The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031238	Haemophilus haemolyticus strain M28486 chromosome, complete genome	1822569	396820	403331	1822569		Streptomyces_phage(16.67%)	6	NA	NA
WP_005627940.1|396820_397144_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.4	8.9e-17
WP_005627942.1|397264_398260_-	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	40.2	7.6e-67
WP_032825634.1|398272_399382_-	methionine biosynthesis PLP-dependent protein	NA	A0A141ZJM2	Faustovirus	26.8	4.1e-13
WP_114892344.1|400111_400642_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	36.2	3.7e-20
WP_005627949.1|400875_402192_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	82.1	5.3e-185
WP_046953135.1|402281_403331_-	ferric ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.3	9.6e-20
>prophage 2
NZ_CP031238	Haemophilus haemolyticus strain M28486 chromosome, complete genome	1822569	962714	1078373	1822569	capsid,protease,tRNA,tail,terminase,portal,head,integrase,transposase	uncultured_Caudovirales_phage(21.21%)	114	1014842:1014866	1029430:1029454
WP_114892487.1|962714_963266_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_114892488.1|963269_964088_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_114892489.1|964084_964642_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_114892490.1|964638_965403_-	glycosyltransferase family 2 protein	NA	A0A1V0SAJ8	Catovirus	30.6	3.7e-05
WP_114892491.1|965465_966749_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_114892492.1|966745_967216_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.9	2.9e-24
WP_114892493.1|967212_967425_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_114892494.1|967430_969446_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	40.1	7.8e-119
WP_046953183.1|969545_970433_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005626623.1|970538_971117_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005626621.1|971179_972517_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_005626619.1|972669_973386_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.5	5.7e-16
WP_005626617.1|973550_974666_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046953182.1|974744_975689_+	alpha/beta hydrolase	NA	Q8V549	Monkeypox_virus	25.3	1.1e-06
WP_005626613.1|976226_976538_+	DUF5389 domain-containing protein	NA	NA	NA	NA	NA
WP_005626609.1|976574_977945_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.1	8.4e-32
WP_005626607.1|978100_978472_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005626605.1|978526_979018_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005626599.1|979289_980660_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.0	5.7e-113
WP_005626596.1|980682_981300_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_046953181.1|981428_982433_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005636074.1|982453_982744_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_046953180.1|982798_983782_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005626584.1|983793_985170_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	26.7	1.3e-08
WP_005543325.1|985438_985813_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_005626581.1|985969_986440_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_005626577.1|986524_988627_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	2.9e-60
WP_046942883.1|988691_989876_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.2	6.1e-31
WP_005628063.1|990107_991406_+	trigger factor	NA	NA	NA	NA	NA
WP_005628065.1|991532_992114_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.8	1.3e-58
WP_005628067.1|992122_993364_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	3.2e-123
WP_005628069.1|993503_993920_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005628071.1|993921_994479_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_046953179.1|994696_995332_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_046953178.1|995331_995787_-	DUF3290 family protein	NA	NA	NA	NA	NA
WP_005639292.1|995863_996685_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_005629721.1|996723_997413_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046953177.1|997402_998440_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.0	4.2e-36
WP_005629725.1|998615_999170_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_046953239.1|1005246_1006386_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_005625824.1|1006395_1007307_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_005625825.1|1007334_1008177_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005625826.1|1008176_1009409_-	murein hydrolase activator EnvC	NA	A0A292GJG6	Xanthomonas_phage	40.2	2.0e-08
WP_005625827.1|1009584_1010268_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_046953238.1|1010345_1010948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005625828.1|1011033_1011246_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_046953237.1|1011421_1012558_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_005625838.1|1012535_1012808_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_046953236.1|1012822_1013899_+	membrane-bound lytic murein transglycosylase MltC	NA	W6ARS2	Escherichia_phage	28.8	1.1e-05
1014842:1014866	attL	TTTTGGTTACTATTTTGGTTACTAA	NA	NA	NA	NA
WP_046953234.1|1015229_1016420_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	62.0	8.4e-129
WP_046953233.1|1016464_1017031_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.8	1.1e-51
WP_046953232.1|1017032_1018265_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	62.8	6.6e-145
WP_046953231.1|1018248_1018593_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	33.0	2.8e-08
WP_046953230.1|1018579_1018888_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	49.0	2.0e-18
WP_046953229.1|1018904_1019267_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	52.7	2.5e-28
WP_005626376.1|1019368_1019743_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	64.9	1.7e-35
WP_046953228.1|1019750_1021418_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	69.6	4.6e-242
WP_046953242.1|1021741_1022026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046953227.1|1022223_1022607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046953226.1|1022707_1023547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005760675.1|1023718_1023940_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_046953241.1|1024134_1024629_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_046953225.1|1024621_1024870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046953224.1|1024862_1025063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005629564.1|1025052_1025259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046953223.1|1025245_1025794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052748876.1|1025795_1026239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046953221.1|1028162_1029389_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PH06	Moraxella_phage	33.4	2.4e-46
WP_046939867.1|1029687_1030026_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
1029430:1029454	attR	TTTTGGTTACTATTTTGGTTACTAA	NA	NA	NA	NA
WP_046953220.1|1030134_1032090_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	7.7e-39
WP_005626527.1|1032105_1032708_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_005629464.1|1032770_1033100_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_046953219.1|1033267_1034113_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_046953218.1|1034186_1036787_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_114892495.1|1036886_1037666_+	competence protein ComA	NA	NA	NA	NA	NA
WP_046953216.1|1037684_1038194_+	competence protein B	NA	NA	NA	NA	NA
WP_046953215.1|1038190_1038712_+	competence protein ComC	NA	NA	NA	NA	NA
WP_046953214.1|1038708_1039122_+	competence protein	NA	NA	NA	NA	NA
WP_114892496.1|1039131_1040475_+	type IV pilus secretin PilQ family protein	NA	D0U174	Enterobacteria_phage	25.9	2.5e-20
WP_005626546.1|1040471_1040927_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_005626547.1|1041128_1041815_+	ComF family protein	NA	NA	NA	NA	NA
WP_005626550.1|1041890_1042487_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_005626553.1|1042555_1043353_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_005626555.1|1043385_1043976_+	YjaG family protein	NA	NA	NA	NA	NA
WP_005626557.1|1044113_1044386_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.0	8.5e-21
WP_005626560.1|1044513_1045287_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005626562.1|1045342_1047175_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.2	3.9e-133
WP_114892497.1|1047353_1048379_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162790467.1|1048457_1048607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005629744.1|1048751_1050407_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_114892498.1|1051155_1052598_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	34.4	2.3e-11
WP_005628052.1|1052961_1054488_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.3	4.7e-100
WP_005628053.1|1054552_1055266_-	UMP kinase	NA	NA	NA	NA	NA
WP_046952878.1|1055396_1056956_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_044233196.1|1057083_1057488_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_005642748.1|1057502_1058291_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_046952879.1|1058333_1059935_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_046952880.1|1060050_1061223_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_046952881.1|1061215_1061809_+	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	40.0	2.4e-23
WP_046952882.1|1062032_1062578_-	YggT family protein	NA	NA	NA	NA	NA
WP_005629627.1|1062577_1063525_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_005629625.1|1063820_1064312_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_005629623.1|1064329_1065274_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_005629621.1|1065330_1065969_+	hemolysin regulation protein AhpA	NA	NA	NA	NA	NA
WP_046952883.1|1066080_1068078_+	transketolase	NA	NA	NA	NA	NA
WP_005629617.1|1068378_1069764_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005629614.1|1069869_1070718_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.3	4.0e-32
WP_046952884.1|1071208_1073980_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	33.6	1.5e-19
WP_005629608.1|1073982_1074642_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_005629606.1|1074668_1075247_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005643940.1|1075276_1076029_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005629599.1|1076156_1076909_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005629596.1|1076965_1077355_+	RidA family protein	NA	NA	NA	NA	NA
WP_005629592.1|1077521_1078373_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 3
NZ_CP031238	Haemophilus haemolyticus strain M28486 chromosome, complete genome	1822569	1786400	1793626	1822569	tRNA	Vibrio_phage(33.33%)	7	NA	NA
WP_046953305.1|1786400_1787390_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	9.3e-33
WP_005628674.1|1787423_1789811_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005628676.1|1789812_1790103_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	38.2	1.5e-10
WP_046953306.1|1790155_1790641_+	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	38.5	3.0e-16
WP_046953308.1|1790968_1791859_+	5'-3'-deoxyribonucleotidase	NA	A0A0D4DB39	Vibrio_phage	58.1	1.8e-43
WP_046953309.1|1791862_1792594_+	NAD-dependent deacylase	NA	R9TG77	Vibrio_phage	37.1	2.5e-27
WP_046953310.1|1792624_1793626_-	cytochrome c	NA	Q9JMN3	Wolbachia_phage	40.6	8.3e-21
