The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	473003	577039	3211268	tail,tRNA,integrase,lysis,terminase,transposase,portal,capsid,protease	Lactobacillus_phage(79.03%)	104	495005:495020	527433:527448
WP_003643854.1|473003_475241_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	47.8	6.0e-104
WP_053267178.1|475389_476277_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_053267179.1|476276_477284_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003642090.1|477387_478887_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.6e-89
WP_003643855.1|485435_486908_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.1e-68
WP_015639982.1|486962_487805_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_086989537.1|488415_489190_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_003640889.1|489219_489678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267007.1|489851_490376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640891.1|490406_490742_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_053267006.1|490776_491619_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003640893.1|491777_492884_-	anion permease	NA	NA	NA	NA	NA
WP_003640894.1|493076_493898_-	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	3.3e-52
WP_053267005.1|494258_495050_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.7	1.7e-29
495005:495020	attL	GAAGGGAATTGATGCA	NA	NA	NA	NA
WP_003644997.1|495128_496265_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003640897.1|496288_496990_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003644996.1|497159_497897_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_053267004.1|498053_499532_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	3.3e-106
WP_003640900.1|499531_500359_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_003644995.1|500814_503469_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.9	8.8e-70
WP_053267003.1|503523_503958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033615666.1|504251_506423_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_003644992.1|506422_506869_+	SprT family protein	NA	NA	NA	NA	NA
WP_003640905.1|506934_508221_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_053267002.1|508229_509105_+	homoserine kinase	NA	NA	NA	NA	NA
WP_053266959.1|509395_510553_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	97.9	2.3e-216
WP_053266960.1|510724_511087_-	hypothetical protein	NA	E9LUS2	Lactobacillus_phage	85.8	1.0e-53
WP_053267417.1|511263_511722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267416.1|511956_512580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267415.1|512672_513104_-	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	99.3	1.7e-79
WP_053267414.1|513113_513494_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	64.5	1.0e-40
WP_050339955.1|513764_513947_+	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	60.0	5.2e-14
WP_053267413.1|513959_514769_+	ORF6N domain-containing protein	NA	Q9T1J2	Lactobacillus_phage	60.4	6.0e-46
WP_053267412.1|514765_514969_+	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	98.5	5.7e-30
WP_021357721.1|514968_515241_+	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	100.0	1.2e-43
WP_053267411.1|515379_515823_+	hypothetical protein	NA	A0A2P0ZLA2	Lactobacillus_phage	91.2	1.7e-71
WP_179297123.1|515815_515992_+	hypothetical protein	NA	A0A2P0ZLB1	Lactobacillus_phage	86.2	7.7e-23
WP_015825166.1|515984_516170_+	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	91.8	2.4e-27
WP_053267410.1|516414_516894_+	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	93.7	9.3e-79
WP_053267419.1|517045_518305_+	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	96.2	3.1e-230
WP_053267409.1|518301_518811_+	HNH endonuclease	NA	A0A0S2MXX9	Enterococcus_phage	35.3	1.5e-13
WP_053267408.1|518810_519527_+	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	99.1	4.6e-114
WP_053267407.1|519529_520162_+	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.9	3.5e-102
WP_053267406.1|520232_521027_+	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	93.9	1.6e-139
WP_053267405.1|521023_522289_+	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	93.6	5.4e-227
WP_053267404.1|522543_522876_+	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	90.0	4.2e-54
WP_101843607.1|522895_523045_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	89.1	1.0e-12
WP_053267403.1|523086_523746_+	SAM-dependent DNA methyltransferase	NA	D6PSV0	Lactobacillus_phage	94.6	7.7e-100
WP_179297124.1|523774_523933_+	hypothetical protein	NA	O03920	Lactobacillus_phage	71.2	6.4e-13
WP_053267402.1|523947_524457_+	DUF1642 domain-containing protein	NA	A0A2K9VC25	Lactobacillus_phage	56.3	5.7e-42
WP_053267401.1|524589_524898_+	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	93.1	1.6e-47
WP_053267400.1|524909_525341_+	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	95.6	3.9e-68
WP_053267399.1|525519_526227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643898.1|526295_526511_+	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	81.4	2.2e-27
WP_080371116.1|526494_526833_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	94.6	2.3e-60
WP_053267398.1|526832_527075_+	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	83.8	6.6e-33
WP_053267397.1|527092_527335_+	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	91.2	2.9e-36
WP_053267418.1|527443_527731_+|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	87.4	5.6e-39
527433:527448	attR	GAAGGGAATTGATGCA	NA	NA	NA	NA
WP_053267396.1|527727_529410_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	98.8	0.0e+00
WP_053267395.1|529428_530571_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	96.8	2.0e-212
WP_053267394.1|530557_531310_+|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	98.4	2.3e-132
WP_003643905.1|531330_532509_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	98.7	1.6e-217
WP_053267393.1|532647_532953_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	97.0	1.4e-48
WP_053267392.1|532933_533323_+	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	86.8	1.9e-61
WP_053267391.1|533319_533727_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.8	3.3e-69
WP_053267390.1|533723_534146_+	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	97.9	9.7e-72
WP_053267389.1|534160_534772_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	96.6	4.3e-105
WP_003643911.1|534864_535179_+	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
WP_003643912.1|535202_535424_+	hypothetical protein	NA	A0A2P0ZLD9	Lactobacillus_phage	98.6	3.9e-32
WP_053267388.1|535442_539990_+|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	80.8	0.0e+00
WP_053267387.1|539993_540815_+|tail	phage tail family protein	tail	A0A2P0ZLE2	Lactobacillus_phage	95.6	2.9e-149
WP_053267386.1|540834_544557_+	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	67.1	0.0e+00
WP_053267385.1|544563_545013_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	41.8	4.0e-23
WP_053267384.1|545015_545462_+	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	69.7	1.5e-46
WP_053267383.1|545466_545850_+	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	94.5	3.6e-65
WP_053267382.1|545852_546047_+	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	100.0	6.9e-25
WP_053267381.1|546046_546331_+|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	97.9	2.0e-41
WP_053267380.1|546330_547263_+	lysin	NA	A0A2P0ZLG2	Lactobacillus_phage	96.8	3.4e-178
WP_046038320.1|547688_548543_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_003640908.1|548833_549808_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_003640909.1|549843_550650_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003644988.1|550668_551601_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003640911.1|551729_552116_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_053267379.1|552420_555270_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003640913.1|555340_555760_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003640914.1|555756_556275_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003640915.1|556438_557410_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003640916.1|557420_557822_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003644984.1|557824_559147_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_053267378.1|559143_559947_+	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
WP_016526943.1|559939_560713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526944.1|560780_561974_-	LCP family protein	NA	NA	NA	NA	NA
WP_003643925.1|562283_563246_+	AEC family transporter	NA	NA	NA	NA	NA
WP_003643926.1|563678_564704_+	EamA family transporter	NA	NA	NA	NA	NA
WP_021356512.1|564853_565531_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_053267377.1|565949_566642_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_053267376.1|566831_568163_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	3.2e-68
WP_053267375.1|568238_568922_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_053267374.1|568930_569227_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640928.1|569365_569902_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	2.4e-35
WP_053267373.1|570962_572342_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640931.1|572357_573533_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003640932.1|573858_575349_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003644975.1|575626_577039_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	3.1e-45
>prophage 2
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	595488	604112	3211268		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|595488_597186_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|597207_597516_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|597531_598131_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|598145_598397_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003644908.1|598794_599460_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_053267369.1|599456_599771_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|599802_600822_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|600846_601194_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|601292_602189_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640969.1|602192_602978_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643943.1|603116_604112_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
>prophage 3
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	804459	850561	3211268	integrase,protease,transposase	Lactobacillus_phage(16.67%)	37	838390:838409	841543:841562
WP_053267349.1|804459_804831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157697323.1|804823_804997_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053267348.1|805612_808180_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053267347.1|808435_809029_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_053267346.1|809025_809892_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_087509231.1|809999_810161_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_053267345.1|810167_810437_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021730181.1|811004_811373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267344.1|811605_811974_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	40.9	6.6e-16
WP_053267343.1|812521_813205_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053267342.1|813701_816206_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021355861.1|816337_816652_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
WP_053267341.1|816814_819526_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_033098993.1|819560_820151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033098992.1|820150_821218_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013355305.1|821284_821641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101208.1|822235_822619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641171.1|822608_824456_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	4.5e-20
WP_003641172.1|824696_824951_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_053267340.1|824962_825508_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|825520_825703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|825717_826140_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641176.1|826200_826641_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_053267339.1|826844_827645_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_053267338.1|827776_828787_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_015825253.1|829148_829481_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158099649.1|829586_831176_+	alpha-rhamnosidase	NA	NA	NA	NA	NA
WP_053267337.1|831378_831972_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_021357610.1|831974_832556_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_053267336.1|832590_836241_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_053267335.1|836265_839817_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
838390:838409	attL	TGGTTTCCGTATAATAAAGG	NA	NA	NA	NA
WP_053267334.1|839874_840963_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	38.5	1.5e-60
WP_114894106.1|840962_843149_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
841543:841562	attR	CCTTTATTATACGGAAACCA	NA	NA	NA	NA
WP_053267332.1|843258_845775_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_047672916.1|845897_848432_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.5	1.2e-68
WP_077727009.1|849806_850016_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_072540428.1|850012_850561_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	9.1e-30
>prophage 4
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	1022013	1111644	3211268	tail,tRNA,integrase,protease,holin,transposase,head,portal,capsid,terminase	Lactobacillus_phage(65.38%)	92	1029755:1029770	1079477:1079492
WP_003641341.1|1022013_1022334_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003644129.1|1022333_1023797_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003641343.1|1023796_1025221_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003641344.1|1025325_1026348_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_003644130.1|1026681_1028055_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	4.2e-124
WP_003641346.1|1028508_1029087_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053267257.1|1029354_1031694_+	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	9.3e-39
1029755:1029770	attL	AGATTCCTGTGGACGG	NA	NA	NA	NA
WP_053267258.1|1031942_1033259_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_053267259.1|1033251_1034136_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644133.1|1034260_1035139_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053267260.1|1035163_1035940_+	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_114894108.1|1035971_1037660_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.1	1.2e-91
WP_044429853.1|1037882_1038347_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_053267129.1|1038625_1038991_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003638174.1|1039334_1039535_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_053267128.1|1039723_1040731_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_053267127.1|1040743_1042078_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.2	5.8e-38
WP_053267126.1|1042319_1043501_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	37.9	6.9e-59
WP_053267125.1|1044662_1045538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267124.1|1045602_1046010_-	toxin	NA	A0A1B0Y2S4	Lactobacillus_phage	47.8	4.0e-30
WP_053267123.1|1046002_1046335_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	60.0	2.1e-29
WP_003644552.1|1046591_1046807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267122.1|1046819_1047572_+	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	96.5	2.2e-58
WP_027823017.1|1047676_1047928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267121.1|1047993_1048692_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	60.9	1.3e-68
WP_179297125.1|1048705_1048870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825329.1|1049084_1049345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267120.1|1049487_1049742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164878069.1|1050122_1050293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641373.1|1050293_1050599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267119.1|1051638_1052436_+	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	65.3	6.3e-56
WP_046038735.1|1052435_1053221_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.2	4.1e-132
WP_053267118.1|1053356_1053659_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	87.0	4.7e-44
WP_053267117.1|1053661_1053973_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	91.3	3.2e-48
WP_100255588.1|1053976_1054135_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	3.9e-18
WP_154566812.1|1054137_1054305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080371094.1|1054333_1054729_+	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	54.0	2.0e-34
WP_053267115.1|1054731_1055178_+	DUF1642 domain-containing protein	NA	Q5ULV5	Lactobacillus_virus	63.6	6.0e-48
WP_053267114.1|1055174_1055552_+	hypothetical protein	NA	A0A1S5SCY1	Streptococcus_phage	41.5	1.3e-14
WP_154566810.1|1055785_1055953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267113.1|1055972_1056395_+	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	44.7	1.0e-12
WP_053267112.1|1056391_1056847_+	DUF1642 domain-containing protein	NA	A0A2K9VD68	Lactobacillus_phage	45.2	4.0e-23
WP_053267111.1|1057007_1057439_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	98.6	1.7e-76
WP_053267110.1|1058248_1058419_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	91.1	5.3e-21
WP_080371092.1|1058429_1058897_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.8	7.9e-83
WP_053267108.1|1058929_1059211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267107.1|1059371_1059830_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.0	4.0e-79
WP_053267106.1|1059832_1061731_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	97.0	0.0e+00
WP_053267105.1|1061720_1061915_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	1.8e-25
WP_053267104.1|1061917_1063111_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	97.7	1.1e-221
WP_053267103.1|1063088_1063844_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.2	6.7e-124
WP_053267102.1|1063843_1065076_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.4	2.7e-207
WP_053267101.1|1065148_1065487_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	93.8	1.1e-52
WP_053267100.1|1065470_1065833_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	96.7	8.3e-64
WP_015380477.1|1065822_1066263_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	4.2e-78
WP_053267099.1|1066259_1066643_+	hypothetical protein	NA	E9LUQ7	Lactobacillus_phage	96.9	3.6e-65
WP_053267098.1|1066643_1067282_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	90.5	2.2e-104
WP_053267097.1|1067483_1067867_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	99.2	8.8e-64
WP_016058335.1|1067863_1068055_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_053267096.1|1068067_1073290_+|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	76.8	0.0e+00
WP_080371098.1|1073430_1075071_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	65.1	5.4e-219
WP_053267094.1|1075138_1077538_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	69.9	0.0e+00
WP_053267093.1|1077553_1080172_+	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	62.9	9.0e-184
1079477:1079492	attR	CCGTCCACAGGAATCT	NA	NA	NA	NA
WP_053267092.1|1080164_1080416_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.2	4.2e-30
WP_053267130.1|1081390_1082503_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	36.4	2.5e-34
WP_053267091.1|1082502_1082766_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	97.7	2.8e-37
WP_053267090.1|1082776_1083157_+|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	63.2	7.8e-12
WP_154566808.1|1083389_1083560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643301.1|1083971_1084412_-	universal stress protein	NA	NA	NA	NA	NA
WP_053267089.1|1084544_1085852_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_021730634.1|1085844_1086711_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080371090.1|1087078_1087243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033611449.1|1087432_1087873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267088.1|1088304_1088868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822961.1|1089028_1089736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114894109.1|1089744_1090620_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	3.6e-20
WP_172639777.1|1090693_1092049_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_053267085.1|1092312_1093491_+	serine hydrolase	NA	NA	NA	NA	NA
WP_053267084.1|1096029_1097148_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	27.8	1.6e-20
WP_053267083.1|1097543_1098473_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_021730627.1|1098682_1099399_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.3	1.6e-18
WP_053267082.1|1099648_1100293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267081.1|1100311_1100899_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080371096.1|1100995_1101682_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_053267079.1|1101713_1102832_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_053267078.1|1102903_1104034_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_053267077.1|1104048_1104771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114894110.1|1104759_1105535_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.3	3.0e-26
WP_162818332.1|1105539_1106115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267074.1|1106111_1107500_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_080371089.1|1107518_1108505_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_087509149.1|1110869_1111644_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.5	1.9e-25
>prophage 5
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	1283133	1292981	3211268		Lactobacillus_phage(87.5%)	9	NA	NA
WP_053267620.1|1283133_1284372_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	96.1	5.7e-213
WP_053267621.1|1284462_1285434_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	97.5	2.5e-179
WP_003643099.1|1285619_1286567_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_053267622.1|1286910_1287525_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	1.2e-110
WP_046810985.1|1287527_1289966_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.8	0.0e+00
WP_053267623.1|1290053_1290614_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.0e-100
WP_053267624.1|1290684_1291125_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	4.0e-76
WP_015380221.1|1291220_1291358_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_053267625.1|1291985_1292981_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	5.3e-52
>prophage 6
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	2135325	2155655	3211268	tail,holin,portal,capsid,terminase	Lactobacillus_phage(93.33%)	19	NA	NA
WP_053267750.1|2135325_2135709_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	87.5	2.2e-14
WP_016511481.1|2135695_2135992_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	75.5	7.6e-39
WP_053267799.1|2135992_2137108_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	79.3	1.3e-30
WP_053267749.1|2137258_2139634_-	CotH kinase family protein	NA	NA	NA	NA	NA
WP_053267748.1|2139611_2140067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267747.1|2140068_2141175_-|tail	phage tail protein	tail	A0A0B5CYL4	Listeria_phage	35.0	1.0e-43
WP_053267746.1|2141174_2142014_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_053267745.1|2142003_2146839_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	81.0	0.0e+00
WP_053267744.1|2146842_2147466_-	hypothetical protein	NA	O03936	Lactobacillus_phage	95.5	5.4e-103
WP_053267743.1|2147471_2147903_-	hypothetical protein	NA	O03935	Lactobacillus_phage	97.2	1.4e-73
WP_053267742.1|2147955_2148471_-	hypothetical protein	NA	O03972	Lactobacillus_phage	89.0	5.9e-79
WP_053267741.1|2148504_2148909_-	hypothetical protein	NA	O03934	Lactobacillus_phage	98.5	4.8e-68
WP_053267798.1|2148908_2149256_-|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	84.3	5.0e-50
WP_053267740.1|2149261_2149615_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	89.7	3.1e-55
WP_053267739.1|2149611_2150040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267738.1|2150059_2150941_-	hypothetical protein	NA	U3PDP8	Lactobacillus_phage	58.4	1.1e-90
WP_053267736.1|2151637_2152780_-|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	93.7	3.6e-169
WP_053267735.1|2152776_2154303_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	81.9	3.7e-246
WP_053267734.1|2154311_2155655_-|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	97.8	3.8e-263
>prophage 7
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	2159603	2170163	3211268		Lactobacillus_phage(63.64%)	19	NA	NA
WP_053267731.1|2159603_2160071_-	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.9e-15
WP_053267730.1|2160380_2160827_-	DUF1642 domain-containing protein	NA	A0A2P0ZKT5	Lactobacillus_phage	41.4	1.8e-20
WP_053267729.1|2160823_2161234_-	hypothetical protein	NA	K4I239	Lactobacillus_phage	55.3	2.3e-33
WP_053267728.1|2161226_2161424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267727.1|2161416_2161797_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_053267726.1|2161793_2162312_-	hypothetical protein	NA	O03915	Lactobacillus_phage	52.3	4.3e-37
WP_013355745.1|2162308_2162596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267725.1|2162592_2163501_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_052748123.1|2163580_2164546_-	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	5.3e-65
WP_024002536.1|2164557_2165088_-	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	59.2	6.1e-55
WP_053267724.1|2165589_2166102_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	2.3e-27
WP_053267723.1|2166169_2166475_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_080371147.1|2166486_2166657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033608054.1|2166653_2166908_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.5e-06
WP_053267722.1|2167049_2167568_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.8	9.3e-16
WP_053267721.1|2167582_2168005_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_053267720.1|2168105_2168564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267719.1|2168649_2169711_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	45.1	4.6e-86
WP_016511204.1|2169986_2170163_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	3.9e-11
>prophage 8
NZ_CP027349	Lactiplantibacillus plantarum strain b-2 chromosome, complete genome	3211268	2365646	2374157	3211268		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2365646_2366225_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_003645866.1|2366217_2367243_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	2.7e-59
WP_053267268.1|2367239_2368694_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	4.3e-50
WP_003645864.1|2368678_2370898_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|2370890_2371571_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2371570_2371825_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2371826_2372558_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2372560_2373691_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2373674_2374157_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
