The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031243	Haemophilus haemolyticus strain M19346 chromosome, complete genome	1973061	433922	540519	1973061	protease,holin,capsid,tail,integrase,portal,plate,tRNA,terminase,head	Mannheimia_phage(40.91%)	114	478599:478649	512489:512539
WP_114908523.1|433922_434951_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	5.8e-110
WP_114908524.1|434959_435541_+	thymidine kinase	NA	M9UV85	Escherichia_phage	52.9	3.6e-53
WP_114908525.1|435577_436798_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_005627640.1|436943_437204_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.8	9.0e-20
WP_114908526.1|437281_438064_+	ribonuclease HI	NA	NA	NA	NA	NA
WP_114908527.1|438159_439320_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_114908528.1|439440_440520_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_114908529.1|440587_441628_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_053466122.1|441841_443386_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_114908530.1|443394_444183_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_114908531.1|444286_445540_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_114908532.1|445609_446326_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005633053.1|446498_446927_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005627655.1|446931_447621_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_114908533.1|448003_452032_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	25.7	1.0e-21
WP_114908534.1|452157_456408_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	2.0e-68
WP_162790761.1|456601_457546_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_114908535.1|457598_458318_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_114908536.1|458379_459291_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_005643947.1|459342_459840_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_114908537.1|459994_461380_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_114908538.1|461485_462334_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.7	1.8e-32
WP_114908539.1|462824_465596_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	32.0	2.5e-19
WP_114908540.1|465598_466258_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_114908541.1|466284_466863_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_114908542.1|466892_467645_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114908543.1|467772_468525_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005630808.1|468581_468971_+	RidA family protein	NA	NA	NA	NA	NA
WP_162837812.1|469135_469990_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032828119.1|470032_470272_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	66.7	4.7e-07
WP_114908544.1|470387_471008_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.0	5.0e-24
WP_114908545.1|471010_472474_+	potassium transporter	NA	NA	NA	NA	NA
478599:478649	attL	CTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCATTAAAA	NA	NA	NA	NA
WP_114908546.1|478661_479717_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	36.2	1.3e-56
WP_114908547.1|479955_480477_-	MazG-like family protein	NA	A0A0M3LTD8	Mannheimia_phage	42.4	1.3e-28
WP_114908548.1|480489_480699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114908549.1|480709_480901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114908550.1|480919_483106_-	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.7	9.2e-166
WP_005691706.1|483115_483424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114908551.1|483539_483794_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157997919.1|483790_483952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114908552.1|483944_484343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114908553.1|484360_484621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005633751.1|484712_485003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114908554.1|485368_485608_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114908555.1|485730_486426_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	40.7	4.1e-35
WP_114908556.1|486439_487120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114908557.1|487141_487381_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_053465676.1|487430_487670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114908558.1|487669_487873_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_114908559.1|487929_488151_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	52.1	8.5e-11
WP_114908560.1|488203_488698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114908561.1|488694_489060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114909567.1|489147_489360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114908562.1|489494_490688_-	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	50.8	1.5e-101
WP_114908563.1|490687_491125_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	57.4	9.1e-41
WP_005642263.1|491125_491464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005633772.1|491631_491778_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_114908564.1|491777_492077_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	44.0	8.0e-12
WP_005633774.1|492161_492668_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	60.1	3.2e-53
WP_114908565.1|492671_493856_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1S6KZY7	Salmonella_phage	48.7	1.6e-103
WP_114909568.1|494276_495143_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	72.4	2.2e-118
WP_167403160.1|495163_495310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114908566.1|495290_495791_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	57.3	9.8e-47
WP_114908567.1|495783_496539_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	56.7	4.6e-32
WP_114908568.1|496549_497452_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	45.9	3.2e-48
WP_114908569.1|497452_498019_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	37.0	1.1e-25
WP_114908570.1|498011_498926_-|plate	baseplate J/gp47 family protein	plate	Q858V6	Yersinia_virus	47.8	3.0e-70
WP_114908571.1|498922_499258_-	GPW/gp25 family protein	NA	Q19UQ6	Mannheimia_phage	56.6	4.4e-19
WP_114908572.1|499259_499859_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	64.5	7.9e-43
WP_114908573.1|499962_502860_-|tail	phage tail tape measure protein	tail	A0A0M3LS92	Mannheimia_phage	30.0	3.7e-69
WP_114908574.1|502931_503243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114908575.1|503253_503724_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	60.1	5.8e-41
WP_053465691.1|503720_504197_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	47.1	4.3e-28
WP_005633796.1|504193_504409_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	47.9	1.4e-10
WP_114908576.1|504583_504934_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_005633800.1|504918_505437_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	46.6	7.3e-37
WP_005633803.1|505429_505651_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_005668467.1|505652_505862_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	40.6	4.5e-06
WP_114908577.1|505861_506368_-|head	head completion/stabilization protein	head	A0A0M3LPQ0	Mannheimia_phage	46.4	9.6e-34
WP_114908578.1|506492_507155_-|terminase	terminase	terminase	Q19US0	Mannheimia_phage	45.4	1.2e-44
WP_114908579.1|507154_508186_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	56.6	6.8e-103
WP_114908580.1|508196_509024_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	51.6	1.3e-67
WP_114908581.1|509188_510970_+|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	1.1e-217
WP_114908582.1|510979_511990_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	61.2	1.3e-119
WP_162790762.1|512667_513807_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
512489:512539	attR	CTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCATTAAAA	NA	NA	NA	NA
WP_114908584.1|513816_514728_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_114908585.1|514757_515600_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_114908586.1|515599_516832_-	murein hydrolase activator EnvC	NA	A0A292GJG6	Xanthomonas_phage	40.2	2.0e-08
WP_005625827.1|517007_517691_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_114908587.1|517768_518371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005625828.1|518457_518670_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_114908588.1|518844_519981_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_114908589.1|519958_520231_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_114908590.1|520245_521322_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_046939867.1|522300_522639_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_114908591.1|522747_524703_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.0	1.6e-39
WP_053465245.1|524718_525321_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_114908592.1|525382_525712_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_114908593.1|525880_526726_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_114908594.1|526798_529393_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_114908595.1|529491_530289_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_114908596.1|530289_530796_+	competence protein B	NA	NA	NA	NA	NA
WP_114908597.1|530792_531314_+	competence protein C	NA	NA	NA	NA	NA
WP_114908598.1|531310_531724_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_114908599.1|531733_533071_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_162790811.1|533079_533766_+	ComF family protein	NA	NA	NA	NA	NA
WP_005634545.1|533842_534439_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_114908601.1|534506_535304_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_114908602.1|535336_535927_+	YjaG family protein	NA	NA	NA	NA	NA
WP_005634530.1|536064_536337_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.2	1.5e-20
WP_114908603.1|536464_537238_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114908604.1|537293_539126_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.3	1.2e-134
WP_114908605.1|539245_539545_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_114908606.1|539538_540519_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP031243	Haemophilus haemolyticus strain M19346 chromosome, complete genome	1973061	1142120	1191326	1973061	holin,transposase,tRNA,integrase	Klosneuvirus(16.67%)	55	1167212:1167230	1185781:1185799
WP_114908982.1|1142120_1143854_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.2	4.0e-87
WP_114908983.1|1143933_1144503_+	VOC family protein	NA	NA	NA	NA	NA
WP_114908984.1|1144507_1144804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114908985.1|1144833_1145298_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_114908986.1|1145520_1147170_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_111407288.1|1147276_1148359_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	1.2e-30
WP_162790783.1|1148368_1149775_-	replicative DNA helicase	NA	O80281	Escherichia_phage	68.3	7.5e-169
WP_114908988.1|1149916_1151353_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_114908989.1|1151793_1152198_-	YhcB family protein	NA	NA	NA	NA	NA
WP_114908990.1|1152226_1152577_-	RidA family protein	NA	NA	NA	NA	NA
WP_053465502.1|1152688_1153405_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_114908991.1|1153405_1153948_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_005653165.1|1153961_1154369_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_065246690.1|1154464_1155148_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_005632431.1|1155160_1155646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114908992.1|1155645_1156266_+	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_114908993.1|1156265_1156898_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_114908994.1|1156899_1157517_+	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.1	3.5e-14
WP_114908995.1|1157664_1158474_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_114908996.1|1158477_1159590_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_114908997.1|1159591_1160605_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_114908998.1|1161194_1162262_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_114908999.1|1162294_1162831_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_114909000.1|1163032_1163542_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_114909001.1|1163541_1164753_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_114909002.1|1164765_1165314_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_114909003.1|1165469_1166552_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.2	1.3e-08
WP_162790784.1|1166604_1167045_+	RDD family protein	NA	NA	NA	NA	NA
WP_114909005.1|1167044_1167923_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
1167212:1167230	attL	AAAATTGACCGCACTTTTA	NA	NA	NA	NA
WP_114909006.1|1167922_1168726_+	SirB1 family protein	NA	NA	NA	NA	NA
WP_114909007.1|1168740_1169595_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.7	3.4e-47
WP_114909008.1|1169682_1170057_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_114909009.1|1170249_1170639_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	33.3	6.1e-12
WP_114909010.1|1170660_1170765_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_114909011.1|1170881_1172837_+	recombinase	NA	NA	NA	NA	NA
WP_080565535.1|1172880_1172997_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_114909012.1|1173051_1173999_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	29.1	9.9e-24
WP_114909013.1|1173998_1175180_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162790815.1|1175202_1176492_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.5	6.9e-20
WP_114909015.1|1176500_1177643_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_114909016.1|1177652_1178300_+	DUF452 family protein	NA	NA	NA	NA	NA
WP_114909017.1|1178287_1179067_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_114909018.1|1179079_1179721_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_114909019.1|1179802_1180486_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.6	1.6e-36
WP_114909020.1|1180485_1181736_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_167403163.1|1181974_1183042_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A1Z1LYN9	Serratia_phage	45.5	8.4e-80
WP_114909022.1|1183112_1183553_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_114909023.1|1183840_1185085_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_114909024.1|1185205_1185814_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
1185781:1185799	attR	AAAATTGACCGCACTTTTA	NA	NA	NA	NA
WP_114909025.1|1185813_1186368_+	molecular chaperone	NA	NA	NA	NA	NA
WP_114909026.1|1186415_1186970_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_114909027.1|1187067_1188915_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_114909028.1|1188952_1189750_-|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	46.7	1.0e-05
WP_114909029.1|1189749_1190451_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_114909030.1|1190447_1191326_-|holin	choline transport protein LicB	holin	NA	NA	NA	NA
