The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031241	Haemophilus influenzae strain M17648 chromosome, complete genome	1816295	69177	78246	1816295		Escherichia_phage(83.33%)	9	NA	NA
WP_112102649.1|69177_69678_-	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	31.4	3.5e-12
WP_050948635.1|69677_70289_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.5	3.0e-21
WP_114934359.1|70400_71240_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	32.2	1.7e-19
WP_005647791.1|71241_71859_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.3	7.5e-73
WP_114890502.1|71869_74290_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	2.4e-223
WP_042611482.1|74543_75653_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005651689.1|75627_75990_+	membrane protein	NA	NA	NA	NA	NA
WP_015702037.1|75998_76277_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_114890501.1|76401_78246_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.3	4.8e-22
>prophage 2
NZ_CP031241	Haemophilus influenzae strain M17648 chromosome, complete genome	1816295	208945	217459	1816295		Planktothrix_phage(16.67%)	8	NA	NA
WP_005663823.1|208945_209929_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	1.8e-20
WP_005694258.1|209931_210924_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_005653671.1|210933_211821_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162816658.1|211835_212837_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162816672.1|212926_215107_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	1.1e-115
WP_005686506.1|215721_216357_-	7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
WP_114934394.1|216378_216783_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	43.3	3.7e-20
WP_112071454.1|216775_217459_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	8.6e-54
>prophage 3
NZ_CP031241	Haemophilus influenzae strain M17648 chromosome, complete genome	1816295	415424	470844	1816295	holin,capsid,tail,terminase,tRNA,integrase	Aggregatibacter_phage(20.59%)	60	448896:448924	474289:474317
WP_112088637.1|415424_416366_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	82.7	1.2e-122
WP_005666957.1|416515_417850_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_114890378.1|417896_418628_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_114890377.1|418627_423160_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_114890376.1|423230_424139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114890375.1|424142_425018_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
WP_114890374.1|425030_426452_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_005691999.1|427181_428459_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.6	7.1e-25
WP_005650606.1|428455_429151_-	phosphate regulon transcriptional regulatory protein PhoB	NA	NA	NA	NA	NA
WP_005650603.1|429247_430015_-	phosphate ABC transporter ATP-binding protein PstB	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-16
WP_114890373.1|430024_430873_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005656744.1|430874_431822_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_005653946.1|431913_432933_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	40.5	1.2e-51
WP_005650594.1|433437_433926_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_005650592.1|433941_434439_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_005671001.1|434726_434894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114934440.1|434999_436556_+	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	33.2	1.8e-22
WP_114890371.1|436568_437150_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	40.4	1.7e-34
WP_005666933.1|437198_437585_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_114890370.1|437637_438639_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.1	1.2e-43
WP_162816674.1|438678_440109_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	38.0	1.6e-33
WP_110431867.1|440239_440512_+	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_114934442.1|440545_443410_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.3	1.0e-148
WP_114934443.1|443808_444117_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_114890364.1|444120_444555_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_114890363.1|444789_446184_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_114890362.1|446311_446920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114890361.1|447018_447843_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_114890360.1|447842_448862_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
448896:448924	attL	AAAAGTGCGGTAAAATTTCACCGCACTTT	NA	NA	NA	NA
WP_114890359.1|449092_449731_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	52.8	4.9e-35
WP_114890358.1|449763_450219_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	77.2	1.3e-58
WP_114934444.1|450231_451332_-	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	87.0	8.8e-141
WP_162790539.1|451472_452654_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	76.3	7.1e-88
WP_114934445.1|452682_454014_-	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	86.5	1.2e-216
WP_114934446.1|454015_455395_-|terminase	phage terminase large subunit	terminase	D0UIJ7	Aggregatibacter_phage	88.7	5.7e-246
WP_114890353.1|455414_455987_-|terminase	terminase small subunit	terminase	Q7Y5U8	Haemophilus_phage	42.5	6.2e-21
WP_114890352.1|455996_456518_-	Rha family transcriptional regulator	NA	A0A0P0HSR5	Acinetobacter_phage	34.3	1.4e-19
WP_114934447.1|456645_456927_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	74.4	3.2e-31
WP_114890351.1|456838_457162_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	61.1	2.8e-23
WP_114934448.1|457154_457757_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.9	1.6e-56
WP_013525935.1|457725_458082_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_162790517.1|458836_459640_-	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	48.3	4.6e-62
WP_114890347.1|460079_460265_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	45.5	1.5e-05
WP_114890346.1|460322_460694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114890345.1|460690_461233_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	62.1	3.3e-56
WP_005633909.1|461776_462001_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_114890344.1|461997_462618_-	replication P	NA	A0A0M3LS65	Mannheimia_phage	39.7	1.0e-29
WP_114934449.1|462614_463313_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	61.5	3.0e-62
WP_114934450.1|463309_463978_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	52.1	2.0e-55
WP_015702309.1|464025_464322_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	1.5e-31
WP_114890342.1|464679_465336_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	58.4	1.2e-65
WP_114890341.1|466403_466778_+	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	46.7	3.7e-22
WP_080281387.1|467200_467374_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	65.0	2.4e-08
WP_005692473.1|467387_467597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687158.1|467923_468163_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	48.6	3.2e-11
WP_005687157.1|468148_468415_-	hypothetical protein	NA	A0A0N9STP5	Staphylococcus_phage	49.2	5.6e-09
WP_114934452.1|468675_469167_+	helicase	NA	NA	NA	NA	NA
WP_005656638.1|469170_469263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103746124.1|470149_470428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162816675.1|470424_470844_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQN1	Mannheimia_phage	58.2	3.8e-20
474289:474317	attR	AAAAGTGCGGTAAAATTTCACCGCACTTT	NA	NA	NA	NA
