The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031321	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	149196	213141	4733230	capsid,tail,integrase,portal,lysis,head,plate,tRNA,holin,terminase	Escherichia_phage(45.45%)	67	154254:154281	185872:185899
WP_000675150.1|149196_150600_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|150596_151319_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|151509_151842_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|152050_152347_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|152348_152645_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|152747_154109_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
154254:154281	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|154381_154600_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_020240659.1|154681_155845_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_000978903.1|155844_156324_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.1	9.6e-84
WP_115431548.1|156338_158786_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	94.8	0.0e+00
WP_001496926.1|158778_158898_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|158930_159206_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|159262_159781_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|159793_160984_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_021517188.1|162200_162728_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.4e-91
WP_115431549.1|162731_165050_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.8	2.4e-212
WP_001285314.1|165060_165591_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_001121497.1|165583_166492_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_001735426.1|166496_166844_-	lysozyme family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
WP_001093748.1|166840_167476_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	7.2e-111
WP_001774103.1|167542_167995_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
WP_000917153.1|167987_168455_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	5.1e-82
WP_115431550.1|168417_168591_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	1.5e-23
WP_115431551.1|168562_168988_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	7.2e-67
WP_097370156.1|168975_169401_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	1.4e-57
WP_001144101.1|169415_169913_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|169912_170194_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|170197_170401_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|170400_170910_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203462.1|171009_171753_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_021541106.1|171756_172830_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	1.1e-199
WP_000156872.1|173915_175688_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038162.1|175687_176716_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|176774_177347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|177339_178773_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_115431552.1|179937_182214_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027667.1|182203_182479_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|182475_182700_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277897.1|182699_183002_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_115431553.1|183001_183226_-	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	97.3	5.2e-32
WP_000217670.1|183289_183790_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|183967_184243_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|184364_184664_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|184778_185792_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001352710.1|186056_186374_-	hypothetical protein	NA	NA	NA	NA	NA
185872:185899	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|186779_187679_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|187760_188540_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|188639_189680_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490714.1|189727_191083_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|191086_191371_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|191401_191854_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|191863_193126_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000129551.1|194317_195370_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|195626_196904_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846224.1|196900_197905_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_001297420.1|199637_200456_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|200520_201321_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|201317_202106_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|202328_202601_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134569.1|202721_203546_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|203764_204103_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000945468.1|205236_207717_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|207732_208407_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|208487_209030_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|209322_209604_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|209866_210976_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|211107_213141_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 2
NZ_CP031321	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	225652	235093	4733230		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001349937.1|225652_226789_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001349936.1|226785_228786_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|228910_229372_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|229411_229882_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|229928_230648_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|230644_232330_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|232551_233283_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|233342_233450_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|233430_234162_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569367.1|234166_235093_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
>prophage 3
NZ_CP031321	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	815099	822239	4733230		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|815099_817661_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|817766_818423_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272549.1|818473_819271_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|819436_820345_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|820341_821604_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|821600_822239_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 4
NZ_CP031321	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	1854826	1861327	4733230		Enterobacteria_phage(100.0%)	8	NA	NA
WP_001673082.1|1854826_1855399_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	98.9	3.1e-97
WP_000984202.1|1855413_1855659_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_001149160.1|1856941_1857208_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_115431597.1|1857204_1857795_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	98.5	8.2e-69
WP_001244664.1|1857787_1858075_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_000459295.1|1858067_1858523_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|1858658_1858979_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_115431598.1|1858993_1861327_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 5
NZ_CP031321	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	2965947	2972726	4733230	integrase	Enterobacteria_phage(100.0%)	8	2964078:2964091	2976153:2976166
2964078:2964091	attL	CTGCCGCCATTCTT	NA	NA	NA	NA
WP_001130499.1|2965947_2967153_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.7	5.5e-144
WP_115431643.1|2967127_2968510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446128.1|2968711_2969284_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	2.5e-94
WP_000638629.1|2969357_2969858_-	transactivation protein	NA	NA	NA	NA	NA
WP_094122397.1|2969854_2970589_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	1.4e-129
WP_001149156.1|2971140_2971407_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	6.3e-45
WP_001244665.1|2971990_2972278_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_115431644.1|2972270_2972726_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	5.2e-63
2976153:2976166	attR	CTGCCGCCATTCTT	NA	NA	NA	NA
>prophage 6
NZ_CP031321	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	3243246	3303391	4733230	capsid,tail,integrase,portal,lysis,transposase,head,tRNA,protease,terminase	Enterobacteria_phage(51.79%)	71	3253408:3253454	3303815:3303861
WP_000912345.1|3243246_3244632_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143543.1|3244667_3245189_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3245296_3245509_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|3245510_3246377_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3246857_3247400_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|3247619_3248312_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|3250964_3251972_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250423.1|3251982_3252498_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|3252500_3253133_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3253408:3253454	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001406354.1|3253467_3254631_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	4.4e-199
WP_000446906.1|3254486_3254858_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	4.7e-46
WP_000488407.1|3254829_3255108_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763384.1|3255164_3255374_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	4.4e-33
WP_000188859.1|3255472_3255688_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548537.1|3255764_3255956_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|3255928_3256111_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000100841.1|3256783_3257569_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995433.1|3257574_3257871_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|3257946_3258153_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|3258748_3259504_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|3259542_3259773_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|3259842_3260382_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001435464.1|3260468_3261398_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000145915.1|3262092_3262395_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|3262462_3262795_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001299444.1|3262842_3262992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001306955.1|3265041_3265593_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|3265602_3266400_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|3266516_3266618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|3266614_3267070_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|3267069_3267240_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|3267232_3267523_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|3267519_3267882_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971068.1|3267878_3268019_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|3268104_3268488_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|3268676_3269759_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|3270348_3270564_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|3270563_3271061_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|3271277_3271460_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001558756.1|3271550_3271844_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	1.3e-43
WP_001307652.1|3272204_3272399_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|3272788_3273334_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|3273308_3275234_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|3275230_3275437_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358553.1|3275433_3277035_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_115431654.1|3277015_3278335_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_001358225.1|3278344_3278677_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063250.1|3278732_3279758_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_001558759.1|3279799_3280195_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	94.7	4.4e-58
WP_000785282.1|3280206_3280560_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|3280571_3281150_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|3281146_3281542_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001358372.1|3281549_3282290_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000479153.1|3282305_3282728_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|3282709_3283144_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_115431655.1|3283136_3285716_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.3	0.0e+00
WP_000847379.1|3285712_3286042_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152632.1|3286041_3286740_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000090891.1|3287424_3288057_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001558762.1|3288116_3291614_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
WP_001233090.1|3291684_3292284_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_115431738.1|3292348_3295375_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_115431657.1|3295371_3296091_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	73.1	4.6e-90
WP_085947772.1|3296060_3297274_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001354832.1|3297543_3298119_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	7.9e-101
WP_000087131.1|3298216_3298807_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.3	4.7e-24
WP_000836765.1|3299125_3299359_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|3299427_3299541_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239872.1|3299906_3300575_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|3301438_3302188_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201857.1|3302437_3303391_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
3303815:3303861	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 7
NZ_CP031321	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 chromosome, complete genome	4733230	4021333	4084567	4733230	capsid,tail,integrase,portal,head,plate,protease,holin,terminase	Enterobacteria_phage(33.33%)	68	4013828:4013841	4023841:4023854
4013828:4013841	attL	GCTGAAGAAGTAAA	NA	NA	NA	NA
WP_000113656.1|4021333_4022464_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	5.7e-103
WP_000113184.1|4022441_4022690_-	excisionase	NA	NA	NA	NA	NA
WP_115431688.1|4022753_4025225_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	5.5e-58
4023841:4023854	attR	TTTACTTCTTCAGC	NA	NA	NA	NA
WP_001090191.1|4025305_4025509_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_049595150.1|4025511_4025694_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_033557427.1|4026180_4026756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4026757_4026913_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362155.1|4027178_4027598_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|4027698_4027980_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693832.1|4027963_4028389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029393094.1|4028460_4029531_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	1.4e-63
WP_029393093.1|4029571_4029994_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.3	1.5e-61
WP_122358658.1|4034469_4034577_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	93.1	9.4e-08
WP_001013636.1|4034621_4034834_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001325325.1|4035292_4035571_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_115431689.1|4035572_4036622_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	5.9e-110
WP_112868901.1|4036634_4037003_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	8.5e-32
WP_077793029.1|4036992_4037364_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	8.8e-53
WP_049595169.1|4037514_4038333_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917767.1|4038618_4038816_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_115431690.1|4038966_4040013_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.6	7.7e-187
WP_001362368.1|4041515_4041908_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.2	8.2e-49
WP_000950574.1|4041897_4042173_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	2.8e-43
WP_049595171.1|4042175_4042553_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	99.2	3.5e-65
WP_137466152.1|4042567_4042750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089572303.1|4042924_4043221_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	93.9	6.2e-49
WP_115431691.1|4043280_4043949_+	hypothetical protein	NA	G8EY51	Synechococcus_phage	28.8	3.5e-07
WP_063079836.1|4044709_4045327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112868902.1|4045280_4047260_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.3	4.5e-135
WP_112868903.1|4047256_4047508_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_089572172.1|4047516_4049157_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.5	9.2e-94
WP_063079839.1|4049153_4050014_+	S49 family peptidase	NA	A0A2H4PRE9	Proteus_phage	46.4	1.4e-48
WP_097427312.1|4050006_4050585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106372304.1|4050671_4050986_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001290410.1|4051041_4052097_+|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	31.5	9.6e-36
WP_000146203.1|4052098_4052284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918573.1|4052267_4052600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096093785.1|4052599_4053160_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000497760.1|4053173_4053410_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_115431692.1|4053406_4054909_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	43.9	2.0e-103
WP_049595179.1|4054948_4055314_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_049595180.1|4055316_4055595_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_089584407.1|4055730_4057689_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	42.8	2.5e-21
WP_063079844.1|4057699_4059106_+	multidrug DMT transporter permease	NA	J7FAD8	Agrobacterium_phage	33.0	4.0e-05
WP_112868906.1|4059102_4060191_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	31.4	2.1e-38
WP_112868907.1|4060187_4060769_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	34.5	5.5e-17
WP_049595185.1|4060770_4061208_+	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	41.6	4.3e-22
WP_063079846.1|4061209_4062364_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	32.2	6.4e-33
WP_162821091.1|4062372_4066704_+	leucine-rich repeat protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	32.5	2.3e-14
WP_089578468.1|4066750_4067542_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	55.8	2.6e-17
WP_112868909.1|4067551_4068091_+|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	41.3	7.3e-32
WP_049595190.1|4068310_4069111_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049595191.1|4069728_4070292_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	71.2	2.9e-47
WP_001079504.1|4070936_4071443_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056495.1|4071488_4071989_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4072074_4072254_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|4072634_4073441_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|4073440_4074634_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001349891.1|4074645_4076004_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|4076007_4077603_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194600.1|4077602_4079165_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|4079256_4079301_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_115431694.1|4079438_4080320_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4080316_4080937_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|4081037_4081910_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|4081949_4082540_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|4082536_4083295_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_115431695.1|4083514_4084567_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 1
NZ_CP031322	Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence	75645	19891	50193	75645	protease,transposase	Escherichia_phage(42.86%)	35	NA	NA
WP_000971921.1|19891_21262_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_162821099.1|21260_21416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115431744.1|21462_22146_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.9e-130
WP_011091091.1|24833_25343_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|25390_27478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|27490_28441_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|28451_29714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|29758_30034_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|30258_30642_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|30721_31375_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011091026.1|31467_31725_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_015243648.1|31657_32059_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_011091030.1|32403_32838_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.4	4.7e-29
WP_011091031.1|32786_34091_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.8	1.2e-112
WP_015058924.1|34113_34962_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	38.9	5.0e-27
WP_004187415.1|34964_35285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050868822.1|35429_35681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|36136_36346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091034.1|36348_36567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091035.1|36611_37295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011091036.1|37291_37564_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012579093.1|37581_38856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045626298.1|39382_39727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060453260.1|39730_39910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187403.1|39909_40494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115431745.1|40839_41523_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_000050481.1|42256_43798_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|44202_45042_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|45035_45371_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|45263_45629_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|45632_46508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015058923.1|47334_47994_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|47998_48364_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|48367_49180_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_001067855.1|49488_50193_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
