The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031240	Haemophilus haemolyticus strain M19345 chromosome, complete genome	1916320	419987	470934	1916320	tail,integrase,head,portal,terminase,capsid,tRNA,protease	uncultured_Caudovirales_phage(36.84%)	57	453707:453731	468912:468936
WP_114891133.1|419987_422813_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	27.4	4.8e-82
WP_162790250.1|422841_423768_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.1	3.5e-05
WP_114891135.1|423814_425389_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005548279.1|425655_425919_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_114891136.1|425990_426557_-	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_005630980.1|426702_427560_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_162790251.1|427628_428618_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_114891137.1|428674_429124_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_114891138.1|429276_429744_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_065265631.1|429920_431267_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005634512.1|431471_431729_+	DUF997 family protein	NA	NA	NA	NA	NA
WP_005626344.1|431725_433180_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
WP_114891139.1|433299_434172_+	EamA family transporter	NA	NA	NA	NA	NA
WP_114891140.1|434206_435094_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_114891141.1|435240_436221_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_009500196.1|436214_436514_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_114891142.1|436631_438464_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.2	3.9e-133
WP_114891143.1|438519_439293_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005634530.1|439421_439694_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.2	1.5e-20
WP_114891144.1|439831_440422_-	DUF416 family protein	NA	NA	NA	NA	NA
WP_114891145.1|440454_441252_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_114891146.1|441319_441916_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_114891147.1|441991_442678_-	ComF family protein	NA	NA	NA	NA	NA
WP_114891148.1|442690_444028_-	type IV pilus secretin PilQ family protein	NA	R9TEZ5	Vibrio_phage	23.2	5.7e-17
WP_114891149.1|444037_444451_-	competence protein	NA	NA	NA	NA	NA
WP_114891150.1|444447_444969_-	competence protein ComC	NA	NA	NA	NA	NA
WP_114891151.1|444965_445475_-	competence protein B	NA	NA	NA	NA	NA
WP_114891152.1|445475_446273_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_114891153.1|446371_448972_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_114891154.1|449044_449890_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_114891155.1|450058_450388_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_114891156.1|450450_451053_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_114891157.1|451068_453024_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	5.4e-40
WP_005676206.1|453132_453474_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
453707:453731	attL	TTAGTAACCAAAATAGTAACCAAAA	NA	NA	NA	NA
WP_114891158.1|453771_454998_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PH06	Moraxella_phage	33.4	1.8e-46
WP_114891159.1|455169_456939_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	37.0	2.1e-75
WP_114891160.1|456926_457319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891161.1|457311_457869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046942480.1|457855_458062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891162.1|458051_458252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891163.1|458244_458493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114892166.1|458485_458980_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_114891164.1|459170_459392_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_114891165.1|459499_460111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891166.1|460312_460768_-	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	29.2	2.2e-05
WP_114891167.1|460778_462446_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	70.0	3.5e-242
WP_005626376.1|462453_462828_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	64.9	1.7e-35
WP_114891168.1|463247_463604_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	53.6	6.5e-29
WP_114891169.1|463620_463935_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	49.5	9.2e-19
WP_005626382.1|463921_464278_-|head	phage head closure protein	head	Q9MCV2	Escherichia_phage	36.7	2.0e-09
WP_114891170.1|464261_465494_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	63.6	2.1e-146
WP_114891171.1|465495_466062_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.0	2.0e-51
WP_114891172.1|466106_467297_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	62.0	2.9e-129
WP_005641212.1|467311_467719_-	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	29.5	8.6e-09
WP_162790252.1|467944_468109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891173.1|468114_468633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891174.1|469857_470934_-	membrane-bound lytic murein transglycosylase MltC	NA	W6ARS2	Escherichia_phage	28.8	8.1e-06
468912:468936	attR	TTAGTAACCAAAATAGTAACCAAAA	NA	NA	NA	NA
>prophage 2
NZ_CP031240	Haemophilus haemolyticus strain M19345 chromosome, complete genome	1916320	1495481	1564349	1916320	tail,integrase,terminase,capsid,holin,transposase	Mannheimia_phage(21.88%)	79	1490782:1490798	1559114:1559130
1490782:1490798	attL	AATTTTAACCGCACTTT	NA	NA	NA	NA
WP_114891853.1|1495481_1496729_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	37.2	2.8e-74
WP_005661499.1|1496725_1496926_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_114891854.1|1497479_1497905_-	hypothetical protein	NA	A0A0E3T9S3	Pseudomonas_phage	37.3	2.6e-16
WP_114891855.1|1497956_1498427_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	35.2	5.4e-15
WP_114891856.1|1498441_1498906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891857.1|1499098_1499290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891858.1|1499462_1500299_-	DNA methyltransferase	NA	U4KJA1	Streptococcus_phage	54.1	4.0e-77
WP_114891859.1|1500300_1500642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891860.1|1500634_1500961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891861.1|1500957_1501851_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	42.6	1.1e-53
WP_114891862.1|1502031_1502229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891863.1|1502237_1502672_-	single-stranded DNA-binding protein	NA	S5M9Z7	Pseudoalteromonas_phage	40.9	1.5e-19
WP_114891864.1|1502675_1503293_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	77.2	4.4e-89
WP_114891865.1|1503286_1504144_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	58.2	2.9e-62
WP_114891866.1|1504156_1505092_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	46.2	6.1e-42
WP_114891867.1|1505104_1505419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891868.1|1505415_1505703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891869.1|1505713_1506262_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_114891870.1|1506230_1506554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114891871.1|1507721_1508390_-	helix-turn-helix domain-containing protein	NA	K7PK07	Enterobacteria_phage	36.6	4.2e-21
WP_114891872.1|1508516_1508726_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	42.4	2.8e-08
WP_114891873.1|1508806_1509076_+	hypothetical protein	NA	A0A088FAW9	Sulfitobacter_phage	50.8	3.0e-10
WP_114891874.1|1509077_1509971_+	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	52.6	9.7e-13
WP_114891875.1|1509973_1510816_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	46.7	1.4e-58
WP_114891876.1|1510812_1511322_+	adenine methyltransferase	NA	D0UIL3	Aggregatibacter_phage	67.7	3.4e-63
WP_114891877.1|1511347_1511986_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.7	6.5e-19
WP_114891878.1|1511990_1512176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891879.1|1512423_1512708_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	88.3	2.6e-44
WP_114891880.1|1512704_1513070_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	60.8	1.3e-40
WP_114891881.1|1513062_1513788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891882.1|1513870_1514446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891884.1|1515107_1515467_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_114891885.1|1515432_1516035_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	54.4	2.5e-57
WP_114891886.1|1516027_1516351_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_114891887.1|1516256_1516538_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	50.7	6.3e-11
WP_114891888.1|1516625_1517429_+|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	26.5	2.4e-15
WP_114891889.1|1517418_1518966_+	TerL	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	43.3	1.1e-99
WP_114891890.1|1518968_1521164_+	hypothetical protein	NA	A0A218MLN6	uncultured_virus	27.3	2.8e-45
WP_162790289.1|1521221_1530503_+	hypothetical protein	NA	Q1MVM9	Enterobacteria_phage	31.9	2.0e-31
WP_114891892.1|1530589_1530784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891893.1|1530849_1531704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114892183.1|1531725_1532724_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
WP_114891894.1|1532776_1533211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891895.1|1533210_1533600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891896.1|1533599_1535585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114892184.1|1536189_1537101_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	50.3	2.7e-34
WP_114891897.1|1537111_1537867_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	56.1	3.0e-31
WP_114891898.1|1537859_1538357_+	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	56.8	1.9e-50
WP_114891899.1|1538410_1539229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005642880.1|1539246_1539615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114892185.1|1539631_1540738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891900.1|1540750_1541278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891901.1|1541281_1542046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114891902.1|1543055_1544207_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	29.8	1.2e-34
WP_114891903.1|1544291_1544696_-	YhcB family protein	NA	NA	NA	NA	NA
WP_114891904.1|1544725_1545076_-	RidA family protein	NA	NA	NA	NA	NA
WP_114891905.1|1545187_1545904_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_162790290.1|1545904_1546447_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_114891906.1|1546460_1546868_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_114891907.1|1546957_1547641_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_114891908.1|1547653_1548139_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_114891909.1|1548138_1548759_+	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_114891910.1|1548758_1549391_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_114891911.1|1549392_1550010_+	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.6	1.6e-14
WP_005645020.1|1550157_1550967_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_114891912.1|1550970_1552083_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_114891913.1|1552084_1553098_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_114891914.1|1553687_1554755_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	24.6	1.0e-08
WP_114891915.1|1554787_1555324_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_114891916.1|1555517_1556174_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_114891917.1|1556250_1557273_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032803489.1|1557382_1558465_+	peptide chain release factor 1	NA	G0YKC3	Acinetobacter_phage	52.8	6.2e-06
WP_005644900.1|1558517_1558958_+	RDD family protein	NA	NA	NA	NA	NA
WP_114891918.1|1558957_1559836_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
1559114:1559130	attR	AAAGTGCGGTTAAAATT	NA	NA	NA	NA
WP_114891919.1|1559835_1560639_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005629022.1|1560653_1561508_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.7	4.4e-47
WP_140527588.1|1562002_1562131_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_114891921.1|1562245_1564201_+	recombinase	NA	NA	NA	NA	NA
WP_162790291.1|1564253_1564349_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP031240	Haemophilus haemolyticus strain M19345 chromosome, complete genome	1916320	1658679	1666654	1916320	tRNA	Bodo_saltans_virus(16.67%)	8	NA	NA
WP_005640625.1|1658679_1659669_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	5.5e-33
WP_114891988.1|1659702_1662090_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005662477.1|1662091_1662382_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	38.2	8.5e-11
WP_046950270.1|1662434_1662920_+	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	39.3	3.9e-16
WP_114891989.1|1662984_1663938_+	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_114891990.1|1663996_1664887_+	hypothetical protein	NA	I6X231	Vibriophage	61.5	1.7e-46
WP_114891991.1|1664890_1665601_+	NAD-dependent deacylase	NA	R9TG77	Vibrio_phage	37.6	7.2e-27
WP_114891992.1|1665652_1666654_-	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	40.6	6.4e-21
