014581493.1|51818_52772_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	47.8	7.1e-46
WP_025458644.1|52810_54007_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002222689.1|54150_54855_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_002222688.1|54918_55485_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	71.1	2.1e-74
WP_002222687.1|55550_55967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002217521.1|56028_56928_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	35.5	1.5e-45
>prophage 8
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	71475	72267	2280611		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002234797.1|71475_72267_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.7	4.5e-38
>prophage 9
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	77226	78210	2280611		Hokovirus(100.0%)	1	NA	NA
WP_002213870.1|77226_78210_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	3.4e-43
>prophage 10
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	81873	82947	2280611		Bacillus_virus(100.0%)	1	NA	NA
WP_002219453.1|81873_82947_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	4.4e-28
>prophage 11
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	88529	89936	2280611		Escherichia_phage(100.0%)	1	NA	NA
WP_002240464.1|88529_89936_+	replicative DNA helicase	NA	O80281	Escherichia_phage	54.2	3.4e-129
>prophage 12
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	94569	98863	2280611	transposase	Paenibacillus_phage(66.67%)	3	NA	NA
WP_086558185.1|94569_95320_+|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_086558185.1|96231_96983_-|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_014581478.1|98410_98863_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	71.9	5.5e-49
>prophage 13
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	105047	111809	2280611	transposase	Moraxella_phage(25.0%)	12	NA	NA
WP_002220686.1|105047_105965_+	KilA-N domain-containing protein	NA	A0A0R6PDL1	Moraxella_phage	60.0	2.6e-29
WP_002220687.1|106022_106232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002219435.1|106368_106560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014581475.1|106562_106856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223443.1|106852_107113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222643.1|107147_107363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222642.1|107432_108287_-	YfdQ family protein	NA	NA	NA	NA	NA
WP_002220694.1|108311_108671_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	32.6	1.7e-05
WP_002219431.1|108738_108939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002219430.1|109182_109608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220696.1|109710_110427_-	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	37.8	1.0e-33
WP_014581474.1|110843_111809_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.8e-36
>prophage 14
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	130038	131430	2280611		environmental_Halophage(100.0%)	1	NA	NA
WP_002235699.1|130038_131430_+	purine permease	NA	H9YQ34	environmental_Halophage	47.4	2.3e-21
>prophage 15
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	144369	149516	2280611		Synechococcus_phage(50.0%)	5	NA	NA
WP_002221128.1|144369_145107_+	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	54.7	5.1e-44
WP_002217391.1|145355_146759_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_002217390.1|147037_147415_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_002217389.1|147408_147750_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_002222618.1|147752_149516_+	succinate dehydrogenase flavoprotein subunit	NA	M1GXT4	Acanthocystis_turfacea_Chlorella_virus	27.8	5.2e-18
>prophage 16
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	156562	165603	2280611		Erysipelothrix_phage(25.0%)	6	NA	NA
WP_002217382.1|156562_157996_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.7	1.8e-48
WP_002213751.1|158120_158408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222616.1|158506_159673_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_002222615.1|159683_160574_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.0e-18
WP_002222614.1|161124_162720_-	hypothetical protein	NA	P79669	Escherichia_phage	58.0	8.5e-185
WP_002244094.1|162753_165603_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	1.0e-310
>prophage 17
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	170231	173755	2280611		Acinetobacter_phage(66.67%)	3	NA	NA
WP_002213729.1|170231_170822_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.8	3.8e-74
WP_002227406.1|170885_171944_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.1	6.2e-75
WP_002222083.1|172720_173755_+	replication protein	NA	S0F3I3	Stenotrophomonas_phage	31.8	3.1e-23
>prophage 18
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	182905	215104	2280611	transposase,tRNA	Pseudomonas_phage(18.18%)	37	NA	NA
WP_014581471.1|182905_184486_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	5.1e-65
WP_025458829.1|185099_186056_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	34.4	4.3e-27
WP_002227393.1|186208_186643_+	gp16 family protein	NA	L7P7R1	Pseudomonas_phage	41.5	8.0e-21
WP_002233778.1|186623_187052_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	40.4	2.1e-21
WP_002227392.1|187359_187905_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	50.3	2.4e-38
WP_002225299.1|187901_188105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002219316.1|188274_188511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002225297.1|188482_188887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014581468.1|188928_189936_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014581467.1|190068_191835_-	adhesin	NA	NA	NA	NA	NA
WP_002239042.1|194165_194336_-	rubredoxin	NA	NA	NA	NA	NA
WP_002217325.1|194807_195899_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_002233788.1|196033_196582_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002213703.1|196736_197108_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_115435230.1|197402_199094_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002258184.1|199618_203452_+	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002233790.1|203528_204530_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002222579.1|204743_204923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115435231.1|205109_206117_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002239049.1|206381_206585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002239050.1|206596_206878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049776673.1|206915_207179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014581463.1|208135_209011_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	39.5	3.0e-43
WP_002232332.1|209055_209346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222576.1|209357_209603_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	55.0	3.8e-12
WP_002219357.1|209595_209820_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002222575.1|210091_210463_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NPU3	Burkholderia_phage	35.1	8.1e-06
WP_002222574.1|210464_211088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002233797.1|211080_211275_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002225288.1|211298_211862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002225287.1|211892_212840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222571.1|212924_213428_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	60.4	2.7e-52
WP_002213679.1|213539_213872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213678.1|213868_214279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002260534.1|214283_214862_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.6	8.4e-50
WP_079274828.1|214885_214996_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	65.7	4.8e-07
WP_079274829.1|215002_215104_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	222136	226826	2280611	transposase,tRNA	Staphylococcus_phage(33.33%)	6	NA	NA
WP_002223889.1|222136_223102_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	1.8e-36
WP_002222563.1|223241_224201_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	78.6	1.2e-112
WP_002222562.1|224266_225130_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_002222561.1|225164_225527_-	RidA family protein	NA	NA	NA	NA	NA
WP_002217103.1|225601_226081_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002217104.1|226103_226826_+	DnaJ domain-containing protein	NA	M1PC06	Moumouvirus	62.1	5.4e-14
>prophage 20
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	232209	233480	2280611		Ostreococcus_lucimarinus_virus(66.67%)	3	NA	NA
WP_002244107.1|232209_232644_-	hypothetical protein	NA	G9E546	Ostreococcus_lucimarinus_virus	43.8	5.0e-23
WP_002235836.1|232658_233054_-	restriction endonuclease NlaIV	NA	G9E546	Ostreococcus_lucimarinus_virus	37.6	2.2e-17
WP_002240544.1|233219_233480_-	DNA (cytosine-5-)-methyltransferase	NA	A0A193GZ36	Escherichia_phage	48.2	2.4e-12
>prophage 21
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	241937	244409	2280611		uncultured_virus(100.0%)	1	NA	NA
WP_014581461.1|241937_244409_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.3	1.9e-74
>prophage 22
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	252499	318592	2280611	terminase,head,plate,transposase,tail,integrase	Mannheimia_phage(24.39%)	73	257578:257606	316537:316565
WP_002221064.1|252499_253465_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	8.0e-37
WP_002222546.1|253586_255497_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	5.2e-56
WP_002219343.1|255515_256160_-	DedA family protein	NA	NA	NA	NA	NA
WP_002222545.1|256324_257143_-	adhesin Opc	NA	NA	NA	NA	NA
257578:257606	attL	CCGTCATTCCCGCGAAAGCGGGAATCTAG	NA	NA	NA	NA
WP_162467427.1|257856_258792_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_061732572.1|259095_260346_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	4.7e-98
WP_002222535.1|260826_262602_-	gamma-glutamyltransferase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	28.7	6.6e-05
WP_079760669.1|263179_263401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213659.1|263376_263595_+	YdcH family protein	NA	NA	NA	NA	NA
WP_014581459.1|263737_264712_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.7	1.5e-46
WP_014581458.1|264957_265803_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_002225265.1|265879_266482_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002213654.1|266537_266894_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_002225264.1|266927_267464_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002255874.1|268130_268490_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	46.1	2.3e-13
WP_002221046.1|268518_269199_-	membrane protein	NA	NA	NA	NA	NA
WP_061728204.1|269363_272396_+	hypothetical protein	NA	G1FGP1	Mycobacterium_phage	48.9	6.5e-85
WP_002235743.1|272620_273883_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	62.6	1.4e-137
WP_002221043.1|273895_275005_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	3.9e-112
WP_002245026.1|275250_277044_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.9	1.5e-09
WP_161624710.1|277135_277801_+	YecA family protein	NA	G9E3U3	Emiliania_huxleyi_virus	40.3	7.2e-05
WP_002229436.1|277883_278735_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002217263.1|278805_279936_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_061728205.1|280105_281002_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_002222525.1|282876_283545_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002213636.1|283541_284210_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_162467426.1|284314_284893_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.9	7.2e-09
WP_072104465.1|285114_285327_-	helix-turn-helix transcriptional regulator	NA	X4YTE2	Pseudomonas_phage	42.0	6.7e-05
WP_002227210.1|285493_286207_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002232388.1|286421_286673_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061386493.1|286674_288651_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LPN5	Mannheimia_phage	42.1	5.5e-117
WP_014581454.1|288686_289859_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	45.3	4.0e-51
WP_002219320.1|289860_290382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014581453.1|290524_291070_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	51.4	3.9e-41
WP_002225299.1|291066_291270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002219316.1|291439_291676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041917659.1|291647_292067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221081.1|292086_292269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215844.1|292313_292484_-	YegP family protein	NA	NA	NA	NA	NA
WP_002215845.1|292496_292715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222592.1|292711_293050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213717.1|293061_293328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213716.1|293324_293522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227349.1|293524_294031_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	50.6	1.5e-39
WP_002222513.1|294027_294618_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	36.3	8.1e-08
WP_002222512.1|294630_296253_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	69.7	3.2e-224
WP_002219310.1|296252_297821_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	61.4	1.0e-187
WP_002222511.1|297807_299103_+|head	phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	50.1	8.3e-114
WP_002213608.1|299212_299629_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	48.2	2.4e-30
WP_002232421.1|299859_300921_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	43.0	9.6e-60
WP_002221064.1|301008_301974_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	8.0e-37
WP_002213605.1|302085_302484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213604.1|302483_302906_+	DUF1320 family protein	NA	A0A2P9JZJ4	Alteromonadaceae_phage	42.5	2.2e-15
WP_002213603.1|302895_303546_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	38.4	6.8e-32
WP_002213602.1|303542_303740_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_002222506.1|303739_305152_+|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	52.6	9.6e-124
WP_002222505.1|305216_305594_+	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	50.8	5.3e-29
WP_002217234.1|305597_305963_+	hypothetical protein	NA	F6MIK9	Haemophilus_phage	37.7	5.3e-10
WP_014580554.1|305937_306171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222503.1|306214_306817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014581450.1|306971_309110_+	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	26.6	1.2e-37
WP_002227342.1|309109_310441_+	phage morphogeneis protein	NA	A0A0M3LQ21	Mannheimia_phage	35.4	2.1e-64
WP_002222500.1|310430_311576_+	hypothetical protein	NA	F6MIL3	Haemophilus_phage	57.9	3.0e-115
WP_002217230.1|311572_312241_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	52.1	1.8e-59
WP_002217228.1|312341_312689_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	61.2	9.5e-33
WP_115435232.1|312702_313758_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	56.4	2.9e-101
WP_002234869.1|313754_314315_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	3.1e-25
WP_002234870.1|314325_316299_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	55.6	3.7e-129
WP_002213586.1|316864_317167_-	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	38.8	1.1e-05
316537:316565	attR	CCGTCATTCCCGCGAAAGCGGGAATCTAG	NA	NA	NA	NA
WP_002217222.1|317138_317426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002234871.1|317505_318111_+	hypothetical protein	NA	D0UIH2	Aggregatibacter_phage	41.8	9.2e-15
WP_002219300.1|318089_318386_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	61.4	1.4e-24
WP_002222487.1|318382_318592_+	hypothetical protein	NA	A0A0R6PHB4	Moraxella_phage	48.2	3.1e-07
>prophage 23
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	325700	327563	2280611		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002222477.1|325700_327563_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	41.1	2.4e-106
>prophage 24
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	345579	346866	2280611		Catovirus(100.0%)	1	NA	NA
WP_014581444.1|345579_346866_-	sulfate adenylyltransferase subunit 1	NA	A0A1V0SA87	Catovirus	30.0	1.3e-18
>prophage 25
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	355177	359370	2280611		Lactococcus_phage(50.0%)	2	NA	NA
WP_041917655.1|355177_357568_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	37.2	3.2e-71
WP_002217182.1|357906_359370_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.8	5.7e-95
>prophage 26
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	366595	373417	2280611		Moraxella_phage(100.0%)	1	NA	NA
WP_002222440.1|366595_373417_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	27.6	8.7e-37
>prophage 27
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	378704	379364	2280611		Harp_seal_herpesvirus(100.0%)	1	NA	NA
WP_061732527.1|378704_379364_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	52.2	9.9e-55
>prophage 28
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	383493	394642	2280611		Tupanvirus(20.0%)	9	NA	NA
WP_115435236.1|383493_385413_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.5	4.6e-68
WP_011798904.1|385489_385921_-	membrane protein	NA	NA	NA	NA	NA
WP_002224514.1|386058_387366_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_002220974.1|387358_387793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213508.1|387851_388121_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	62.9	3.8e-21
WP_002227310.1|388302_390753_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	9.5e-212
WP_002227308.1|391003_392107_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_115435237.1|392134_393880_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.9	2.6e-22
WP_002258219.1|393946_394642_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.1	5.4e-35
>prophage 29
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	399225	404575	2280611	transposase	Tupanvirus(33.33%)	5	NA	NA
WP_002224512.1|399225_400854_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.0	9.0e-57
WP_002222420.1|400925_402179_+	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	41.9	1.3e-71
WP_002215827.1|402263_402941_+|transposase	IS1595-like element ISNme3 family transposase	transposase	NA	NA	NA	NA
WP_002217140.1|403153_403462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220958.1|403543_404575_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.3	1.1e-07
>prophage 30
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	411421	425074	2280611	transposase	Staphylococcus_phage(57.14%)	9	NA	NA
WP_002221064.1|411421_412387_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	8.0e-37
WP_002222409.1|412535_413570_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.8	2.9e-69
WP_002222408.1|414329_415007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220947.1|414999_415593_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.4e-44
WP_002225186.1|416990_418328_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	37.5	2.1e-59
WP_002213472.1|418487_418625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222407.1|419244_420555_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.3	3.8e-82
WP_002222168.1|421092_422058_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	3.6e-37
WP_061732592.1|422134_425074_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	51.7	8.6e-276
>prophage 31
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	428459	433031	2280611		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_061732533.1|428459_429017_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	31.0	1.3e-07
WP_061732532.1|429081_429999_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002222403.1|430181_430454_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_002222402.1|430450_430744_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002222401.1|430788_431265_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_061732534.1|431335_431848_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002232545.1|431915_433031_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	2.1e-73
>prophage 32
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	436054	444441	2280611		uncultured_virus(20.0%)	7	NA	NA
WP_002217091.1|436054_436267_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	49.3	1.4e-10
WP_002220901.1|436896_438333_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.7	2.1e-49
WP_002224501.1|438343_439330_+	DUF459 domain-containing protein	NA	NA	NA	NA	NA
WP_002227285.1|439326_440520_+	hypothetical protein	NA	Q4ZC48	Staphylococcus_virus	23.7	4.3e-08
WP_153957932.1|440557_440758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014581435.1|440768_442322_+	fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	26.5	5.8e-29
WP_002237041.1|442413_444441_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.1	1.9e-19
>prophage 33
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	454515	469444	2280611		Burkholderia_phage(22.22%)	14	NA	NA
WP_002222386.1|454515_455358_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.6	5.7e-47
WP_002222384.1|455372_455813_+	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_002222383.1|455860_457147_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	62.3	2.5e-147
WP_002213385.1|457160_457439_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_002217077.1|457479_457770_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.5	7.5e-15
WP_033908593.1|458014_459169_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	75.1	1.8e-165
WP_002213380.1|459208_460396_-	type II restriction enzyme	NA	E5E3X4	Burkholderia_phage	38.9	6.6e-33
WP_002222381.1|460388_461402_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	52.8	8.0e-88
WP_002222380.1|461459_463739_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	67.6	1.2e-309
WP_002233953.1|464252_464579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227278.1|464889_465657_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002227277.1|465744_466572_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	29.5	7.3e-23
WP_002227276.1|466623_467289_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002227275.1|467467_469444_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A0RVE6	Bacillus_phage	38.3	1.1e-08
>prophage 34
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	474902	475217	2280611		Geobacillus_virus(100.0%)	1	NA	NA
WP_002213349.1|474902_475217_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	40.0	2.4e-11
>prophage 35
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	479668	480094	2280611		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_002213338.1|479668_480094_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.2	1.9e-19
>prophage 36
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	483818	489919	2280611		Agrobacterium_phage(33.33%)	4	NA	NA
WP_002225167.1|483818_484433_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.1	9.8e-57
WP_002233971.1|484528_485839_-	trigger factor	NA	NA	NA	NA	NA
WP_115435240.1|486046_488485_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.5	2.3e-85
WP_002245072.1|488707_489919_+	uracil-xanthine permease	NA	Q2WG41	Clostridium_botulinum_D_phage	23.0	8.2e-23
>prophage 37
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	494314	497566	2280611		Orpheovirus(50.0%)	2	NA	NA
WP_002213296.1|494314_495265_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	46.0	5.2e-65
WP_014581429.1|495403_497566_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	52.5	1.7e-196
>prophage 38
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	502607	506923	2280611		Salmonella_phage(50.0%)	4	NA	NA
WP_002222360.1|502607_502970_-	hypothetical protein	NA	S4TR57	Salmonella_phage	37.5	1.9e-07
WP_162819252.1|503082_505182_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_153308396.1|505282_505429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061732528.1|505438_506923_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.2	6.5e-22
>prophage 39
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	518365	520150	2280611		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002227248.1|518365_520150_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.9	1.2e-33
>prophage 40
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	542618	557228	2280611	tRNA,protease	Gordonia_phage(14.29%)	14	NA	NA
WP_002239156.1|542618_543974_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.7	1.2e-33
WP_014573949.1|544170_544992_+	NAD(+) synthase	NA	A0A222YW38	Synechococcus_phage	49.6	2.0e-57
WP_002213213.1|545843_546176_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	41.6	6.5e-15
WP_002222330.1|546228_547176_-	oxidoreductase	NA	NA	NA	NA	NA
WP_002220827.1|547503_548892_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	5.1e-53
WP_009348581.1|549166_549367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222329.1|549380_549935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220826.1|550019_550520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222328.1|550923_552120_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.5e-29
WP_002222327.1|552222_553467_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.6	2.3e-129
WP_002220822.1|553657_554029_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002222326.1|554061_554985_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_021438889.1|555201_555642_+	type III restriction/modification enzyme methylation subunit	NA	NA	NA	NA	NA
WP_025458878.1|555869_557228_+	site-specific DNA-methyltransferase	NA	A0A2R3ZYF2	Campylobacter_phage	36.0	3.6e-51
>prophage 41
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	563554	567959	2280611		uncultured_virus(33.33%)	5	NA	NA
WP_002213175.1|563554_563941_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	1.9e-53
WP_002216984.1|564027_564348_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	4.8e-23
WP_002222321.1|564307_564529_-	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_002219110.1|564610_565111_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_002216981.1|565208_567959_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	30.4	8.8e-89
>prophage 42
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	574735	576181	2280611		Cyanophage(100.0%)	1	NA	NA
WP_002222316.1|574735_576181_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	36.0	3.1e-77
>prophage 43
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	582321	586832	2280611		Salmonella_phage(50.0%)	2	NA	NA
WP_002216968.1|582321_582882_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	51.9	2.1e-45
WP_002224462.1|584699_586832_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.0	6.5e-47
>prophage 44
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	590263	600135	2280611		uncultured_Caudovirales_phage(66.67%)	3	NA	NA
WP_014581420.1|590263_591262_+	calcium-binding protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	40.9	3.0e-23
WP_115435243.1|592051_597199_+	iron-regulated protein frpC	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	40.9	5.4e-23
WP_002222308.1|597531_600135_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	8.0e-15
>prophage 45
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	604912	606286	2280611		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002222301.1|604912_606286_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.5	1.1e-52
>prophage 46
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	610284	615458	2280611	tRNA	Catovirus(50.0%)	3	NA	NA
WP_014581417.1|610284_611796_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	5.3e-88
WP_002213067.1|611950_613204_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_014581416.1|613661_615458_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	47.1	3.5e-155
>prophage 47
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	622573	623107	2280611		Clostridioides_phage(100.0%)	1	NA	NA
WP_002235938.1|622573_623107_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	43.4	6.2e-23
>prophage 48
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	629601	641946	2280611		Bacillus_phage(33.33%)	10	NA	NA
WP_002222288.1|629601_630087_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_002222287.1|630134_630848_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002222286.1|630847_631516_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_002213027.1|631526_631712_-	DUF3460 family protein	NA	NA	NA	NA	NA
WP_002222285.1|631855_633832_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.9	1.2e-84
WP_115435245.1|633926_636047_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.5	1.2e-45
WP_002219073.1|636126_636462_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002213013.1|637846_638893_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.3	6.2e-120
WP_002229647.1|639113_639911_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	33.8	1.6e-19
WP_002249022.1|639930_641946_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	36.8	1.4e-107
>prophage 49
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	659091	664841	2280611	transposase	EBPR_podovirus(33.33%)	5	NA	NA
WP_002212976.1|659091_659616_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	60.7	1.5e-34
WP_002225104.1|659619_661002_-	MFS transporter	NA	NA	NA	NA	NA
WP_002212974.1|661112_661736_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	34.0	3.0e-05
WP_002235017.1|662470_662962_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002212532.1|663632_664841_+	replication initiation factor	NA	B1NI77	Stenotrophomonas_phage	33.5	1.9e-27
>prophage 50
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	677134	679714	2280611		Cronobacter_phage(100.0%)	1	NA	NA
WP_014581410.1|677134_679714_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.2	3.6e-116
>prophage 51
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	686649	690472	2280611		Lactococcus_phage(33.33%)	3	NA	NA
WP_014581407.1|686649_687897_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BKT8	Lactococcus_phage	39.8	6.3e-10
WP_014581406.1|688152_688899_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.7	2.0e-59
WP_002238116.1|688915_690472_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	36.1	3.0e-33
>prophage 52
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	699526	700735	2280611		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_002212532.1|699526_700735_+	replication initiation factor	NA	B1NI77	Stenotrophomonas_phage	33.5	1.9e-27
>prophage 53
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	716145	720059	2280611	tRNA	uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_002222245.1|716145_717000_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.9	8.1e-09
WP_014581404.1|717040_718249_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.8	3.2e-43
WP_014581403.1|718340_720059_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.8	6.3e-85
>prophage 54
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	726635	727370	2280611		Bradyrhizobium_phage(100.0%)	1	NA	NA
WP_014581400.1|726635_727370_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	1.3e-34
>prophage 55
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	739286	743561	2280611	transposase	Paenibacillus_phage(33.33%)	4	NA	NA
WP_086558185.1|739286_740037_+|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_002229688.1|740900_741347_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.5	1.2e-24
WP_014581397.1|741401_742412_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_041917638.1|742808_743561_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	39.1	1.3e-21
>prophage 56
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	752373	756269	2280611		Helicobacter_phage(50.0%)	2	NA	NA
WP_014581392.1|752373_754146_+	DNA primase	NA	A0A1S5RFN0	Helicobacter_phage	31.9	8.0e-43
WP_002225051.1|754340_756269_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.5	1.7e-30
>prophage 57
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	767167	770584	2280611		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_002222222.1|767167_768802_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.1e-155
WP_002222221.1|768913_770584_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	4.4e-35
>prophage 58
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	774393	776082	2280611	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_025458612.1|774393_776082_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.9	3.5e-197
>prophage 59
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	780575	784295	2280611		Synechococcus_phage(50.0%)	4	NA	NA
WP_002222210.1|780575_781202_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.6	1.3e-24
WP_002212827.1|781308_782127_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002244237.1|782385_782826_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002225032.1|782888_784295_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	8.3e-43
>prophage 60
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	792758	794486	2280611		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_115435251.1|792758_794486_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.9	1.5e-57
>prophage 61
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	811602	823842	2280611	tRNA,transposase	Klosneuvirus(25.0%)	8	NA	NA
WP_002222191.1|811602_814227_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.4	1.6e-76
WP_002218975.1|814315_815338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014575487.1|815391_816561_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	38.6	1.6e-55
WP_072104340.1|816906_817143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101045608.1|818407_819364_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	34.4	3.1e-25
WP_002222190.1|819540_820485_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_002220519.1|820558_821242_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_115435315.1|821538_823842_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	37.4	7.6e-86
>prophage 62
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	828102	829272	2280611		Tupanvirus(100.0%)	1	NA	NA
WP_002234138.1|828102_829272_-	O-succinylhomoserine sulfhydrylase	NA	A0A2K9L4S9	Tupanvirus	23.4	5.7e-05
>prophage 63
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	838185	838623	2280611		Salmonella_phage(100.0%)	1	NA	NA
WP_002222174.1|838185_838623_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.0	7.7e-40
>prophage 64
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	845548	846304	2280611		Microcystis_virus(100.0%)	1	NA	NA
WP_002227122.1|845548_846304_+	formylglycine-generating enzyme family protein	NA	A0A7F1	Microcystis_virus	32.7	2.3e-15
>prophage 65
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	851595	859534	2280611		Streptococcus_phage(33.33%)	5	NA	NA
WP_014581382.1|851595_852702_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	47.6	6.2e-86
WP_002216731.1|853066_853498_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_014581381.1|853525_855028_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_014581380.1|855039_857928_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-19
WP_002235087.1|858139_859534_-	DUF3482 domain-containing protein	NA	A0A0R6PHS5	Moraxella_phage	50.6	1.5e-92
>prophage 66
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	878908	886531	2280611	tRNA	Methanothermobacter_phage(20.0%)	7	NA	NA
WP_002222148.1|878908_880093_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.4	1.3e-41
WP_002222147.1|880159_882316_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	35.3	8.3e-10
WP_002212665.1|882407_882614_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002222146.1|882672_883290_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	32.5	7.9e-14
WP_002227106.1|883450_884017_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.6	7.7e-32
WP_002222143.1|884062_884851_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002222142.1|885175_886531_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	59.6	1.1e-111
>prophage 67
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	896699	899552	2280611		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_061732545.1|896699_899552_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	49.4	2.4e-254
>prophage 68
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	903725	911730	2280611	tRNA	Pandoravirus(20.0%)	7	NA	NA
WP_002227098.1|903725_904826_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	44.5	2.9e-83
WP_002227097.1|904917_905343_+	osmoprotectant transport activator ProQ	NA	NA	NA	NA	NA
WP_002227096.1|905416_907402_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.0	2.0e-95
WP_002220454.1|907468_908077_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002227094.1|908157_909453_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.0	4.1e-97
WP_002222131.1|909530_910529_-	2-hydroxyacid dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	44.7	1.2e-64
WP_002222130.1|910653_911730_-	peptide chain release factor 1	NA	G0YKC3	Acinetobacter_phage	46.3	6.9e-05
>prophage 69
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	916222	917074	2280611		Pandoravirus(100.0%)	1	NA	NA
WP_002222125.1|916222_917074_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.7	5.4e-21
>prophage 70
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	930019	930814	2280611		Microbacterium_phage(100.0%)	1	NA	NA
WP_002222109.1|930019_930814_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	68.3	7.3e-105
>prophage 71
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	970336	971371	2280611		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_002222083.1|970336_971371_+	replication protein	NA	S0F3I3	Stenotrophomonas_phage	31.8	3.1e-23
>prophage 72
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1005693	1009604	2280611		Stenotrophomonas_phage(100.0%)	2	NA	NA
WP_002212532.1|1005693_1006902_-	replication initiation factor	NA	B1NI77	Stenotrophomonas_phage	33.5	1.9e-27
WP_002212532.1|1008395_1009604_+	replication initiation factor	NA	B1NI77	Stenotrophomonas_phage	33.5	1.9e-27
>prophage 73
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1020651	1021902	2280611		Thermus_virus(100.0%)	1	NA	NA
WP_101133174.1|1020651_1021902_+	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	50.0	1.0e-15
>prophage 74
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1033941	1034907	2280611	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_002217985.1|1033941_1034907_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	4.7e-37
>prophage 75
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1043620	1044829	2280611		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_002212532.1|1043620_1044829_+	replication initiation factor	NA	B1NI77	Stenotrophomonas_phage	33.5	1.9e-27
>prophage 76
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1059730	1061041	2280611		Moraxella_phage(100.0%)	1	NA	NA
WP_002212503.1|1059730_1061041_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.5	1.6e-59
>prophage 77
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1102937	1103603	2280611		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002235484.1|1102937_1103603_-	beta-phosphoglucomutase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	27.4	1.7e-09
>prophage 78
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1108862	1110539	2280611		Tupanvirus(100.0%)	1	NA	NA
WP_002227014.1|1108862_1110539_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.5	2.4e-41
>prophage 79
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1117789	1119364	2280611		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_002212449.1|1117789_1119364_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	28.1	1.4e-38
>prophage 80
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1135967	1142710	2280611	transposase	Paenibacillus_phage(25.0%)	8	NA	NA
WP_086558185.1|1135967_1136719_-|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_014581337.1|1137256_1138066_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002239498.1|1138067_1138769_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_014581336.1|1139237_1139972_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	2.6e-24
WP_014581335.1|1140045_1140576_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_014581334.1|1140556_1141138_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_061386456.1|1141134_1141671_-	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	44.4	7.8e-26
WP_115435264.1|1141735_1142710_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A0B6VSY5	Edwardsiella_phage	35.1	8.1e-21
>prophage 81
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1165955	1166930	2280611		Indivirus(100.0%)	1	NA	NA
WP_002226981.1|1165955_1166930_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.6	1.5e-06
>prophage 82
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1173657	1176792	2280611		Pneumococcus_phage(33.33%)	3	NA	NA
WP_002237610.1|1173657_1174131_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	68.7	1.1e-50
WP_002226976.1|1174310_1174997_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	62.3	1.3e-62
WP_014581325.1|1175499_1176792_-	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	46.2	5.5e-25
>prophage 83
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1184955	1186567	2280611		Erwinia_phage(50.0%)	2	NA	NA
WP_002218701.1|1184955_1185444_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.9	8.4e-27
WP_002221951.1|1185511_1186567_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.5	5.0e-85
>prophage 84
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1205301	1212405	2280611		Streptococcus_phage(25.0%)	5	NA	NA
WP_002221942.1|1205301_1207452_+	ATP-dependent DNA helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	31.4	4.3e-14
WP_002221941.1|1207487_1208102_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_002226961.1|1208382_1210251_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	37.4	6.2e-54
WP_002233479.1|1210330_1211701_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.4e-108
WP_002215682.1|1211772_1212405_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	36.8	1.3e-19
>prophage 85
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1224182	1227330	2280611		Acinetobacter_phage(50.0%)	2	NA	NA
WP_014581314.1|1224182_1224965_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.6	3.6e-56
WP_002221929.1|1225029_1227330_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	35.6	1.2e-78
>prophage 86
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1231550	1235335	2280611		Synechococcus_phage(50.0%)	4	NA	NA
WP_050888735.1|1231550_1232270_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.9	3.9e-20
WP_002235414.1|1232323_1232650_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014581312.1|1232731_1233316_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_101171756.1|1233478_1235335_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	41.5	6.7e-32
>prophage 87
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1260152	1262360	2280611		Bacillus_phage(100.0%)	1	NA	NA
WP_014581306.1|1260152_1262360_-	DNA helicase II	NA	S5M596	Bacillus_phage	31.1	6.0e-72
>prophage 88
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1267227	1268193	2280611	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_002219428.1|1267227_1268193_+|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	2.7e-37
>prophage 89
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1274519	1274756	2280611		Ralstonia_phage(100.0%)	1	NA	NA
WP_002215574.1|1274519_1274756_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	42.5	1.7e-09
>prophage 90
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1279714	1288471	2280611		Tupanvirus(33.33%)	5	NA	NA
WP_115435270.1|1279714_1281229_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.5	1.1e-101
WP_002221883.1|1281625_1282192_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_014581303.1|1282814_1284851_-	M3 family metallopeptidase	NA	A0A1V0SID3	Klosneuvirus	23.8	5.8e-45
WP_002224809.1|1284938_1285811_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_014581302.1|1286080_1288471_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	29.8	4.5e-97
>prophage 91
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1310639	1312939	2280611		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_002218599.1|1310639_1311224_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	44.5	2.4e-28
WP_014575111.1|1311236_1311482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221868.1|1312165_1312939_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.6	7.1e-20
>prophage 92
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1316572	1317319	2280611		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002218592.1|1316572_1317319_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.4	1.4e-20
>prophage 93
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1330497	1333335	2280611	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_002226913.1|1330497_1333335_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.8e-143
>prophage 94
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1350992	1364730	2280611		Catovirus(25.0%)	8	NA	NA
WP_002221846.1|1350992_1352177_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	32.6	6.6e-09
WP_002218568.1|1352262_1354368_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	2.5e-59
WP_002215391.1|1354386_1354857_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002218431.1|1354974_1355346_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_002215381.1|1355524_1355674_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_002221845.1|1355670_1355928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002221842.1|1356219_1360395_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.3	7.6e-76
WP_002220155.1|1360551_1364730_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.3	2.2e-22
>prophage 95
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1368322	1387330	2280611	tRNA	Catovirus(12.5%)	19	NA	NA
WP_002221846.1|1368322_1369507_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	32.6	6.6e-09
WP_002215364.1|1369923_1370175_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	55.7	2.3e-20
WP_002215358.1|1370297_1370867_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_002233408.1|1370955_1371333_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002221836.1|1371450_1372002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033908460.1|1372024_1372717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221835.1|1372789_1375096_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.7	1.7e-109
WP_002215351.1|1375167_1375629_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_061732521.1|1375654_1376848_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.1	1.2e-31
WP_115435272.1|1376938_1378216_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_115435273.1|1378208_1380329_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.5	6.5e-07
WP_002216221.1|1380328_1380928_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_014581289.1|1380893_1382153_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_014581288.1|1382231_1383158_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.0	6.3e-07
WP_002215341.1|1383244_1383790_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	35.3	4.4e-16
WP_002233401.1|1383931_1385149_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002218543.1|1385211_1385877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216215.1|1385941_1386400_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002215336.1|1386409_1387330_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	41.7	3.5e-58
>prophage 96
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1392366	1393938	2280611		Bacillus_phage(100.0%)	1	NA	NA
WP_002243941.1|1392366_1393938_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.3	5.1e-25
>prophage 97
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1410475	1413066	2280611		Enterobacteria_phage(66.67%)	3	NA	NA
WP_061732525.1|1410475_1411015_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.5	8.3e-52
WP_061732524.1|1411068_1411935_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	3.6e-105
WP_002236574.1|1412040_1413066_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.0e-98
>prophage 98
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1417587	1418238	2280611		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002218516.1|1417587_1418238_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	2.3e-11
>prophage 99
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1427795	1434918	2280611		Enterobacteria_phage(40.0%)	6	NA	NA
WP_115435274.1|1427795_1428815_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.0	5.6e-81
WP_002236574.1|1428930_1429956_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.0e-98
WP_061732524.1|1430061_1430928_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	3.6e-105
WP_024015112.1|1430966_1431539_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.4	1.3e-50
WP_002220107.1|1431582_1433601_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_002220105.1|1433796_1434918_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	33.7	1.3e-27
>prophage 100
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1459311	1459797	2280611		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002257085.1|1459311_1459797_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	46.5	2.7e-25
>prophage 101
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1462858	1464229	2280611		Tupanvirus(100.0%)	1	NA	NA
WP_014581277.1|1462858_1464229_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A2K9L277	Tupanvirus	36.0	2.1e-30
>prophage 102
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1470993	1476033	2280611	tRNA	Paramecium_bursaria_Chlorella_virus(66.67%)	3	NA	NA
WP_061374816.1|1470993_1472832_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	46.1	1.5e-140
WP_014581273.1|1472947_1475002_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.1	7.6e-53
WP_002220067.1|1475079_1476033_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	30.2	6.2e-26
>prophage 103
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1486846	1491123	2280611		Synechococcus_phage(50.0%)	4	NA	NA
WP_014581267.1|1486846_1488295_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	33.3	5.4e-37
WP_014581266.1|1488357_1489629_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_115435280.1|1489669_1490119_+	CopD family copper resistance protein	NA	NA	NA	NA	NA
WP_014581264.1|1490151_1491123_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.2	2.5e-46
>prophage 104
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1495321	1495972	2280611		Planktothrix_phage(100.0%)	1	NA	NA
WP_002215189.1|1495321_1495972_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.7	5.6e-26
>prophage 105
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1500322	1502917	2280611		Klosneuvirus(100.0%)	1	NA	NA
WP_002223232.1|1500322_1502917_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.7	8.2e-28
>prophage 106
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1509041	1513600	2280611	transposase	Streptococcus_phage(33.33%)	5	NA	NA
WP_002235309.1|1509041_1509653_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	2.8e-19
WP_014581603.1|1509704_1510022_-	DUF4298 domain-containing protein	NA	NA	NA	NA	NA
WP_002224204.1|1510179_1511451_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002220011.1|1511484_1512087_+	L-threonylcarbamoyladenylate synthase	NA	S4VW33	Pandoravirus	30.3	5.9e-06
WP_002217985.1|1512634_1513600_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	4.7e-37
>prophage 107
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1518416	1522866	2280611		Klosneuvirus(33.33%)	3	NA	NA
WP_002223223.1|1518416_1519310_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	28.6	4.2e-08
WP_002227769.1|1519412_1520516_+	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	30.2	8.9e-08
WP_002223221.1|1521408_1522866_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.7	4.1e-61
>prophage 108
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1533758	1537241	2280611		Dickeya_phage(50.0%)	3	NA	NA
WP_014581601.1|1533758_1535102_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	82.5	3.7e-56
WP_014581600.1|1535414_1536215_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_002238447.1|1536254_1537241_+	S49 family peptidase	NA	A0A1B0WM92	Flavobacterium_phage	31.2	3.0e-07
>prophage 109
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1561275	1563143	2280611		Caulobacter_phage(50.0%)	3	NA	NA
WP_002217774.1|1561275_1561869_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	36.2	2.8e-16
WP_002217775.1|1561873_1562221_-	YraN family protein	NA	NA	NA	NA	NA
WP_002217776.1|1562267_1563143_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	33.9	2.5e-37
>prophage 110
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1567062	1574245	2280611	tRNA	Moumouvirus(25.0%)	8	NA	NA
WP_014581594.1|1567062_1568484_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.4	1.6e-46
WP_002223195.1|1568566_1569346_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.1	1.2e-35
WP_014581593.1|1569332_1569677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002235285.1|1569687_1570218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246521.1|1570310_1571426_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002215045.1|1571601_1572183_+	RDD family protein	NA	NA	NA	NA	NA
WP_002227750.1|1572244_1573099_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.6	3.7e-30
WP_002224176.1|1573738_1574245_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	39.3	2.6e-23
>prophage 111
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1602408	1607805	2280611		Hokovirus(50.0%)	6	NA	NA
WP_002223169.1|1602408_1603233_+	DNA ligase	NA	A0A1X9VNU1	Mimivirus	30.0	5.4e-26
WP_002223168.1|1603301_1603865_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	34.1	3.2e-06
WP_002214994.1|1603947_1604385_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002219949.1|1604453_1604723_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_002219948.1|1604722_1606498_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	5.6e-12
WP_002225688.1|1606866_1607805_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	9.8e-32
>prophage 112
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1629622	1630306	2280611		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002223156.1|1629622_1630306_+	membrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	40.3	6.5e-25
>prophage 113
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1640211	1641303	2280611		Clostridium_phage(100.0%)	1	NA	NA
WP_002223147.1|1640211_1641303_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	29.1	2.1e-25
>prophage 114
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1646640	1650860	2280611	transposase	Paenibacillus_phage(50.0%)	4	NA	NA
WP_086558185.1|1646640_1647392_-|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_061732571.1|1647428_1647638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223143.1|1647681_1649325_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002223142.1|1649468_1650860_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	31.2	1.8e-45
>prophage 115
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1655222	1672779	2280611		Clostridioides_phage(20.0%)	12	NA	NA
WP_002219917.1|1655222_1655978_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	48.6	4.3e-22
WP_014581586.1|1656222_1657131_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002227713.1|1657198_1658653_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014581585.1|1658884_1663357_-	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	36.9	9.3e-80
WP_014581584.1|1663663_1664422_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_014581583.1|1664516_1668473_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.6	5.6e-113
WP_003710665.1|1668630_1668843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214902.1|1668937_1669276_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_014581582.1|1669334_1670093_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	9.1e-12
WP_014574268.1|1670175_1670802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014581581.1|1670846_1671821_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002238174.1|1671810_1672779_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.5	7.5e-43
>prophage 116
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1680628	1684999	2280611		Enterobacterial_phage(100.0%)	1	NA	NA
WP_115435285.1|1680628_1684999_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	34.0	4.5e-79
>prophage 117
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1688506	1691302	2280611		uncultured_virus(100.0%)	1	NA	NA
WP_002235242.1|1688506_1691302_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.4	1.8e-73
>prophage 118
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1698201	1705235	2280611	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_086558185.1|1698201_1698952_+|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_002214868.1|1699164_1699455_+	co-chaperone GroES	NA	A0A221S308	uncultured_virus	42.6	7.5e-15
WP_002248549.1|1699547_1701182_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.0	2.4e-174
WP_012779597.1|1701877_1703395_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_014581577.1|1703453_1705235_-	para-aminobenzoate synthase	NA	S4VT78	Pandoravirus	29.2	1.2e-35
>prophage 119
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1709690	1710491	2280611		Bacillus_virus(100.0%)	1	NA	NA
WP_002221642.1|1709690_1710491_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.6e-25
>prophage 120
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1715085	1715253	2280611		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_024465111.1|1715085_1715253_-	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.0	1.6e-06
>prophage 121
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1720466	1728020	2280611		Bacillus_virus(25.0%)	8	NA	NA
WP_162819263.1|1720466_1720913_-	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	31.7	6.8e-07
WP_002214819.1|1721044_1721257_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002227691.1|1721545_1723393_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	39.1	2.5e-15
WP_160336981.1|1723910_1724660_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.8	2.9e-34
WP_002226745.1|1724661_1725348_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002224121.1|1725507_1726371_+	membrane protein	NA	NA	NA	NA	NA
WP_002214807.1|1726432_1727131_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_002218058.1|1727159_1728020_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.4	1.1e-13
>prophage 122
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1739584	1741984	2280611		Catovirus(100.0%)	3	NA	NA
WP_002259765.1|1739584_1739986_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.9	5.1e-06
WP_101090829.1|1740028_1740931_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_019742909.1|1740985_1741984_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.9	9.5e-09
>prophage 123
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1750825	1755164	2280611		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_002223073.1|1750825_1751572_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	1.7e-15
WP_002223072.1|1751633_1753199_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.8e-20
WP_002227678.1|1753298_1755164_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	26.5	1.7e-35
>prophage 124
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1767665	1768769	2280611		Rhizobium_phage(100.0%)	1	NA	NA
WP_002223059.1|1767665_1768769_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	35.4	4.5e-52
>prophage 125
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1773238	1777026	2280611	tRNA	Staphylococcus_phage(33.33%)	3	NA	NA
WP_061728247.1|1773238_1775869_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.2	5.0e-182
WP_061728248.1|1776097_1776889_+	restriction endonuclease	NA	A0A2P0QEG9	Haloarcula_hispanica_pleomorphic_virus	50.0	5.4e-07
WP_079762054.1|1776885_1777026_+	DNA adenine methylase	NA	R9TL68	Synechococcus_phage	55.6	2.7e-07
>prophage 126
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1793900	1794542	2280611		Hokovirus(100.0%)	1	NA	NA
WP_002223035.1|1793900_1794542_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	28.6	7.0e-05
>prophage 127
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1798854	1799772	2280611		Gordonia_phage(100.0%)	1	NA	NA
WP_002217973.1|1798854_1799772_+	tyrosine recombinase XerC	NA	A0A1B3B212	Gordonia_phage	26.8	5.8e-13
>prophage 128
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1805702	1806314	2280611		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002225781.1|1805702_1806314_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.1	2.3e-29
>prophage 129
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1811946	1812846	2280611		Burkholderia_virus(100.0%)	1	NA	NA
WP_002214623.1|1811946_1812846_+	LysR family transcriptional regulator CrgA	NA	Q6JIH3	Burkholderia_virus	23.3	5.0e-09
>prophage 130
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1819129	1820263	2280611		Halovirus(100.0%)	1	NA	NA
WP_002223013.1|1819129_1820263_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.4	7.6e-47
>prophage 131
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1834689	1842306	2280611	tRNA	Pseudomonas_phage(33.33%)	4	NA	NA
WP_115435319.1|1834689_1836570_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	34.7	6.9e-53
WP_002223003.1|1836632_1837928_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.1	1.2e-85
WP_002223001.1|1838454_1839375_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002223000.1|1839516_1842306_+|tRNA	isoleucine--tRNA ligase	tRNA	L7Y3E1	Megavirus	26.1	1.5e-75
>prophage 132
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1849100	1852535	2280611		Streptomyces_phage(100.0%)	1	NA	NA
WP_002222991.1|1849100_1852535_-	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	35.7	4.3e-178
>prophage 133
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1856121	1859255	2280611		Megavirus(50.0%)	2	NA	NA
WP_002222987.1|1856121_1858032_-	NADH-dependent dehydratase PglD	NA	L7Y3T9	Megavirus	27.1	6.0e-20
WP_002222986.1|1858079_1859255_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	49.9	1.2e-106
>prophage 134
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1862412	1863522	2280611		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014581550.1|1862412_1863522_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.9	1.4e-48
>prophage 135
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1881920	1945982	2280611	tRNA,transposase	Moraxella_phage(35.71%)	52	NA	NA
WP_002222974.1|1881920_1882985_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.1	6.4e-88
WP_002222973.1|1883028_1883880_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_002219782.1|1884261_1885431_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.4	2.9e-126
WP_014581546.1|1885602_1886610_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_086558185.1|1886825_1887577_-|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_002234261.1|1887801_1888026_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	54.8	7.8e-12
WP_100199148.1|1888038_1888446_+	chromosome partitioning protein ParA	NA	K7R2R7	Vibrio_phage	50.0	1.3e-28
WP_002214489.1|1888488_1888692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086558185.1|1888899_1889650_+|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_049776676.1|1889730_1890876_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002220746.1|1890882_1891089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002261717.1|1891112_1891448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002248022.1|1891482_1893579_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.8	1.2e-32
WP_002214479.1|1893580_1894843_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002214477.1|1895112_1895952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115435291.1|1895992_1897000_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002222967.1|1897942_1899352_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_002222966.1|1899516_1900083_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002222940.1|1900652_1901966_+	CitMHS family transporter	NA	NA	NA	NA	NA
WP_101125614.1|1902389_1903610_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_002214463.1|1903643_1905137_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002221441.1|1905349_1905607_+	glutaredoxin 3	NA	A0A1X7BZ88	Faustovirus	32.4	9.6e-06
WP_002214461.1|1905627_1906071_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_014581543.1|1906156_1908199_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_002222937.1|1909261_1910305_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_002222936.1|1910301_1910583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002239280.1|1910834_1911155_+	cupin	NA	NA	NA	NA	NA
WP_002237323.1|1911266_1911983_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002249064.1|1911991_1912198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222935.1|1912209_1912419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222933.1|1912402_1912762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162467417.1|1913394_1913550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221436.1|1913915_1914218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002236088.1|1914501_1914741_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_115435292.1|1914801_1916544_+	two-partner secretion system transporter TpsB1	NA	A0A0R6PI85	Moraxella_phage	27.5	1.8e-31
WP_115435293.1|1916653_1922752_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	24.0	4.4e-64
WP_002214437.1|1922767_1923199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014580961.1|1923343_1926007_+	S-layer family protein	NA	A0A0R6PJK4	Moraxella_phage	33.2	8.7e-33
WP_002219760.1|1926013_1926523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025458570.1|1926582_1928271_+	S-layer family protein	NA	A0A0R6PJK4	Moraxella_phage	51.5	8.0e-16
WP_002217880.1|1928279_1928657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224016.1|1928934_1929309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115435294.1|1929343_1931149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061726307.1|1931151_1932087_+	immunity 49 family protein	NA	NA	NA	NA	NA
WP_061732599.1|1932849_1933338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217985.1|1933401_1934367_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	4.7e-37
WP_002224040.1|1942492_1942909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002225626.1|1942977_1943991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002233812.1|1943962_1944271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002225624.1|1944282_1944597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014581538.1|1944762_1945164_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_086558185.1|1945231_1945982_+|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
>prophage 136
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1950515	1951928	2280611		Clostridioides_phage(100.0%)	1	NA	NA
WP_002227071.1|1950515_1951928_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	29.7	2.3e-24
>prophage 137
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1956016	1956397	2280611	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_002222952.1|1956016_1956397_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.5	3.7e-22
>prophage 138
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1962822	1963857	2280611		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_002222083.1|1962822_1963857_-	replication protein	NA	S0F3I3	Stenotrophomonas_phage	31.8	3.1e-23
>prophage 139
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	1978387	1996828	2280611		Moraxella_phage(71.43%)	10	NA	NA
WP_002237722.1|1978387_1978873_-	DNA helicase	NA	Q7Y5V9	Haemophilus_phage	47.8	1.9e-18
WP_002219732.1|1978969_1979953_-	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	38.9	9.0e-36
WP_115435320.1|1979899_1981579_+	two-partner secretion system transporter TpsB1	NA	A0A0R6PI85	Moraxella_phage	27.5	1.8e-31
WP_014581532.1|1981688_1987886_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	24.0	4.4e-64
WP_002219725.1|1987890_1988274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115435295.1|1988523_1990848_+	S-layer family protein	NA	A0A0R6PJK4	Moraxella_phage	33.9	1.7e-40
WP_002234239.1|1990866_1991130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115435296.1|1991236_1993522_+	S-layer family protein	NA	A0A0R6PJK4	Moraxella_phage	41.3	5.5e-36
WP_002214437.1|1993537_1993969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115435297.1|1994113_1996828_+	S-layer family protein	NA	A0A0R6PJK4	Moraxella_phage	33.2	8.8e-33
>prophage 140
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2007421	2012404	2280611		Bacillus_phage(25.0%)	7	NA	NA
WP_002244020.1|2007421_2007703_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	56.0	3.2e-07
WP_002217875.1|2007723_2008950_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_002222914.1|2009494_2010154_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	55.0	5.4e-61
WP_002222913.1|2010181_2010700_+	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_002222912.1|2010706_2011129_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	41.0	9.2e-22
WP_002222911.1|2011397_2011769_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_002222910.1|2011765_2012404_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1V0DYC7	Dinoroseobacter_phage	34.8	2.4e-13
>prophage 141
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2015905	2082483	2280611	transposase,protease,tRNA	Staphylococcus_phage(15.38%)	55	NA	NA
WP_002214418.1|2015905_2017405_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.2	8.3e-25
WP_002217860.1|2017542_2018172_-	endonuclease III	NA	NA	NA	NA	NA
WP_002224005.1|2018217_2018631_-	DedA family protein	NA	NA	NA	NA	NA
WP_002217858.1|2019220_2020444_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_002227587.1|2020734_2022114_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_002219709.1|2022243_2023068_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_061728245.1|2023069_2023585_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002254851.1|2023703_2024639_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_002231852.1|2025042_2026236_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002217852.1|2026317_2026815_-	DNA-mimic protein DMP19	NA	NA	NA	NA	NA
WP_002217851.1|2026930_2027134_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_061728244.1|2027302_2028889_-	L-lactate permease	NA	NA	NA	NA	NA
WP_002230310.1|2029157_2029880_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_009345706.1|2029876_2030128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014581529.1|2030129_2033615_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_014581528.1|2033779_2034826_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	27.4	3.2e-23
WP_014581527.1|2035108_2035495_-	type IV pilin protein	NA	NA	NA	NA	NA
WP_002214393.1|2035720_2036899_+	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	55.8	2.3e-06
WP_002240344.1|2036964_2038899_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-36
WP_002214390.1|2039216_2039999_-	DsbC family protein	NA	NA	NA	NA	NA
WP_115435300.1|2040137_2042327_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_061825456.1|2043494_2044481_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	34.0	1.3e-26
WP_002214383.1|2045514_2047443_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.6	9.0e-149
WP_002222886.1|2047650_2047923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222885.1|2048108_2048795_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	36.4	6.3e-28
WP_002219692.1|2048926_2049265_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.7	4.4e-27
WP_002222884.1|2049424_2049889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214375.1|2049923_2051435_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	32.9	1.7e-38
WP_002214372.1|2051791_2052610_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_002214370.1|2052793_2053372_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002219688.1|2053495_2053711_-	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_002222883.1|2053736_2054792_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002227574.1|2055085_2056093_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_061729912.1|2056487_2057453_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	5.2e-36
WP_002222881.1|2057623_2058841_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_002214363.1|2058854_2059448_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_002214361.1|2059451_2060078_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_002221363.1|2060077_2060854_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_002222880.1|2060846_2062079_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_002236764.1|2062081_2063425_-	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_002222877.1|2063774_2065196_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002222875.1|2065556_2065916_-	YbaN family protein	NA	NA	NA	NA	NA
WP_002231938.1|2065912_2066509_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_002221359.1|2066564_2067047_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004519544.1|2067320_2067587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222873.1|2067557_2068658_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_033908566.1|2068804_2069206_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_002214343.1|2069357_2070605_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_041917673.1|2072568_2073219_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	8.9e-24
WP_115435301.1|2073357_2073852_+	copper-binding protein	NA	NA	NA	NA	NA
WP_014581524.1|2073939_2075601_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002222865.1|2075730_2076273_-	peptidase C39	NA	NA	NA	NA	NA
WP_002227566.1|2077498_2078152_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_086558185.1|2078658_2079410_-|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_115435302.1|2080050_2082483_+	calcium-binding protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	39.0	1.7e-19
>prophage 142
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2091616	2092294	2280611		Bacillus_phage(100.0%)	1	NA	NA
WP_002214312.1|2091616_2092294_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	2.5e-29
>prophage 143
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2095314	2096085	2280611		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002227557.1|2095314_2096085_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.5	3.9e-26
>prophage 144
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2099322	2105827	2280611		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_002227552.1|2099322_2100432_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	28.8	1.8e-32
WP_002226590.1|2100559_2100826_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	49.4	1.0e-10
WP_002227551.1|2101037_2102891_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002219655.1|2102894_2103830_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	5.5e-43
WP_002217790.1|2104052_2104322_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002254252.1|2104420_2104564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222840.1|2104702_2105827_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.8e-27
>prophage 145
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2113381	2115766	2280611		Hokovirus(100.0%)	1	NA	NA
WP_014581520.1|2113381_2115766_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.1	5.9e-174
>prophage 146
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2123385	2124981	2280611		Tupanvirus(100.0%)	1	NA	NA
WP_002226578.1|2123385_2124981_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	35.7	3.2e-14
>prophage 147
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2129520	2130579	2280611		Planktothrix_phage(100.0%)	1	NA	NA
WP_002219640.1|2129520_2130579_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	6.3e-27
>prophage 148
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2135353	2137717	2280611		Bacillus_phage(50.0%)	4	NA	NA
WP_002225519.1|2135353_2136223_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.1	3.5e-68
WP_002222823.1|2136250_2136850_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_002227538.1|2136842_2137076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002222820.1|2137183_2137717_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	37.7	6.4e-20
>prophage 149
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2151492	2157728	2280611		Clostridioides_phage(50.0%)	6	NA	NA
WP_002219611.1|2151492_2152323_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R2ZGN5	Clostridioides_phage	36.9	6.3e-06
WP_002227534.1|2152399_2152789_-	RidA family protein	NA	NA	NA	NA	NA
WP_002219609.1|2152924_2153449_-	outer membrane beta-barrel protein NspA	NA	NA	NA	NA	NA
WP_010980824.1|2153619_2153814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227533.1|2154033_2155233_-	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_033910078.1|2155265_2157728_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.2	1.1e-117
>prophage 150
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2161129	2161750	2280611		Bacteriophage(100.0%)	1	NA	NA
WP_002222793.1|2161129_2161750_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	40.2	2.7e-30
>prophage 151
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2172910	2173387	2280611		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014581517.1|2172910_2173387_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.6	2.0e-17
>prophage 152
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2178299	2179844	2280611		Mollivirus(100.0%)	1	NA	NA
WP_002222778.1|2178299_2179844_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.1	4.8e-84
>prophage 153
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2183742	2184471	2280611		Planktothrix_phage(100.0%)	1	NA	NA
WP_002217681.1|2183742_2184471_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	1.6e-34
>prophage 154
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2187910	2193271	2280611		Enterobacterial_phage(100.0%)	1	NA	NA
WP_115435306.1|2187910_2193271_-	IgA-specific serine endopeptidase autotransporter	NA	Q9LA58	Enterobacterial_phage	38.1	6.1e-78
>prophage 155
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2206008	2206872	2280611		Salicola_phage(100.0%)	1	NA	NA
WP_002217665.1|2206008_2206872_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.0	1.5e-42
>prophage 156
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2212279	2227455	2280611	tRNA	uncultured_Mediterranean_phage(14.29%)	15	NA	NA
WP_002221244.1|2212279_2213395_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.0	5.7e-87
WP_002222759.1|2213703_2215617_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	2.4e-125
WP_010951024.1|2215634_2216156_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.0	2.5e-13
WP_002232040.1|2216302_2216500_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002214103.1|2216512_2216872_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002217654.1|2217217_2218210_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.1	2.0e-30
WP_002222757.1|2218392_2219451_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_002222756.1|2219453_2220923_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_002217650.1|2220919_2221570_+	site-specific DNA-methyltransferase	NA	Q5ZGB2	Flavobacterium_phage	50.2	1.9e-50
WP_014581513.1|2221594_2223958_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002214080.1|2224031_2224334_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	37.4	6.8e-11
WP_002214078.1|2224317_2224626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222754.1|2224955_2225441_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_002227501.1|2225700_2225940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229230.1|2226153_2227455_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	7.0e-20
>prophage 157
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2231088	2233668	2280611		Corynebacterium_phage(50.0%)	3	NA	NA
WP_002222747.1|2231088_2231943_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	32.8	9.0e-08
WP_002222746.1|2232023_2232965_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002217634.1|2233065_2233668_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.9	2.3e-18
>prophage 158
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2241390	2248404	2280611		Staphylococcus_phage(25.0%)	9	NA	NA
WP_002227494.1|2241390_2241957_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	40.2	2.8e-34
WP_002214042.1|2242041_2242335_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014580525.1|2242463_2243414_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002214039.1|2243825_2244266_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_002227491.1|2244317_2245193_+	site-specific tyrosine recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	31.2	7.5e-18
WP_002227489.1|2245364_2245565_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_002227488.1|2245730_2245964_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_002227487.1|2246478_2247342_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.9	5.8e-39
WP_002227486.1|2247540_2248404_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.5	8.7e-51
>prophage 159
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2253595	2262263	2280611		Streptococcus_phage(100.0%)	7	NA	NA
WP_002217611.1|2253595_2254528_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	56.5	6.4e-84
WP_033909161.1|2254990_2255890_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014581510.1|2256154_2257174_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002222735.1|2257316_2259110_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.6	1.0e-21
WP_002222734.1|2259252_2259954_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002222733.1|2260139_2261252_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_002223913.1|2261285_2262263_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.2	9.6e-14
>prophage 160
NZ_CP031333	Neisseria meningitidis strain M18727 chromosome, complete genome	2280611	2273690	2277305	2280611		Bacillus_phage(100.0%)	1	NA	NA
WP_115435311.1|2273690_2277305_-	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	20.8	5.9e-08
