The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022593	Mycoplasma bovis strain NADC57 chromosome, complete genome	978015	73600	84961	978015	tRNA	Bodo_saltans_virus(28.57%)	8	NA	NA
WP_013954527.1|73600_74581_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.9e-15
WP_115266292.1|74584_75406_+	alpha/beta fold hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	3.9e-08
WP_115266293.1|75489_76254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456612.1|76246_77227_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.3	1.8e-52
WP_115266294.1|77351_81728_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	8.1e-12
WP_115266295.1|82133_83357_+	AAA family ATPase	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_115266296.1|83346_84312_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013456493.1|84301_84961_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP022593	Mycoplasma bovis strain NADC57 chromosome, complete genome	978015	157789	249215	978015	tRNA,transposase,integrase	Enterobacteria_phage(14.29%)	59	236108:236135	245998:246025
WP_075271214.1|157789_158926_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_013455960.1|158969_159248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143823108.1|159289_160771_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_174245895.1|161002_162469_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_075271216.1|163099_165535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271217.1|165686_168176_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.9	5.8e-140
WP_075271218.1|168178_169039_+	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	1.3e-33
WP_013954592.1|169138_170095_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013954593.1|170098_171292_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_101456651.1|171307_171730_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_101456652.1|171729_172311_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_101456653.1|172338_173835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456654.1|173971_175408_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_101456655.1|175476_176457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456656.1|176707_178501_+	molecular chaperone DnaK	NA	A0A0G2YAL1	Acanthamoeba_polyphaga_mimivirus	45.8	2.5e-129
WP_174245822.1|178694_180296_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_115266318.1|180602_181886_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013954601.1|182044_182428_+	membrane protein	NA	NA	NA	NA	NA
WP_115266319.1|182565_183555_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.9	7.9e-40
WP_115266320.1|183964_184765_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013954605.1|184880_185042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954606.1|185218_185671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266321.1|185838_188262_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_013455963.1|191798_193304_-	trigger factor	NA	NA	NA	NA	NA
WP_013456067.1|194860_195316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174245811.1|195880_196039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954613.1|196167_197577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456364.1|197546_199853_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013954995.1|200073_201318_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_115300205.1|201644_202415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115300206.1|202555_204391_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_078086164.1|205771_207373_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013456284.1|207619_208849_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_013456433.1|208959_210321_+	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	56.4	3.1e-103
WP_013455911.1|210424_211321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456619.1|211320_212625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271001.1|213004_214189_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_075271002.1|214405_215407_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	23.1	1.7e-10
WP_013456213.1|215583_215823_+	hypothetical protein	NA	A0A172JI00	Bacillus_phage	40.9	4.6e-10
WP_013456099.1|215894_216719_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013456411.1|216737_218096_+	signal recognition particle protein	NA	D6PHS7	uncultured_phage	29.0	8.7e-05
WP_013456353.1|218112_219078_+	YwaF family protein	NA	NA	NA	NA	NA
WP_115266325.1|219294_220443_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	52.2	8.4e-102
WP_013456580.1|220705_221107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115266326.1|221097_222489_-|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	24.9	1.1e-07
WP_115266327.1|222776_224819_+	peptidase S41	NA	NA	NA	NA	NA
WP_115266328.1|224845_226804_+	peptidase S41	NA	NA	NA	NA	NA
WP_013456193.1|226785_227340_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_174245901.1|228305_229907_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_115266330.1|231328_231808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115300208.1|231880_232519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455926.1|232893_235572_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.6	9.1e-91
WP_115300209.1|235576_236155_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
236108:236135	attL	TCCTTAATAACCCTTCATCAGCGTAAGC	NA	NA	NA	NA
WP_115266333.1|236278_237580_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_115300210.1|240126_241263_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_115300211.1|241271_244469_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_038582887.1|244514_245435_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	48.0	1.0e-78
WP_115300234.1|245449_245851_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954691.1|247970_249215_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
245998:246025	attR	GCTTACGCTGATGAAGGGTTATTAAGGA	NA	NA	NA	NA
>prophage 3
NZ_CP022593	Mycoplasma bovis strain NADC57 chromosome, complete genome	978015	373698	450501	978015	transposase,tRNA	Faecalibacterium_phage(26.67%)	57	NA	NA
WP_080551570.1|373698_374727_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013455983.1|375320_376283_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_013456269.1|376466_377525_+	site-specific DNA-methyltransferase	NA	S4VS49	Pandoravirus	29.4	2.8e-19
WP_078086167.1|377751_379353_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013456160.1|379486_380194_-	MjaI family restriction endonuclease	NA	E3SIW0	Synechococcus_phage	35.1	2.6e-21
WP_080551570.1|381325_382354_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_115300213.1|382489_383218_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_013456339.1|383432_384254_-	DNA-binding protein WhiA	NA	NA	NA	NA	NA
WP_013456083.1|384342_385530_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_013456498.1|385663_386911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455970.1|387046_389011_+	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	31.7	3.9e-83
WP_075271152.1|389196_391407_+	putative immunoglobulin-blocking virulence protein	NA	NA	NA	NA	NA
WP_075271115.1|391439_394049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271114.1|394123_396352_+	putative immunoglobulin-blocking virulence protein	NA	NA	NA	NA	NA
WP_075271112.1|396547_398797_+	putative immunoglobulin-blocking virulence protein	NA	NA	NA	NA	NA
WP_075271146.1|398826_401403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115300214.1|401456_402968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271108.1|402954_403452_+	DUF2714 domain-containing protein	NA	NA	NA	NA	NA
WP_075271107.1|403451_404372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271106.1|404371_404836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271104.1|404825_407069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041309119.1|407072_408647_+	ATP F0F1 synthase subunit alpha	NA	NA	NA	NA	NA
WP_013456309.1|408646_410026_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013456496.1|410048_411119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266350.1|411137_413528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456170.1|413683_414574_-	DegV family protein	NA	NA	NA	NA	NA
WP_013456573.1|414615_416262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115266351.1|416276_418481_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.1	6.2e-93
WP_013455988.1|418505_419174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456111.1|419175_420180_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_115266352.1|420189_421551_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	34.0	1.6e-67
WP_013456505.1|421914_422676_+	membrane protein	NA	NA	NA	NA	NA
WP_013456102.1|422825_423146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954838.1|423148_423727_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_013456233.1|423730_425191_+	magnesium transporter	NA	NA	NA	NA	NA
WP_013456142.1|425279_425582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456043.1|425581_426145_-	elongation factor P	NA	NA	NA	NA	NA
WP_013456488.1|426477_427416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456600.1|427582_429400_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	7.5e-36
WP_115266353.1|429392_431189_-	ATP-binding cassette domain-containing protein	NA	Q6GYZ6	Mycoplasma_phage	44.7	2.4e-34
WP_080551570.1|431444_432473_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456055.1|432860_434804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456447.1|434840_435770_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_115266354.1|435859_436135_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_013456282.1|436118_436958_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	34.1	3.8e-27
WP_115266356.1|436959_438252_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_115266357.1|438253_439504_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_013456131.1|439517_439850_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_115266358.1|439987_441352_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	54.4	7.6e-126
WP_115266359.1|441748_442939_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	25.9	7.5e-29
WP_115266360.1|443130_443535_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_115266361.1|443534_444092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266362.1|444093_445023_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	36.6	5.5e-51
WP_115266363.1|445047_446919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266364.1|446981_447353_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_115266507.1|447597_448626_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.9	1.9e-20
WP_115266365.1|449085_450501_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022593	Mycoplasma bovis strain NADC57 chromosome, complete genome	978015	592499	652782	978015	tRNA,transposase	Faecalibacterium_phage(20.0%)	44	NA	NA
WP_013456122.1|592499_594203_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	23.1	2.0e-14
WP_013456205.1|594271_595588_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.7e-11
WP_115266417.1|595826_597497_+	amino acid permease	NA	NA	NA	NA	NA
WP_013456295.1|597547_598003_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_115266418.1|598079_599408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456088.1|599542_599869_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013456362.1|599888_600287_-	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	30.3	9.3e-08
WP_013456432.1|600328_600766_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_174245815.1|601132_602986_+	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	32.2	3.7e-75
WP_115266512.1|603130_604177_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	26.6	1.3e-13
WP_174245828.1|604420_606934_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_013456114.1|607014_607260_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_115266421.1|607364_609116_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_115266422.1|609079_610012_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	4.4e-08
WP_115300220.1|610014_611370_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_115266424.1|611820_613614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266425.1|613725_615102_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.2	1.3e-53
WP_115300221.1|615143_617084_+	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.3	9.7e-42
WP_013954706.1|617076_618606_+	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_115266427.1|618610_619396_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_115266428.1|619506_620871_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078086165.1|621492_622521_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_080551570.1|622928_623957_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456509.1|624275_624779_+	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	32.8	7.4e-10
WP_115300222.1|624802_626656_+	peptidase S41	NA	NA	NA	NA	NA
WP_115266430.1|626687_627584_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_115266431.1|627633_628587_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013456029.1|629147_630560_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_115266432.1|630580_631402_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	45.4	2.3e-53
WP_115266433.1|631921_633283_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115266434.1|633352_633580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271012.1|633604_635914_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_115266435.1|635916_637755_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_115266513.1|637718_639806_+	peptidase S41	NA	NA	NA	NA	NA
WP_013455951.1|639917_641357_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013456519.1|641421_643032_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013456216.1|643024_644374_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-13
WP_013456029.1|644597_646010_-|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_115300223.1|646467_647229_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456502.1|647397_647697_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_013456595.1|647855_648764_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_099620126.1|648993_649314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456029.1|649881_651294_-|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_080551570.1|651753_652782_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
>prophage 5
NZ_CP022593	Mycoplasma bovis strain NADC57 chromosome, complete genome	978015	660118	717294	978015	transposase,integrase,tRNA	Faecalibacterium_phage(29.41%)	39	693659:693686	699073:699100
WP_080551570.1|660118_661147_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_115266439.1|661381_662449_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456451.1|662487_664257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115266440.1|664405_665230_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_115300224.1|665216_666191_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_115266442.1|666256_667474_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	32.5	3.5e-13
WP_013455955.1|667599_668391_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013456065.1|668544_668811_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_013456459.1|668901_669789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456636.1|669820_670663_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013456468.1|670655_671522_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_013456399.1|671592_673959_-	membrane protein	NA	NA	NA	NA	NA
WP_013456191.1|673995_674958_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	1.5e-06
WP_013455950.1|674938_675535_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_115266510.1|676130_677159_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_115266443.1|678017_679877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271156.1|680071_680782_-	signal peptidase II	NA	NA	NA	NA	NA
WP_115266444.1|680783_683462_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.4	5.6e-80
WP_080551570.1|683735_684764_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456530.1|685235_686855_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	39.8	1.0e-108
WP_080551570.1|687894_688923_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456106.1|692017_693469_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	24.6	3.2e-29
WP_115266445.1|693468_694776_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
693659:693686	attL	ATAATTGTTATTATGAGAAGTTTGAAGA	NA	NA	NA	NA
WP_115266510.1|694931_695960_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013456290.1|696644_697442_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	29.3	1.5e-20
WP_115266446.1|697772_698831_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_115266447.1|699836_702107_-	S8 family serine peptidase	NA	NA	NA	NA	NA
699073:699100	attR	TCTTCAAACTTCTCATAATAACAATTAT	NA	NA	NA	NA
WP_013954662.1|702108_703152_-	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_115266448.1|703624_705058_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456032.1|705203_707429_+	AAA family ATPase	NA	A0A2K9V9X6	Bandra_megavirus	26.6	3.4e-30
WP_013455939.1|708290_708953_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013456585.1|708939_709785_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013456514.1|709796_710795_-	serine/threonine protein kinase	NA	Q85453	Moloney_murine_sarcoma_virus	32.2	4.3e-17
WP_013456579.1|710812_711565_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456283.1|711570_712158_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_013456572.1|712500_712743_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456627.1|712745_714935_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_075270989.1|714955_715741_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014829889.1|715743_717294_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.7	1.9e-80
>prophage 6
NZ_CP022593	Mycoplasma bovis strain NADC57 chromosome, complete genome	978015	734015	833959	978015	transposase,tRNA	Faecalibacterium_phage(18.18%)	59	NA	NA
WP_080551570.1|734015_735044_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013954635.1|735644_736619_-	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	38.4	1.6e-48
WP_075271093.1|736806_737523_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013954633.1|737524_738454_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013954632.1|738595_741181_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	29.6	9.8e-90
WP_013954631.1|741194_743111_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	5.7e-119
WP_075271105.1|743214_744612_-	CvpA family protein	NA	NA	NA	NA	NA
WP_075271109.1|744624_745185_-	peptide deformylase	NA	NA	NA	NA	NA
WP_013954629.1|745252_745801_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075271113.1|745801_746821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115266515.1|746964_748680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456311.1|748790_749243_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_115300225.1|749229_751071_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_078086175.1|751293_752322_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013954624.1|752927_753377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041309277.1|755860_757192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456363.1|757825_759259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266451.1|759373_761227_-	LppA family lipoprotein	NA	NA	NA	NA	NA
WP_013456227.1|762020_764339_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013456262.1|764308_765733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456072.1|766239_769173_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	34.0	8.8e-87
WP_115266452.1|769174_770092_+	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	31.2	9.6e-32
WP_174245829.1|770552_772154_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013456376.1|772277_774320_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013456179.1|774484_776578_-	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	25.2	1.8e-54
WP_013456121.1|776607_777078_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004024001.1|777108_777522_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013456204.1|777842_779060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456632.1|779097_780711_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	2.4e-54
WP_013954980.1|782011_782356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115266454.1|782487_783342_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456540.1|783819_785208_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456369.1|785642_787475_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	1.2e-28
WP_013456008.1|787485_789270_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.6e-30
WP_115266455.1|789491_790961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115266456.1|791441_791687_-	YneF family protein	NA	NA	NA	NA	NA
WP_115266457.1|791712_792801_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_174245817.1|792873_794121_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	26.3	3.8e-07
WP_174245830.1|794289_795891_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_115266459.1|796282_804295_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_115266460.1|804450_808887_-	DNA-directed RNA polymerase subunit beta'	NA	A0A076FGB9	Aureococcus_anophage	23.5	4.2e-48
WP_115266461.1|808879_812515_-	DNA-directed RNA polymerase subunit beta	NA	W8W1V4	Invertebrate_iridescent_virus	26.8	2.6e-48
WP_115266462.1|812955_813618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086165.1|813915_814944_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_115266463.1|815152_815524_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_172792937.1|815550_816045_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_078086175.1|816385_817414_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_115266464.1|818071_818821_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_013456485.1|818807_820277_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	36.9	4.0e-80
WP_013954990.1|820430_821321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456434.1|821365_823525_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075271051.1|823671_825840_+	AAA family ATPase	NA	K4FB40	Cronobacter_phage	34.4	1.1e-107
WP_115300226.1|827082_828327_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013954997.1|829487_830585_+	DNA adenine methylase	NA	M1HGA9	Paramecium_bursaria_Chlorella_virus	31.6	6.5e-27
WP_014829976.1|830566_831508_+	DNA adenine methylase	NA	A0A1W6JN66	Lactococcus_phage	39.9	6.5e-52
WP_013954999.1|831646_831937_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013456497.1|831940_832624_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_115266466.1|832613_832964_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013955000.1|833119_833959_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	23.7	9.1e-05
>prophage 7
NZ_CP022593	Mycoplasma bovis strain NADC57 chromosome, complete genome	978015	858874	920695	978015	transposase,integrase,tRNA	Enterobacteria_phage(10.0%)	60	879507:879523	923698:923714
WP_048349594.1|858874_860119_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	3.1e-09
WP_115300229.1|860144_860840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|860901_862146_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_174245899.1|862176_862680_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	3.2e-05
WP_115266472.1|862887_865644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456522.1|865763_866771_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_013456092.1|866773_867511_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013456356.1|867513_868326_-	NAD(+) synthase	NA	M1IPF8	Pelagibacter_phage	40.0	7.7e-33
WP_115266473.1|868436_869342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115266474.1|869343_870267_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_115266475.1|870312_871635_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.4	4.5e-67
WP_013455987.1|871677_872577_-	ATP-binding protein	NA	A0A0S2SXI8	Bacillus_phage	28.9	3.0e-06
WP_115266477.1|872585_873593_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_115266478.1|873642_874215_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_115266479.1|874216_874597_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	46.0	6.5e-19
WP_152028819.1|874823_875054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115300230.1|875055_876180_+	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	29.6	6.5e-22
WP_153700572.1|877626_877764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955038.1|877831_878008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955039.1|878338_878602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456336.1|878743_880024_-	ATP-binding protein	NA	NA	NA	NA	NA
879507:879523	attL	AATTTAGCCAACATATC	NA	NA	NA	NA
WP_013456354.1|880337_880961_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	35.9	1.9e-23
WP_013456057.1|880985_882044_-	membrane protein	NA	NA	NA	NA	NA
WP_013955040.1|882091_883009_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	7.9e-10
WP_013456176.1|883043_883712_-	chromate transporter	NA	NA	NA	NA	NA
WP_013455977.1|883711_884365_-	chromate transporter	NA	NA	NA	NA	NA
WP_013456477.1|884371_884989_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004024108.1|885043_885259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456259.1|885547_886159_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_013455927.1|886455_887472_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_013456320.1|887629_889303_-	ribonuclease J	NA	NA	NA	NA	NA
WP_013455948.1|890347_891073_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	36.9	1.4e-30
WP_013456583.1|891065_891968_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_013456476.1|891967_892615_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.6	2.2e-22
WP_013456384.1|892629_893217_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_013456226.1|893219_893510_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_115266483.1|893526_895377_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	38.9	1.5e-52
WP_078086165.1|895615_896644_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456015.1|897161_897827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266484.1|897956_899453_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_115266485.1|899455_900355_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_115266486.1|900543_901296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115266487.1|901493_902027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456446.1|902013_902622_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_115266488.1|902680_903586_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013955056.1|903624_904281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955057.1|904424_904937_-	adenine phosphoribosyltransferase	NA	A0A2K9L6J1	Tupanvirus	34.5	1.0e-11
WP_115266489.1|904965_906771_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.9	7.4e-28
WP_013456107.1|906749_907052_-	YlxR family protein	NA	NA	NA	NA	NA
WP_115266490.1|907035_908670_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_101456728.1|908677_909124_-	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_115266491.1|909263_909836_-	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	69.5	2.1e-69
WP_013456539.1|909911_911282_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	73.1	1.5e-153
WP_115266518.1|911714_912743_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	8.5e-21
WP_115266492.1|912968_913976_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_115266494.1|914522_915119_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115287432.1|917381_918044_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115300232.1|918253_918853_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115287438.1|918895_919660_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456123.1|919945_920695_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
923698:923714	attR	AATTTAGCCAACATATC	NA	NA	NA	NA
