The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	1028624	1036828	3954901	protease	uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_003358601.1|1028624_1029581_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.6	7.2e-14
WP_003358688.1|1029727_1030546_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003358784.1|1030847_1031498_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.7e-59
WP_003358544.1|1031681_1032272_-	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	54.5	9.8e-46
WP_003358633.1|1032275_1032941_-	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.6	1.4e-37
WP_003358723.1|1032942_1033374_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	33.1	1.4e-12
WP_003358645.1|1033391_1034153_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_003358556.1|1034269_1035265_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_003358714.1|1035883_1036828_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.1	3.2e-14
>prophage 2
NZ_CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	1344434	1384444	3954901	capsid,plate,terminase,portal,tail,integrase	Clostridium_phage(52.5%)	55	1370043:1370060	1388678:1388695
WP_003356732.1|1344434_1345202_-	SH3 domain-containing protein	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	65.1	3.5e-88
WP_003356211.1|1345241_1345436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003357220.1|1345452_1345707_-	membrane protein	NA	A0A0A7RTX0	Clostridium_phage	68.4	9.1e-25
WP_003356540.1|1345802_1346147_-	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	60.0	6.4e-05
WP_003356147.1|1346414_1346819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356858.1|1347228_1347573_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	62.6	1.8e-31
WP_003356966.1|1347583_1348765_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	62.3	4.6e-71
WP_003356868.1|1348768_1349395_-	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	74.1	4.6e-86
WP_003355953.1|1349375_1350470_-|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	77.5	4.0e-162
WP_003356660.1|1350473_1350881_-	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	84.6	3.6e-55
WP_003356627.1|1350883_1351228_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	73.7	6.3e-37
WP_003355762.1|1351230_1352205_-	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.9	1.6e-157
WP_003356924.1|1352216_1352885_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	75.0	2.0e-95
WP_031367384.1|1352884_1354909_-	hypothetical protein	NA	A0A0A7S091	Clostridium_phage	51.4	6.8e-155
WP_003356953.1|1354949_1355627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356777.1|1355884_1356298_-	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	74.8	1.1e-51
WP_003356607.1|1356313_1356778_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	87.7	1.9e-73
WP_003356497.1|1356781_1358092_-	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	85.8	5.5e-214
WP_003356354.1|1358253_1358712_-	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	76.2	3.8e-53
WP_003356102.1|1358698_1359190_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	74.1	2.4e-61
WP_003356756.1|1359189_1359576_-	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	75.2	7.8e-44
WP_031367383.1|1359577_1359922_-	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	77.2	6.3e-45
WP_003355814.1|1359941_1361009_-	hypothetical protein	NA	A0A0A7RTH8	Clostridium_phage	88.7	1.7e-181
WP_003356226.1|1361031_1361601_-	scaffold protein	NA	A0A0A7RTM5	Clostridium_phage	52.1	1.8e-33
WP_003357135.1|1361619_1361979_-	hypothetical protein	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	82.4	1.8e-50
WP_003356965.1|1362093_1362366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356283.1|1362432_1363455_-|capsid	minor capsid protein	capsid	A0A0A7RVY7	Clostridium_phage	78.2	1.0e-151
WP_003355796.1|1363444_1364887_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	89.1	4.7e-251
WP_003356486.1|1364899_1366309_-|terminase	phage terminase large subunit	terminase	A0A0A7RTS1	Clostridium_phage	87.9	3.2e-212
WP_003356852.1|1366301_1366877_-|terminase	terminase small subunit	terminase	Q6SED9	Lactobacillus_prophage	31.6	2.9e-10
WP_003356019.1|1366975_1367167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356664.1|1367352_1367790_-	siderophore-interacting protein	NA	A0A2H4J015	uncultured_Caudovirales_phage	40.4	5.2e-20
WP_003356993.1|1368154_1368334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003355742.1|1368363_1370229_-	primase	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	88.2	0.0e+00
1370043:1370060	attL	TTTTATATAAAATATCTG	NA	NA	NA	NA
WP_003356867.1|1370255_1371245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003355773.1|1371241_1371565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356576.1|1371567_1371897_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A2H4J7H8	uncultured_Caudovirales_phage	78.0	5.1e-44
WP_003355908.1|1371897_1372167_-	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	82.8	3.3e-33
WP_031367224.1|1372352_1372568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356217.1|1372596_1372914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356709.1|1372958_1374653_-	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	84.6	3.8e-292
WP_003356587.1|1374652_1374817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003355843.1|1374869_1375328_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	66.7	3.3e-57
WP_003357073.1|1375330_1375651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356243.1|1375650_1377333_-	AAA family ATPase	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	74.1	1.3e-215
WP_003356700.1|1377378_1377675_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	80.2	1.1e-40
WP_003356400.1|1377747_1378572_-	DUF1351 domain-containing protein	NA	A0A2H4J082	uncultured_Caudovirales_phage	67.9	2.9e-96
WP_031367223.1|1378572_1379673_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	78.5	2.4e-170
WP_003357026.1|1380017_1380311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003356023.1|1380330_1381080_-	hypothetical protein	NA	Q332L4	Clostridium_botulinum_C_phage	36.6	1.0e-15
WP_003356844.1|1381096_1381426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003355789.1|1381425_1381629_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003356555.1|1381837_1382350_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	29.5	6.1e-12
WP_003355973.1|1382397_1382814_+	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	30.1	2.4e-06
WP_003357131.1|1383373_1384444_+|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	33.1	1.5e-31
1388678:1388695	attR	TTTTATATAAAATATCTG	NA	NA	NA	NA
>prophage 3
NZ_CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	3515090	3547393	3954901		Clostridium_phage(74.07%)	36	NA	NA
WP_003357882.1|3515090_3516578_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	38.3	4.3e-66
WP_003358005.1|3518123_3518534_-	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_003357707.1|3518725_3518935_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003358080.1|3518996_3519209_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003357946.1|3519302_3520208_+	hypothetical protein	NA	A8ASN4	Listeria_phage	40.2	4.2e-40
WP_003357809.1|3520197_3520998_+	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	35.2	3.4e-33
WP_003357794.1|3521054_3521375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358043.1|3521488_3522010_+	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.6	3.6e-36
WP_003357791.1|3522676_3522961_+	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	59.2	3.0e-24
WP_003357709.1|3522960_3523326_+	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.9	1.2e-33
WP_003357847.1|3523330_3523678_+	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	58.9	7.8e-35
WP_003357924.1|3523683_3524103_+	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	71.9	1.1e-56
WP_003357852.1|3524107_3524995_+	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	75.0	1.2e-119
WP_003357967.1|3525009_3525426_+	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	71.2	9.0e-46
WP_162265969.1|3525385_3525628_+	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	66.2	9.9e-21
WP_003357715.1|3525791_3527195_+	hypothetical protein	NA	A0A0A7RU22	Clostridium_phage	42.4	5.2e-05
WP_003357973.1|3527207_3527642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357869.1|3527628_3528714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357831.1|3528726_3529068_+	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	55.7	2.1e-16
WP_003358000.1|3529082_3530432_+	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.6	2.1e-75
WP_003358129.1|3530433_3531411_+	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.2	9.3e-110
WP_003357799.1|3531433_3532942_+	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	37.7	5.5e-93
WP_003357733.1|3532953_3534975_+	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	48.5	1.1e-56
WP_003358083.1|3534977_3535253_+	hypothetical protein	NA	A0A223LE82	Bacillus_phage	38.8	3.9e-05
WP_003358057.1|3535264_3536263_+	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.6	2.1e-141
WP_003358123.1|3536274_3537360_+	hypothetical protein	NA	A0A0A7RU66	Clostridium_phage	70.4	4.2e-143
WP_003358023.1|3537392_3538310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003393065.1|3538312_3539092_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_003357911.1|3539143_3539911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358070.1|3539976_3540801_+	discoidin domain-containing protein	NA	A0A0A7RU33	Clostridium_phage	30.4	7.3e-15
WP_003357870.1|3540866_3541676_+	hypothetical protein	NA	A0A0A7RU33	Clostridium_phage	34.7	2.8e-27
WP_003358009.1|3541831_3542086_+	membrane protein	NA	A0A0A7RTX0	Clostridium_phage	70.9	4.8e-26
WP_003357959.1|3542104_3542299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357964.1|3542445_3543225_+	SH3 domain-containing protein	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	63.4	1.2e-88
WP_003357751.1|3543623_3544748_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	28.5	3.8e-30
WP_003357975.1|3544765_3547393_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.4	4.2e-64
>prophage 4
NZ_CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	3563422	3651374	3954901	plate,terminase,portal,transposase,holin,head,tRNA,tail,integrase,protease	Clostridium_phage(76.0%)	91	3583377:3583436	3627822:3627882
WP_003358144.1|3563422_3564274_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_003357979.1|3564386_3566237_+	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_003357739.1|3566214_3566928_+	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_003358087.1|3566966_3568406_+	ribonuclease E/G	NA	NA	NA	NA	NA
WP_003357920.1|3568529_3568844_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003357900.1|3568846_3569173_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003357774.1|3569175_3569478_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003357748.1|3569856_3571131_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003358089.1|3571157_3571451_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_003357933.1|3571693_3572299_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003357821.1|3572381_3572951_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003358143.1|3572961_3574236_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	29.2	1.7e-18
WP_003357849.1|3574251_3574632_+	RidA family protein	NA	NA	NA	NA	NA
WP_003357985.1|3574957_3575860_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003357731.1|3575967_3577215_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_003358042.1|3577403_3578012_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_093461105.1|3578117_3579197_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_003358076.1|3579263_3580652_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_003358142.1|3580670_3582578_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.9	2.8e-17
3583377:3583436	attL	GGGTGGGTTCGATTCCCACATATTCCCGCCAAATTTTAAAATGAACCTCTAAGCGAGTAA	NA	NA	NA	NA
WP_003357815.1|3583553_3584717_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	31.4	5.3e-35
WP_003357740.1|3584765_3585218_-	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	40.0	6.2e-16
WP_003357840.1|3585226_3585661_-	helix-turn-helix transcriptional regulator	NA	M9Q2L3	Clostridium_phage	39.1	9.5e-14
WP_003358015.1|3585878_3586073_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WE47	Clostridium_phage	36.5	6.1e-05
WP_003358119.1|3586090_3586351_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_003358071.1|3586365_3586545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003398780.1|3586758_3587040_+	hypothetical protein	NA	A0A0A7RTW4	Clostridium_phage	63.8	1.0e-21
WP_003357951.1|3587092_3587446_+	hypothetical protein	NA	A0A0A7RVM0	Clostridium_phage	69.8	3.4e-38
WP_003357939.1|3587463_3587709_+	hypothetical protein	NA	A0A0A7RTK9	Clostridium_phage	65.0	1.1e-24
WP_003357853.1|3587742_3588192_+	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	50.9	1.9e-09
WP_003357764.1|3588191_3589337_+	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	88.5	5.0e-195
WP_003358058.1|3589348_3589969_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	85.5	6.8e-90
WP_003357884.1|3590139_3592101_+	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	72.4	3.3e-279
WP_003358078.1|3592139_3592370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358037.1|3592406_3593432_+	nucleoid-associated protein	NA	A0A090D855	Clostridium_phage	33.1	1.9e-44
WP_003357932.1|3593477_3595904_+	virulence-associated E family protein	NA	A0A0A7RTG3	Clostridium_phage	60.6	5.4e-276
WP_003357721.1|3596174_3596312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357936.1|3596298_3596574_+	VRR-NUC domain-containing protein	NA	A0A0A7RTE1	Clostridium_phage	86.7	5.4e-23
WP_003358039.1|3597999_3598479_+	hypothetical protein	NA	I2E8Y5	Clostridium_phage	43.7	2.7e-25
WP_003357935.1|3599110_3599455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358041.1|3599521_3600115_+|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	36.8	1.4e-20
WP_003358133.1|3600107_3601517_+|terminase	phage terminase large subunit	terminase	A0A0A7RTS1	Clostridium_phage	87.2	3.6e-211
WP_031368140.1|3601530_3602982_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	85.8	4.4e-233
WP_003357989.1|3602971_3604003_+|head	phage head morphogenesis protein	head	A0A0A7RVY7	Clostridium_phage	75.7	1.7e-146
WP_003357813.1|3604099_3604681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358074.1|3604748_3605108_+	hypothetical protein	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	81.5	2.0e-49
WP_003357803.1|3605130_3605703_+	scaffold protein	NA	A0A0A7RTM5	Clostridium_phage	54.7	1.7e-39
WP_003357819.1|3605725_3606793_+	hypothetical protein	NA	A0A0A7RTH8	Clostridium_phage	88.5	2.5e-180
WP_031367423.1|3606812_3607157_+	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	75.4	2.6e-43
WP_003358011.1|3607158_3607542_+	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	83.5	3.7e-54
WP_003357746.1|3607541_3608033_+	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	75.3	2.1e-62
WP_003357825.1|3608034_3608466_+	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	75.4	5.1e-52
WP_003358030.1|3608627_3609938_+	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	85.1	1.3e-212
WP_003358090.1|3609941_3610406_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	83.1	1.1e-68
WP_003358106.1|3610421_3610835_+	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	77.0	2.1e-55
WP_003357987.1|3611089_3611851_+	SHOCT domain-containing protein	NA	X5JB37	Clostridium_phage	42.8	2.6e-43
WP_003357961.1|3611908_3614068_+	hypothetical protein	NA	A0A0A7S091	Clostridium_phage	48.0	1.6e-133
WP_003358114.1|3614067_3614745_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	75.0	4.6e-92
WP_003358132.1|3614756_3615731_+	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.9	2.7e-157
WP_003357723.1|3615733_3616078_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	74.6	7.4e-38
WP_003357890.1|3616080_3616488_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	78.5	1.1e-51
WP_003358010.1|3616488_3617583_+|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	76.1	1.3e-160
WP_003357941.1|3617563_3618187_+	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	71.4	2.4e-79
WP_003357943.1|3618189_3619929_+|tail	phage tail protein	tail	A0A0A7RTQ0	Clostridium_phage	51.1	1.9e-60
WP_003357937.1|3619961_3620354_+	hypothetical protein	NA	B6SBV4	Clostridium_virus	37.6	4.5e-07
WP_003357857.1|3620346_3620469_+	XkdX family protein	NA	A0A0A7S0E7	Clostridium_phage	57.5	4.5e-06
WP_003394958.1|3620792_3621989_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	44.4	4.7e-87
WP_003358136.1|3622156_3622576_+|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	66.2	1.1e-43
WP_003358121.1|3622620_3623391_+	SH3 domain-containing protein	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	66.1	2.2e-90
WP_003357838.1|3623569_3625138_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_100067000.1|3625226_3626090_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_003357984.1|3626940_3627129_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	70.9	2.9e-12
WP_003358148.1|3627130_3627373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357926.1|3627422_3627563_+	hypothetical protein	NA	A0A0A7S0D9	Clostridium_phage	77.3	2.2e-12
WP_031367398.1|3628701_3630216_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
3627822:3627882	attR	GGGTGGGTTCGATTCCCACATATTCCCGCCAAATTTTAAAATGAACCTCTAAGCGAGTAAT	NA	NA	NA	NA
WP_003358128.1|3630723_3633318_+	cation-transporting P-type ATPase	NA	NA	NA	NA	NA
WP_003357983.1|3633422_3633653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357743.1|3633664_3635452_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_003357804.1|3635480_3636512_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003358111.1|3636546_3636813_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003357832.1|3637022_3637997_+	GPR endopeptidase	NA	NA	NA	NA	NA
WP_003357912.1|3638181_3639273_+	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_003358116.1|3639343_3639739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357725.1|3639879_3641688_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.3	4.2e-23
WP_003357872.1|3641714_3642857_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003357960.1|3643057_3644089_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003357929.1|3644115_3644760_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003357980.1|3644814_3646686_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.7	1.6e-142
WP_003357741.1|3646828_3647974_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	29.0	2.2e-25
WP_003357816.1|3648281_3649220_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003358022.1|3649317_3650076_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003357957.1|3650075_3651374_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	3729004	3738473	3954901		Synechococcus_phage(42.86%)	7	NA	NA
WP_003357997.1|3729004_3731560_+	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	32.4	1.3e-09
WP_003357851.1|3732235_3732715_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.7	1.1e-26
WP_003358103.1|3732714_3733419_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	1.0e-41
WP_003385256.1|3733510_3734959_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	7.2e-58
WP_003357871.1|3735019_3736015_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	44.0	3.4e-67
WP_003357901.1|3736142_3736760_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.6	1.5e-25
WP_031367308.1|3736973_3738473_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.1e-69
>prophage 1
NZ_CP031100	Clostridium botulinum strain CFSAN034202 plasmid p1_CFSAN034202, complete sequence	57676	6140	24892	57676	portal,capsid,head,terminase,tail	Pseudomonas_phage(16.67%)	37	NA	NA
WP_003385000.1|6140_6746_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003385001.1|6792_6990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003385002.1|6998_7325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050497295.1|7338_8436_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	35.4	2.4e-66
WP_050497296.1|8435_9365_-	hypothetical protein	NA	A0A2D1GNL2	Pseudomonas_phage	37.6	4.1e-14
WP_003385006.1|9510_9756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154231186.1|9759_9930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080283532.1|9971_10361_-	single-stranded DNA-binding protein	NA	A0A0K0MWE1	Streptococcus_phage	48.9	1.3e-27
WP_154231177.1|10357_10504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154231176.1|10569_10743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154231175.1|10770_10926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367494.1|10903_11122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367559.1|11124_12093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367560.1|12092_12356_-	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	79.1	1.0e-31
WP_031367561.1|12658_12865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154231184.1|13019_13175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134791037.1|13193_13445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003385017.1|13484_13835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003385019.1|13866_14049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367563.1|14090_14750_-	DNA modification methylase	NA	A0A1S5S9L2	Streptococcus_phage	67.6	8.0e-89
WP_003385021.1|14791_15220_-	phage N-6-adenine-methyltransferase	NA	A0A0A7RUD1	Clostridium_phage	87.1	3.5e-69
WP_031367565.1|15266_15506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003385025.1|15666_16434_-|capsid	minor capsid protein	capsid	W8VT12	Pseudomonas_phage	33.9	1.4e-07
WP_003385027.1|16475_17789_-|portal	phage portal protein	portal	A0A0F7L7L5	uncultured_marine_virus	23.0	1.1e-23
WP_154231185.1|17799_17973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003385029.1|18075_18474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367509.1|18707_18962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367787.1|19057_19441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367551.1|19455_19698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050497297.1|19825_20530_-	helix-turn-helix domain-containing protein	NA	F0PIG9	Enterococcus_phage	46.8	9.3e-19
WP_031367549.1|20549_20813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154231181.1|20813_20972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367548.1|21301_21493_-	DUF4236 domain-containing protein	NA	A0A2K9V2W7	Faecalibacterium_phage	58.7	4.1e-14
WP_154231180.1|21515_21692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367547.1|21694_22111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367546.1|23234_24479_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S0KEN9	Bacillus_phage	61.7	7.6e-149
WP_003384520.1|24481_24892_-|terminase	terminase small subunit	terminase	A0A0A8WDX8	Clostridium_phage	42.8	4.0e-22
>prophage 2
NZ_CP031100	Clostridium botulinum strain CFSAN034202 plasmid p1_CFSAN034202, complete sequence	57676	32794	49096	57676		Clostridium_phage(53.85%)	26	NA	NA
WP_031367568.1|32794_32977_-	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	82.5	6.5e-17
WP_003384948.1|33500_34130_-	FAD-dependent thymidylate synthase	NA	F8UBK4	Clostridium_phage	47.1	2.0e-44
WP_154231187.1|34198_34372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003384949.1|34424_34892_-	hypothetical protein	NA	D9ZNH9	Clostridium_phage	39.5	9.2e-15
WP_003384950.1|34948_35839_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031367570.1|35859_36369_-	hypothetical protein	NA	S6AVW3	Thermus_phage	39.9	8.2e-25
WP_003384953.1|36369_36579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003384954.1|36581_37136_-	hypothetical protein	NA	Q332D2	Clostridium_botulinum_C_phage	50.5	4.3e-43
WP_003384956.1|37150_37384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154231188.1|37386_37530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003384958.1|37567_37834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367571.1|37827_39684_-	AAA family ATPase	NA	K4NWL6	Pseudomonas_phage	24.2	6.3e-14
WP_050501308.1|39696_40452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367515.1|40475_40721_-	stage III sporulation protein D	NA	M9Q261	Clostridium_phage	52.0	6.3e-15
WP_031367557.1|40720_41038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050497291.1|41336_41948_-	hypothetical protein	NA	A0A0A7RVW0	Clostridium_phage	62.3	2.7e-62
WP_031367555.1|41963_42851_-	hypothetical protein	NA	A0A088FAU5	Sulfitobacter_phage	47.3	1.9e-69
WP_031367554.1|42869_43355_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	39.6	1.2e-20
WP_003384967.1|43822_44206_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154231183.1|44223_44364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050497246.1|44480_45530_-	hypothetical protein	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	43.2	3.3e-20
WP_003384969.1|45933_46500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003384970.1|46617_47529_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_003384971.1|47512_47800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003384972.1|47877_48294_-	hypothetical protein	NA	I2E8W8	Clostridium_phage	27.7	8.2e-07
WP_033051712.1|48304_49096_-	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	52.5	5.5e-68
