The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	0	112757	4923235	tail,transposase,head,terminase,integrase,lysis,protease,portal,capsid	Enterobacteria_phage(40.0%)	131	27081:27115	114191:114225
WP_000961458.1|755_2348_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|2566_3487_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056442.1|3545_4664_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|4660_5128_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|5313_5442_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054678.1|5713_7297_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|7345_7861_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|7913_7979_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|8213_9101_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|9399_9903_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|10306_11053_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|11191_11851_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|11847_12570_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267255.1|12686_14912_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001275941.1|14908_15835_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|16110_16371_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430063.1|16634_18917_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|18958_19636_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|19709_19976_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|20240_20501_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|20770_21751_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000443534.1|22031_23117_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|23257_24220_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001398823.1|24247_26398_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	7.4e-43
WP_001145128.1|26517_27000_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
27081:27115	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000399648.1|27259_28240_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000007101.1|28510_29875_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|30103_30775_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|30777_31773_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996099.1|31765_33502_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|33494_34628_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|34638_35745_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|35706_36117_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|36249_37011_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|37007_38249_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045448.1|38248_39205_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|39240_39954_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|40158_40863_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|40999_41452_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|41453_41699_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|41691_42177_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|42179_42692_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|42713_43703_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|44099_45008_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|45199_47221_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|47799_48477_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|48469_49225_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118833.1|49211_50366_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|50362_51403_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001716325.1|51489_52779_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	5.0e-18
WP_000767389.1|52837_53314_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586343.1|54059_55391_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_001598351.1|55464_56049_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.6e-104
WP_074503241.1|56048_59120_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_001598346.1|59184_59784_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.0	2.4e-108
WP_114569525.1|59854_63352_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
WP_000090895.1|63412_64045_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_114569526.1|63981_64725_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.4e-145
WP_001152639.1|64730_65429_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|65428_65758_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840305.1|65754_68316_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000459457.1|68308_68743_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|68724_69147_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_114569637.1|69162_69903_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
WP_000683129.1|69910_70306_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|70302_70881_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|70892_71246_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|71257_71653_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000399648.1|72268_73249_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001299443.1|74054_74387_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123216.1|74396_75716_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_000140265.1|77285_77567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032195591.1|77578_78121_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.5	4.9e-36
WP_001179424.1|78322_78706_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032195592.1|78717_79059_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|79068_80109_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_032195593.1|80326_80776_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000197300.1|80772_81024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761761.1|81225_82641_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.2	6.9e-114
WP_000810838.1|82637_82937_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001244628.1|82943_83162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032195594.1|83151_83364_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	42.4	6.7e-05
WP_000336174.1|83356_83593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114569527.1|83582_84500_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032195595.1|84531_85110_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	63.0	1.2e-56
WP_001029461.1|85166_85424_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000963722.1|85425_86667_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	1.6e-93
WP_000856878.1|86815_87697_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.3	8.6e-163
WP_000198149.1|87693_87900_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_114569528.1|87896_89822_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_114569529.1|89796_90342_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.8e-94
WP_001663509.1|90730_90964_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|91020_91431_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001283921.1|91717_91975_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839225.1|91971_92469_-	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_000092271.1|92670_93129_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	95.4	6.2e-72
WP_001759865.1|93125_93623_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	97.0	2.7e-89
WP_000839582.1|93622_93838_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|95107_96067_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|96259_96784_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|96939_97317_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|97402_97543_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099700.1|97539_97902_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000386643.1|98108_98450_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|98452_98629_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|98625_99153_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|99149_99590_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_024233453.1|99663_99954_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	99.0	6.3e-46
WP_000788877.1|99950_100652_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185506.1|100648_101548_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_114569530.1|101580_101874_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	4.8e-46
WP_000437875.1|101992_102193_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274762.1|102293_103007_+	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	100.0	1.1e-131
WP_001207141.1|103057_103492_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_000512959.1|105259_105637_+	Antitermination protein N	NA	J3JZZ6	Escherichia_phage	97.4	5.6e-55
WP_001278766.1|105629_106124_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000213977.1|106333_106534_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_000065358.1|106716_107085_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	6.5e-64
WP_001198861.1|107157_107322_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|107290_107434_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|107508_107805_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|107810_108596_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186812.1|108592_109273_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|109269_109452_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548531.1|109424_109616_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001395510.1|109626_109908_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_114569531.1|110006_110228_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	98.6	8.4e-35
WP_000120064.1|110438_111041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|111283_111451_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|111490_111709_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|111686_112757_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
114191:114225	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 2
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	579855	676295	4923235	plate,tail,head,holin,terminase,integrase,portal,lysis,protease,capsid	Shigella_phage(45.76%)	96	630002:630048	672393:672439
WP_000131049.1|579855_581889_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001351501.1|582017_582605_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|582618_584091_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|584104_585775_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000370308.1|586898_587594_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023907.1|587586_589014_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|589024_589744_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|590270_591125_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046304.1|591350_592676_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474077.1|592784_593021_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001296896.1|593032_593626_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001716187.1|593789_594656_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001716185.1|594904_595762_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092609.1|595882_600136_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|601251_601353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|601715_601979_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|601978_602119_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|602153_602381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|603203_603746_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|603820_604408_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716392.1|604465_605134_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|605159_607685_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001315269.1|607674_609318_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001296887.1|609286_609997_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|610309_610639_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070693.1|611916_612606_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643313.1|612602_613559_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|613555_615754_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121356.1|615763_616720_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|616698_617109_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_114569535.1|617638_618736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016238.1|618829_621163_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.4	0.0e+00
WP_000842357.1|621177_621501_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001014982.1|621497_621722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046684.1|621721_622270_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	56.9	1.0e-25
WP_000556937.1|622266_622527_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000214379.1|623430_624183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091692.1|624179_624734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185335.1|624735_625008_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000934358.1|627462_628659_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001130502.1|628660_629839_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.6	1.7e-145
630002:630048	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001460374.1|630397_631828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000625667.1|632444_633722_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_005032116.1|633785_635783_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_000355478.1|636410_637184_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.9	1.1e-36
WP_000185984.1|637734_638802_+	acyltransferase	NA	NA	NA	NA	NA
WP_085674526.1|639062_639479_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	71.6	2.9e-20
WP_114569536.1|639478_640405_-	carbohydrate kinase	NA	U5P0I1	Shigella_phage	84.3	3.5e-50
WP_000383547.1|640408_640993_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.4e-113
WP_085674744.1|640983_642042_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.4	7.5e-198
WP_000424732.1|642028_642454_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001201467.1|642453_643002_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	2.4e-94
WP_000999500.1|643001_644081_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	2.6e-206
WP_124038805.1|644077_645406_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.2	3.9e-244
WP_000807205.1|645466_647302_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	1.1e-305
WP_000661047.1|647443_647713_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|647712_648069_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_061157272.1|648068_649565_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	99.6	2.3e-277
WP_000497751.1|649548_649719_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779293.1|649727_650288_-	hypothetical protein	NA	S5FM61	Shigella_phage	100.0	4.7e-106
WP_000224836.1|650284_650791_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|650765_651176_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924830.1|651172_651496_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
WP_000766098.1|651574_652804_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.8	1.5e-226
WP_000999805.1|652814_653417_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_061157273.1|653409_654636_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.5	4.6e-239
WP_000838374.1|654625_654787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124038881.1|654783_656280_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	7.0e-290
WP_000929181.1|656513_657008_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_021552260.1|657133_657484_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	92.2	7.0e-60
WP_021543214.1|657757_658255_-	KilA-N domain-containing protein	NA	Q9AZ05	Salmonella_phage	95.7	1.1e-87
WP_085674742.1|658446_658821_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	79.8	2.7e-49
WP_021543212.1|658859_659327_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	74.3	7.7e-54
WP_021543211.1|659310_659787_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	2.4e-87
WP_001120496.1|659790_660117_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_085674740.1|660414_661746_+	NTPase	NA	R9TRQ8	Vibrio_phage	29.4	3.2e-20
WP_077943988.1|661774_662143_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	86.7	2.7e-54
WP_089477048.1|662157_663147_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001459460.1|663154_663964_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	5.3e-151
WP_001463160.1|663983_664373_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	6.0e-68
WP_001459458.1|664369_664696_-	lexA DNA-binding domain protein	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_001305610.1|664692_665346_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001305611.1|665345_665840_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_001459457.1|665836_666778_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	1.6e-143
WP_001761574.1|666767_666947_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	1.1e-13
WP_001434539.1|667122_667674_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|667711_667912_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|668009_668636_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000917896.1|668821_669118_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008224.1|669794_670331_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	4.8e-100
WP_001242749.1|670321_670684_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|670683_670989_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|671215_672379_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|672583_673837_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
672393:672439	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|673848_674952_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|675239_676295_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 3
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	708458	755038	4923235	transposase,plate,tRNA	Shigella_phage(14.29%)	41	NA	NA
WP_000611742.1|708458_708872_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_114569539.1|708875_710585_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_085968792.1|710577_711755_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.1e-100
WP_171964993.1|711843_711987_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|711950_713033_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|713057_714338_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|714334_714859_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|714861_716193_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|716197_716959_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001609263.1|716967_719781_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.0	6.9e-81
WP_000088859.1|719777_720521_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|720525_721938_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985420.1|722046_725481_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087754.1|725491_726844_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|726867_727350_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908077.1|727393_728308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|728317_728797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086145.1|728933_729719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|730257_730989_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917881.1|731053_731521_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	62.4	2.3e-50
WP_001297210.1|731517_732240_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|732273_733029_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|733100_734459_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_114569540.1|734506_735277_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230963.1|735354_736155_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|736395_737310_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997037.1|737306_738110_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_001140187.1|744006_744582_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|744769_745801_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|745793_746447_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|746486_747302_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|747419_747824_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|747820_748528_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260702.1|748638_750357_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001297208.1|750410_751235_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239152.1|751389_752100_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|752113_752536_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|752532_753078_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|753243_753444_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|753430_753691_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176577.1|753739_755038_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	1154504	1213738	4923235	transposase,protease	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|1154504_1155857_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|1155950_1156502_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|1156657_1158031_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|1158206_1159205_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595986.1|1159237_1160233_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_024198507.1|1160219_1161242_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205791.1|1161255_1162758_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|1163067_1164024_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1164333_1164864_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|1164943_1165294_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|1165287_1165539_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_114569543.1|1165751_1166093_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060921.1|1166095_1169875_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269331.1|1169871_1171605_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|1171810_1172449_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000399648.1|1172674_1173655_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000935036.1|1174050_1175394_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|1175455_1175662_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|1175986_1176544_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|1176533_1177274_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589416.1|1177463_1179407_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|1179535_1179916_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560564.1|1180004_1180865_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|1180972_1181938_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|1182045_1182708_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|1182752_1184165_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|1184473_1185094_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|1185312_1185951_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001371426.1|1186085_1187294_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.1e-208
WP_001350063.1|1188354_1189149_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|1189219_1189669_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|1189710_1189938_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|1189942_1190257_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|1190263_1190659_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|1190985_1191261_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170840.1|1191389_1192076_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949492.1|1192075_1192930_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|1192939_1193590_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|1193603_1194068_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|1194077_1194383_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|1194398_1195796_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|1196150_1197215_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|1197322_1198078_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569695.1|1198074_1198824_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|1199005_1199335_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|1199483_1199759_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299244.1|1199875_1201501_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_114569544.1|1201584_1202748_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.6e-79
WP_000101653.1|1202750_1203389_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1203398_1203797_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1203814_1204474_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1204524_1205223_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1205241_1205643_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1205769_1206501_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_114569545.1|1206680_1209122_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|1209160_1209586_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1209790_1211089_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1211192_1211390_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1211471_1212476_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312484.1|1212478_1213738_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 5
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	2746276	2755625	4923235	transposase,plate	Acinetobacter_phage(25.0%)	10	NA	NA
WP_000106970.1|2746276_2746705_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000484008.1|2746708_2747245_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000373311.1|2747225_2748305_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000342493.1|2748268_2750029_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000199055.1|2750588_2751011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2751104_2752266_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001348777.1|2752294_2752819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031311978.1|2753111_2754092_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.6e-184
WP_124038864.1|2754129_2754357_-	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	86.0	1.1e-13
WP_085947772.1|2754411_2755625_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 6
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	2853728	2860868	4923235		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2853728_2854367_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2854363_2855626_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2855622_2856531_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2856726_2857494_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141314.1|2857544_2858201_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001272900.1|2858306_2860868_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 7
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	2930739	3027313	4923235	tail,transposase,tRNA,terminase,integrase,lysis,protease,portal	Enterobacteria_phage(35.48%)	99	2935775:2935789	2946397:2946411
WP_085947771.1|2930739_2931901_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|2932053_2933772_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|2933773_2935522_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|2935593_2936010_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
2935775:2935789	attL	ATATCGCCTTGATCA	NA	NA	NA	NA
WP_001341819.1|2936048_2937278_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_032083256.1|2937614_2938538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032083255.1|2938530_2938872_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_032083254.1|2938873_2939503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032083253.1|2939515_2940682_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.2	2.8e-145
WP_001331174.1|2940642_2940849_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_021530639.1|2940890_2941757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021530638.1|2941865_2942390_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.1	1.7e-94
WP_000081287.1|2942518_2943343_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|2943408_2943771_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000848749.1|2944439_2945114_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000649477.1|2945204_2945405_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|2945448_2946000_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_063084591.1|2945996_2946833_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	6.0e-150
2946397:2946411	attR	TGATCAAGGCGATAT	NA	NA	NA	NA
WP_001504950.1|2946825_2947062_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	1.9e-37
WP_021527492.1|2947058_2947877_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_074167262.1|2947873_2948368_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	2.1e-86
WP_000066917.1|2948367_2949021_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210164.1|2949017_2949344_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_000767127.1|2949340_2949730_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061378.1|2949749_2950559_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_021538841.1|2950566_2951556_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001204819.1|2951573_2951939_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_023147430.1|2952023_2952470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|2952740_2952944_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_096982353.1|2953094_2954147_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	2.3e-207
WP_057930325.1|2954214_2954430_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	4.5e-33
WP_001709864.1|2954434_2954785_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.6e-35
WP_000992100.1|2954848_2955382_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001300226.1|2955378_2955846_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_001139681.1|2955833_2955986_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_114569569.1|2956671_2957163_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	84.1	1.5e-68
WP_000934127.1|2957162_2959265_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
WP_001072975.1|2959261_2959474_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985968.1|2959473_2960982_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
WP_085967216.1|2960926_2962954_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001097046.1|2963040_2963364_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283144.1|2963356_2963632_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_029700808.1|2963643_2964222_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.6e-101
WP_001079398.1|2964218_2964620_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|2964631_2965375_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001440689.1|2965435_2965822_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_001161009.1|2965830_2966160_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_072692432.1|2966131_2969197_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447247.1|2969196_2969526_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|2969535_2970234_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_064735486.1|2970238_2970982_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.3e-147
WP_050550752.1|2970918_2971527_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.0	8.1e-104
WP_029700815.1|2971587_2975085_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.5	0.0e+00
WP_029700816.1|2975155_2975755_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.5	4.5e-107
WP_072059871.1|2975819_2978891_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	80.7	2.8e-67
WP_029701022.1|2978890_2979475_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	6.6e-103
WP_000355482.1|2979544_2980318_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072095179.1|2980754_2982158_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_012602456.1|2982192_2983407_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_000162574.1|2984212_2984695_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|2984826_2985303_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|2985292_2985583_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|2985644_2985986_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|2986134_2987796_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|2987881_2988760_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|2988882_2989476_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077221315.1|2989530_2990817_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|2990837_2991629_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|2991795_2993157_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|2993405_2993654_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|2993672_2994221_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|2994251_2995019_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|2995060_2995408_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|2995484_2995967_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|2995982_2997209_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|2997198_2997717_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|2997866_2998232_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|2998441_2999512_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|2999522_3000644_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|3000686_3001847_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3001945_3001993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3002096_3002438_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3002708_3003446_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|3003580_3004561_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|3004557_3005289_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3005418_3007992_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|3013770_3015069_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|3015065_3015389_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|3015434_3016790_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082969.1|3016903_3019564_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|3019595_3020294_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3020362_3020782_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997411.1|3020988_3022026_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|3022073_3022763_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627807.1|3023067_3023451_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189206.1|3023505_3024093_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001297408.1|3024195_3025077_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219196.1|3025109_3026444_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001297411.1|3026575_3027313_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	3256738	3299828	4923235	holin,terminase,lysis,integrase,portal,protease,coat	Enterobacteria_phage(45.16%)	69	3245464:3245481	3306679:3306696
3245464:3245481	attL	GGTTGTCGATACCAATAT	NA	NA	NA	NA
WP_000155330.1|3256738_3259411_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	3.2e-59
WP_001075585.1|3259407_3259791_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001027159.1|3259787_3260072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246995.1|3260103_3260463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|3260455_3260632_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_000173141.1|3260992_3261208_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001164795.1|3261310_3262192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024198532.1|3262222_3263497_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.9e-71
WP_001163428.1|3263769_3263970_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_112929951.1|3264027_3264195_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.4e-26
WP_114569574.1|3264353_3264797_-	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	84.8	8.4e-34
WP_047088405.1|3264793_3265159_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	8.7e-69
WP_047088404.1|3265160_3265379_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	55.6	1.8e-13
WP_001594981.1|3265411_3265624_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	91.4	1.5e-33
WP_000403783.1|3265674_3266031_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_114569575.1|3266032_3266542_-	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	45.6	2.2e-33
WP_114569576.1|3266617_3266785_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	6.6e-24
WP_113401498.1|3266795_3267092_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	87.8	3.3e-42
WP_114569577.1|3267115_3267703_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.0	1.9e-105
WP_113401497.1|3267699_3268380_-	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	99.6	2.2e-126
WP_000613347.1|3268388_3268577_-	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
WP_015966850.1|3268573_3268687_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	100.0	2.7e-13
WP_001198866.1|3268679_3268820_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000865175.1|3269001_3269190_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	61.1	1.3e-12
WP_114569578.1|3269189_3269486_-	hypothetical protein	NA	A0A2D1GLR6	Escherichia_phage	94.9	5.2e-48
WP_000394302.1|3269525_3269777_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	9.5e-43
WP_157840108.1|3269831_3269969_-	hypothetical protein	NA	Q716D9	Shigella_phage	97.8	3.9e-22
WP_174222184.1|3270154_3270601_-	antitermination N domain protein	NA	K7PHE0	Enterobacteria_phage	97.5	2.7e-56
WP_112914990.1|3270519_3270792_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	90.0	1.4e-26
WP_162816609.1|3270803_3271220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233129.1|3271366_3271735_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	98.4	8.5e-56
WP_000428318.1|3271753_3272470_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|3272576_3272771_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_021544312.1|3272879_3273158_+	transcriptional activator protein C1	NA	K7P7A2	Enterobacteria_phage	97.8	9.0e-42
WP_000166961.1|3273192_3273354_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539336.1|3273340_3274231_+	hypothetical protein	NA	G5DA89	Enterobacteria_phage	99.7	3.4e-159
WP_162816610.1|3274220_3275657_+	AAA family ATPase	NA	G5DA90	Enterobacteria_phage	99.6	2.3e-274
WP_000736913.1|3275934_3276375_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153280.1|3276371_3276899_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_016063117.1|3276895_3277078_+	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_114569581.1|3277074_3277248_+	protein ninF	NA	K7PL22	Enterobacteria_phage	98.2	2.8e-25
WP_000237097.1|3277237_3277630_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	35.2	2.2e-14
WP_074465589.1|3277622_3277913_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	97.9	2.5e-50
WP_023146907.1|3277909_3278434_+	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_001549462.1|3278434_3278797_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
WP_000994515.1|3278793_3278982_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235461.1|3278978_3279602_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|3280324_3280648_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229390.1|3280631_3281108_+	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
WP_097414186.1|3281104_3281542_+|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	98.6	5.0e-71
WP_024193020.1|3281743_3282262_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	5.5e-93
WP_000342560.1|3282608_3282824_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
WP_000807785.1|3282971_3283214_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000729920.1|3283293_3283782_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_024238508.1|3283759_3285259_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.8	2.4e-306
WP_114569582.1|3285259_3287425_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.9	0.0e+00
WP_080028446.1|3287438_3288350_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	8.3e-161
WP_114569583.1|3288349_3289645_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	8.0e-242
WP_167784818.1|3289688_3290294_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.7	4.6e-59
WP_073461871.1|3290271_3290772_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.9e-90
WP_114569584.1|3290772_3292191_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.2	7.8e-275
WP_114569585.1|3292190_3293039_+	hypothetical protein	NA	Q716G6	Shigella_phage	94.3	1.9e-98
WP_114569586.1|3293038_3293494_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.3e-85
WP_114569587.1|3293496_3294192_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	92.7	1.5e-85
WP_096941567.1|3294201_3295533_+	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	96.8	2.0e-208
WP_114569588.1|3295533_3298302_+	transglycosylase SLT domain-containing protein	NA	A0A2D1GLK8	Escherichia_phage	94.7	0.0e+00
WP_114569589.1|3298319_3298472_-	hypothetical protein	NA	A0A088CPT2	Enterobacteria_phage	61.1	2.5e-06
WP_114569590.1|3298484_3298961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114569591.1|3298880_3299828_+	DNA transfer domain protein	NA	Q716G2	Shigella_phage	99.0	2.5e-160
3306679:3306696	attR	GGTTGTCGATACCAATAT	NA	NA	NA	NA
>prophage 9
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	3535931	3545373	4923235		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|3535931_3536858_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|3536862_3537594_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3537574_3537682_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3537741_3538473_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3538694_3540380_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3540376_3541096_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3541142_3541613_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|3541653_3542115_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|3542239_3544240_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|3544236_3545373_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 10
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	3640363	3649020	4923235		Enterobacteria_phage(42.86%)	8	NA	NA
WP_053273166.1|3640363_3641758_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_052925279.1|3641932_3642826_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.9e-47
WP_053286085.1|3643198_3644284_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.0e-100
WP_053273168.1|3644283_3645183_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	9.7e-29
WP_052925277.1|3645240_3646116_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_057080958.1|3646124_3646679_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.3	1.7e-47
WP_064759649.1|3646687_3647926_+	flippase	NA	NA	NA	NA	NA
WP_052925274.1|3647928_3649020_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	64.4	1.9e-140
>prophage 11
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	4083630	4148282	4923235	tail,terminase,lysis,portal,integrase,protease	Enterobacteria_phage(40.0%)	73	4095811:4095826	4134404:4134419
WP_001260840.1|4083630_4084452_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4084551_4084635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|4084727_4085063_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091819.1|4085459_4086713_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|4086819_4087713_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4087847_4089068_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4089192_4089888_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4089840_4091133_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148713.1|4091291_4091906_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526493.1|4091948_4092803_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213025.1|4092804_4093422_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	2.1e-75
WP_001342196.1|4093432_4095856_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
4095811:4095826	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_000041686.1|4095916_4098343_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_001295396.1|4098541_4098847_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4098954_4099665_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4099667_4100228_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|4100262_4100604_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4100738_4101065_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001296944.1|4101270_4102485_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.1e-46
WP_000836082.1|4102496_4103516_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|4103573_4103702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876973.1|4103703_4104984_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
WP_000005552.1|4105018_4105270_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048328.1|4105342_4107814_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|4107906_4108098_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|4108094_4108283_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|4108682_4108847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|4108850_4109069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4109228_4109384_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001003382.1|4109576_4109984_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
WP_000476993.1|4110061_4110289_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|4110272_4110794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054489.1|4110774_4111740_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	1.3e-55
WP_001151218.1|4111780_4112203_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	4.8e-63
WP_000566845.1|4112455_4113355_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_114569618.1|4113669_4114323_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|4114335_4115031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|4115716_4115929_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000980987.1|4116145_4116397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515373.1|4116463_4116742_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_048237184.1|4116743_4117793_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.2e-109
WP_000904114.1|4117805_4118180_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762864.1|4118176_4118998_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	54.0	5.9e-81
WP_000562553.1|4119898_4120030_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|4120396_4120825_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348755.1|4120996_4121371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|4121622_4121838_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000192451.1|4121842_4122187_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000370545.1|4122152_4122425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101169.1|4122530_4123073_+	lysozyme	NA	Q08J98	Stx2-converting_phage	87.2	3.4e-93
WP_000700651.1|4123069_4123606_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	1.1e-72
WP_000085746.1|4123774_4124467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|4125038_4125533_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934127.1|4125532_4127635_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
WP_001072975.1|4127631_4127844_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985968.1|4127843_4129352_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
WP_085967216.1|4129296_4131324_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001097046.1|4131410_4131734_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283144.1|4131726_4132002_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677108.1|4132013_4132592_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|4132588_4132990_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|4133001_4133745_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|4133805_4134192_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|4134200_4134530_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
4134404:4134419	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_114569619.1|4134501_4137567_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.1	0.0e+00
WP_000447267.1|4137566_4137896_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152336.1|4137905_4138604_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000194745.1|4138609_4139353_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	5.0e-148
WP_001309913.1|4139250_4139898_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000515620.1|4139958_4143438_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.7	0.0e+00
WP_114569620.1|4143506_4144106_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	5.5e-105
WP_071940856.1|4144170_4147701_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
WP_001593356.1|4147700_4148282_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 12
NZ_CP031134	Escherichia coli strain CFSAN064035 chromosome, complete genome	4923235	4791978	4890113	4923235	plate,tail,transposase,head,tRNA,terminase,lysis,portal,integrase,protease,capsid	Salmonella_phage(56.9%)	94	4784939:4784954	4893416:4893431
4784939:4784954	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|4791978_4793271_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|4793361_4794705_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|4794715_4795327_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077086.1|4795481_4799549_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4799683_4800178_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4800722_4801688_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|4801810_4803577_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202179.1|4803577_4805299_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	6.4e-21
WP_001241678.1|4805340_4806045_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4806329_4806548_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000350179.1|4808430_4808985_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001029754.1|4808995_4809997_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	39.9	1.8e-47
WP_000120900.1|4810007_4810931_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_000415804.1|4810927_4812235_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101569.1|4812565_4815799_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.8	2.8e-62
WP_000097888.1|4815795_4816779_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
WP_000934041.1|4817971_4820248_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4820278_4820599_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4820921_4821146_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188140.1|4821218_4823165_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|4823161_4824277_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|4824427_4825384_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|4825380_4827039_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|4827464_4828160_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|4828654_4829554_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|4829697_4831350_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|4831361_4832330_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815350.1|4832462_4834181_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|4834217_4835219_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|4835229_4836660_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|4836758_4837772_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|4837768_4838599_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4838595_4838919_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|4839044_4839560_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4839777_4840506_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|4840523_4841255_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|4841261_4841978_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|4841977_4842646_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|4842937_4843669_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149734.1|4843843_4844971_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|4845011_4845500_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|4845559_4846405_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|4846401_4847355_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|4847364_4848498_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126091.1|4848592_4849705_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4850056_4850533_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4850620_4851523_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001201560.1|4852289_4852577_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|4852736_4852994_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|4853023_4853401_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|4853670_4855356_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|4855591_4855810_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011782.1|4855900_4857001_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	2.9e-176
WP_000980384.1|4856997_4857483_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_001282754.1|4857479_4860557_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|4860549_4860669_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|4860683_4860986_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207656.1|4861040_4861556_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046127.1|4861565_4862738_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.1e-202
WP_000994393.1|4862844_4863258_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	73.0	1.5e-21
WP_000104780.1|4863257_4865177_-|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	47.4	8.0e-81
WP_001086820.1|4865173_4865779_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_000268315.1|4865771_4866680_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.4	2.2e-145
WP_000177571.1|4866666_4867026_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	2.5e-52
WP_000993753.1|4867022_4867601_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	1.5e-91
WP_074169137.1|4869991_4870432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829131.1|4870507_4870954_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.4	4.3e-54
WP_001039937.1|4870946_4871378_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_000196202.1|4871473_4871902_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.2	8.6e-60
WP_001069911.1|4871898_4872414_-	lysozyme	NA	E5G6N1	Salmonella_phage	93.6	1.9e-90
WP_000171568.1|4872394_4872610_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|4872613_4872817_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673514.1|4872816_4873281_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	2.2e-77
WP_000059204.1|4873376_4874027_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_114569635.1|4874030_4875089_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_114569636.1|4875105_4875939_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.7e-123
WP_001098403.1|4876081_4877848_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_000520354.1|4877847_4878915_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.0	1.0e-170
WP_048237166.1|4878999_4879626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000834899.1|4880428_4880854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4881013_4881247_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|4881257_4881446_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000017505.1|4881599_4884014_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_000104144.1|4884010_4884868_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	1.6e-158
WP_000752613.1|4884864_4885092_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244167.1|4885091_4885325_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
WP_000963473.1|4885392_4885734_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|4885697_4885898_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460893.1|4885905_4886415_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|4886447_4886669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047325.1|4886794_4887364_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
WP_001321204.1|4887379_4887571_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_000343760.1|4887789_4889010_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_024174454.1|4889081_4890113_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	5.6e-105
4893416:4893431	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 1
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	0	13464	310064	integrase	Wolbachia_phage(50.0%)	7	NA	NA
WP_044256769.1|1539_1716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115176.1|1963_4351_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_040115178.1|4666_7123_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_004883034.1|7625_8825_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004883035.1|8821_9889_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	32.9	3.7e-35
WP_004883036.1|10128_11376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883039.1|11664_13464_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	23.5	1.8e-29
>prophage 2
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	18052	26702	310064		Cronobacter_phage(25.0%)	9	NA	NA
WP_004883049.1|18052_18883_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	8.4e-43
WP_004883050.1|18963_21030_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.8	2.4e-22
WP_004883051.1|21840_22155_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_064717570.1|22457_22751_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_028699139.1|23070_23421_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	45.1	1.3e-18
WP_004883055.1|23764_24532_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_004883058.1|24644_24929_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004883059.1|24955_25798_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_004883061.1|26063_26702_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	40.1	1.1e-31
>prophage 3
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	53944	57415	310064		Escherichia_phage(50.0%)	6	NA	NA
WP_022652139.1|53944_54337_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	62.6	1.0e-43
WP_022652138.1|54329_54602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652137.1|54710_54869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063087.1|54915_55242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015063086.1|55430_55946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115182.1|56533_57415_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	5.0e-54
>prophage 4
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	61903	63591	310064		Cronobacter_phage(33.33%)	4	NA	NA
WP_015063081.1|61903_62608_-	hypothetical protein	NA	M1EZB9	Cronobacter_phage	27.9	1.8e-17
WP_032610385.1|62686_62986_-	hypothetical protein	NA	A0A2P1JU39	Erwinia_phage	60.0	9.4e-05
WP_022652133.1|63021_63276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652132.1|63327_63591_-	hypothetical protein	NA	A0A076YMQ7	Citrobacter_phage	42.3	1.8e-07
>prophage 5
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	67541	72111	310064		Caulobacter_phage(66.67%)	7	NA	NA
WP_015063076.1|67541_67838_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	36.2	8.4e-06
WP_015063075.1|67846_69028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063074.1|69418_69796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063073.1|69931_70366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258061.1|70366_70687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063032.1|70802_71438_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.4	1.9e-26
WP_022652124.1|71499_72111_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.3	5.2e-26
>prophage 6
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	81234	83860	310064		Salmonella_phage(66.67%)	5	NA	NA
WP_015063024.1|81234_81966_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	7.3e-67
WP_022652358.1|81962_82271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652357.1|82304_82829_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.7	2.8e-44
WP_022652356.1|82859_83468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652355.1|83623_83860_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	1.1e-05
>prophage 7
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	91664	94441	310064		Pectobacterium_phage(50.0%)	4	NA	NA
WP_040115203.1|91664_92075_-	hypothetical protein	NA	A0A2D2W6B4	Pectobacterium_phage	45.1	1.9e-11
WP_032610479.1|92074_92329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155034045.1|92562_92739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115206.1|93235_94441_+	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	27.8	4.5e-13
>prophage 8
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	99349	102862	310064	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_032430896.1|99349_100330_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	4.0e-185
WP_015063010.1|100558_100918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063009.1|100950_101679_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	37.7	3.4e-08
WP_040113315.1|101680_102862_-	S49 family peptidase	NA	A0A2I6UG67	Salinibacter_virus	29.5	7.8e-10
>prophage 9
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	134665	191758	310064	transposase,protease	Escherichia_phage(26.32%)	60	NA	NA
WP_032610457.1|134665_135745_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	5.6e-39
WP_032610456.1|135746_136520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610455.1|136512_137655_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.1	2.5e-29
WP_015062980.1|137664_138723_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_015062979.1|139045_139627_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.6	5.3e-12
WP_015062978.1|139626_140784_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007448.1|140806_141262_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|141284_142325_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_015062976.1|142373_142952_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	1.5e-06
WP_015062975.1|143021_143597_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.6	5.6e-30
WP_032610453.1|143655_144306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062974.1|144321_145563_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_170904152.1|145710_146499_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032610449.1|146704_147334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610521.1|147482_147836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039273855.1|148203_149184_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	6.8e-185
WP_040115229.1|149315_150413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216141.1|150727_150985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246546.1|151374_151668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246547.1|151688_151988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062961.1|152303_153242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062960.1|153247_153763_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
WP_162859440.1|154021_155413_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.2e-103
WP_016246550.1|155541_155709_+	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	56.4	2.3e-08
WP_032610439.1|155732_157052_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_024191726.1|157065_157269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170904153.1|157323_158541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062955.1|158546_159359_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_040113341.1|159859_160525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115233.1|160562_161015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115235.1|161126_161531_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_040115239.1|162191_165200_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.2	0.0e+00
WP_040115241.1|165359_165917_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	46.1	3.8e-39
WP_040115243.1|165933_166797_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_043495618.1|166837_167242_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_043495620.1|167518_167917_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_045284274.1|167921_169130_-	DUF4071 domain-containing protein	NA	NA	NA	NA	NA
WP_080198910.1|169448_170009_+	topoisomerase C-terminal repeat-containing protein	NA	NA	NA	NA	NA
WP_040115250.1|170020_170470_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_040115252.1|170531_170936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001243598.1|171395_171860_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_040115257.1|173923_174274_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072259269.1|174565_175042_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_016241611.1|175156_175594_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000626969.1|175754_176216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137910.1|176190_176511_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|176970_177975_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_044258217.1|178039_178567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004393997.1|178595_179306_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_040115262.1|179307_180513_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032430843.1|180509_181661_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|181657_182266_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022542389.1|182453_183458_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|184061_184391_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|184371_184653_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_040115270.1|184930_185911_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_001752509.1|186227_186728_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|187054_187759_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040115271.1|188899_190939_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.4	4.6e-26
WP_022652199.1|191146_191758_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	94.8	1.1e-84
>prophage 10
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	202406	216088	310064		Wolbachia_phage(33.33%)	13	NA	NA
WP_003092331.1|202406_203471_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	31.3	7.7e-33
WP_003092330.1|203822_204332_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	34.8	1.7e-17
WP_006379607.1|204398_206702_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003092327.1|207247_208075_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.6	1.6e-46
WP_000994919.1|208155_210225_+	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	26.1	7.7e-21
WP_022580212.1|210286_210496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273857.1|211271_211586_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_006379425.1|211898_212192_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162835797.1|212449_212827_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	46.8	5.5e-18
WP_003092318.1|213169_213940_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_001247107.1|214051_214336_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022652188.1|214362_215208_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_003092312.1|215449_216088_+	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	40.0	3.5e-33
>prophage 11
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	221717	222539	310064		Pithovirus(100.0%)	1	NA	NA
WP_023093371.1|221717_222539_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.1	4.1e-10
>prophage 12
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	255801	257034	310064		Pseudomonas_phage(100.0%)	1	NA	NA
WP_032610499.1|255801_257034_-	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.3	4.6e-13
>prophage 13
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	264881	266690	310064		Bacillus_phage(100.0%)	1	NA	NA
WP_015063127.1|264881_266690_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.9	9.7e-20
>prophage 14
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	282844	283768	310064		Enterobacteria_phage(100.0%)	1	NA	NA
WP_074143881.1|282844_283768_-	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.8	6.4e-36
>prophage 15
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	287015	288020	310064		Aeromonas_phage(100.0%)	1	NA	NA
WP_040115168.1|287015_288020_-	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	31.1	1.6e-11
>prophage 16
NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	310064	302781	309648	310064		Salmonella_phage(100.0%)	7	NA	NA
WP_015063098.1|302781_303657_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.8	1.0e-59
WP_022652149.1|304198_305272_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	34.1	2.9e-11
WP_022652148.1|305289_305490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063095.1|305486_306206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063094.1|306472_307294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063093.1|307308_308154_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	37.8	3.5e-44
WP_040115173.1|308493_309648_+	hypothetical protein	NA	A0A060D5B2	Salmonella_phage	27.8	3.1e-19
>prophage 1
NZ_CP031136	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence	109442	0	82749	109442	terminase,portal,capsid,tRNA,tail	Salmonella_phage(96.3%)	91	NA	NA
WP_114569646.1|972_1731_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.9	4.5e-51
WP_114569647.1|1740_2310_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	2.5e-91
WP_024219431.1|2383_4699_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000122502.1|4804_5947_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_076604783.1|6024_6894_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	81.3	6.3e-134
WP_053886718.1|7065_8169_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.2	2.2e-192
WP_000289391.1|8182_8584_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.2	4.7e-60
WP_000781810.1|8580_9057_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
WP_000386469.1|9056_9701_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_001718079.1|9762_10182_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_062859151.1|10191_10749_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	82.5	4.8e-87
WP_114569649.1|10907_11717_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	4.4e-65
WP_000559570.1|11900_12494_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.4e-99
WP_112038702.1|12679_12910_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.1	1.7e-30
WP_001404443.1|13492_14083_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_074430104.1|14231_14726_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
WP_001103988.1|14735_14924_+	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_000900261.1|15017_15443_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_021520148.1|15442_15601_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_114569650.1|15740_16307_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	62.0	8.5e-55
WP_022644971.1|16448_18134_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_114569651.1|18194_18899_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	9.4e-88
WP_047659451.1|18898_19279_+	hypothetical protein	NA	J9Q801	Salmonella_phage	67.4	2.2e-27
WP_000004356.1|19577_20678_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_021512337.1|20835_22869_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_024269800.1|23030_23330_+	hypothetical protein	NA	J9Q750	Salmonella_phage	42.9	1.8e-19
WP_047659412.1|23500_24691_+	hypothetical protein	NA	J9Q803	Salmonella_phage	55.6	3.1e-123
WP_162535791.1|26274_26490_+	hypothetical protein	NA	J9Q804	Salmonella_phage	88.7	5.5e-31
WP_022644956.1|26628_26958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749407.1|27111_27423_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_000216801.1|27549_27945_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
WP_000522000.1|28062_28437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908301.1|28787_29270_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	1.0e-61
WP_023908302.1|29876_30107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031323041.1|30128_30332_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	89.6	1.7e-26
WP_001273881.1|30380_31031_-	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	6.4e-99
WP_023908305.1|31326_31851_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	78.4	2.9e-65
WP_106504433.1|31847_32447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106504421.1|32462_32951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023145145.1|33096_33696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291061.1|33728_34007_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_049076836.1|34009_35569_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	4.1e-277
WP_024170896.1|35633_36332_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
WP_114569652.1|36331_37000_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.2	2.8e-105
WP_000049674.1|36996_37635_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	3.6e-110
WP_001113022.1|37627_37882_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	5.9e-40
WP_000763393.1|37887_38778_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	9.9e-167
WP_000176292.1|38787_39054_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000215413.1|39249_39882_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_001007300.1|39881_41138_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
WP_000422363.1|41164_42739_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.9	8.4e-286
WP_001055286.1|42760_43648_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.6e-132
WP_114569653.1|43673_44549_+|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	3.2e-154
WP_001348642.1|44622_45543_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.9	2.1e-132
WP_001405041.1|45587_46022_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	5.7e-59
WP_000057118.1|46021_46855_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_001027663.1|46934_47279_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|47269_47743_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001405042.1|47744_48128_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	83.5	9.4e-58
WP_000072375.1|48202_48949_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	6.2e-106
WP_000163861.1|49011_49329_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000952686.1|49454_49679_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_114569654.1|49686_54261_+	tape measure protein	NA	J9Q712	Salmonella_phage	83.8	0.0e+00
WP_000511446.1|55498_56197_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.1e-134
WP_000526938.1|56189_56987_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	94.3	5.9e-155
WP_024171470.1|56974_57568_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	3.4e-99
WP_114569655.1|57585_62313_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.2	0.0e+00
WP_001405049.1|62948_63632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114569664.1|64488_66705_+|tail	tail fiber domain-containing protein	tail	J9Q6E3	Salmonella_phage	50.2	1.4e-73
WP_000120169.1|66765_67020_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	3.0e-28
WP_000274392.1|67019_67628_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	74.3	2.6e-78
WP_001717323.1|67950_68274_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_000856758.1|68287_68980_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_000901561.1|68981_69233_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
WP_053886731.1|69605_70025_+	hypothetical protein	NA	J9Q6E9	Salmonella_phage	61.3	2.8e-39
WP_053886730.1|70009_70783_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.5	2.3e-31
WP_000161228.1|70932_71601_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_160394000.1|71606_71960_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	96.9	3.2e-44
WP_114569656.1|72011_73718_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.3	1.3e-13
WP_001717320.1|73899_74640_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_016607338.1|74683_76024_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.3	1.3e-234
WP_162816613.1|76171_77287_+	DNA primase	NA	J9Q720	Salmonella_phage	91.1	4.4e-204
WP_016607336.1|77278_78532_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000038288.1|78759_79173_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	48.1	3.9e-25
WP_099492813.1|79298_80081_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	43.4	3.0e-58
WP_016607333.1|80361_80619_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	2.3e-15
WP_114569658.1|80615_81938_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.5	2.2e-239
WP_000979130.1|81934_82114_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.4e-16
WP_000636536.1|82097_82313_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
WP_114569659.1|82309_82462_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	76.0	1.6e-13
WP_114569660.1|82458_82749_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
>prophage 2
NZ_CP031136	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence	109442	85810	91752	109442	integrase	Salmonella_phage(50.0%)	6	82309:82328	92179:92198
82309:82328	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_000156433.1|85810_86056_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_000797846.1|86266_87370_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_001282577.1|87364_87751_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001098352.1|88001_88214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114569661.1|88312_90421_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.1	6.3e-228
WP_000213833.1|90516_91752_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	81.3	6.7e-198
92179:92198	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
>prophage 3
NZ_CP031136	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence	109442	95075	108279	109442		Salmonella_phage(100.0%)	15	NA	NA
WP_032252480.1|95075_96245_+	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	92.2	2.2e-206
WP_001404458.1|96371_96803_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	4.4e-64
WP_032328850.1|96920_97949_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_032328849.1|98009_98954_+	exonuclease	NA	J9Q7S6	Salmonella_phage	91.4	5.6e-168
WP_000920224.1|98953_99220_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_114569663.1|99222_101562_+	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000591156.1|101653_101854_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
WP_000715581.1|101857_102688_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_022644979.1|102779_103205_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	74.6	5.5e-59
WP_014962290.1|103260_103536_+	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	9.8e-33
WP_001404454.1|103751_104087_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
WP_001229345.1|104086_104299_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001348683.1|104878_106093_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	8.4e-76
WP_000364573.1|106294_106939_+	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_000174803.1|107193_108279_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
>prophage 1
NZ_CP031137	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_3, complete sequence	77958	4522	69617	77958	integrase,protease,transposase	Escherichia_phage(41.94%)	61	31201:31215	64727:64741
WP_000016982.1|4522_5329_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|6101_6857_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|7444_8611_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|8610_9582_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_001348615.1|10448_11351_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|11735_12419_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|12419_12641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|12654_13089_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|13236_13941_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000205718.1|14753_15500_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139341.1|15554_16115_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023861.1|16245_16458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023144756.1|17328_17463_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083850.1|17759_18014_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001016257.1|18173_18920_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_002431311.1|18934_20476_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_014966221.1|20837_20912_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001333237.1|22461_22602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000616807.1|22699_23353_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|23445_23703_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|23635_24037_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|24320_25631_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|25907_26768_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|27352_28057_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|29176_30037_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|30049_30592_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|31073_31265_-	hypothetical protein	NA	NA	NA	NA	NA
31201:31215	attL	AGAATATTGACGGCA	NA	NA	NA	NA
WP_000248278.1|31288_31516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837927.1|31566_32694_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|32730_33435_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|33556_34462_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|34458_35697_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|35696_36281_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|36773_37538_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067858.1|37666_38371_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000679427.1|39017_39365_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|39570_40359_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|40489_40963_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|41865_42570_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|42713_43268_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|43398_44229_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_114569666.1|44366_44999_+	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001067858.1|45382_46087_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_031311978.1|47973_48954_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.6e-184
WP_000412211.1|49027_49687_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|49887_50265_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|50331_53298_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|53300_53861_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000134999.1|54433_55075_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_086258557.1|56047_56242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|56437_57607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042065278.1|58749_58932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066942.1|59052_59793_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361610.1|60077_61055_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001513660.1|62187_62547_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|62574_62754_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|62758_63139_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|63138_63360_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|63542_65099_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
64727:64741	attR	TGCCGTCAATATTCT	NA	NA	NA	NA
WP_001617890.1|65095_66379_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_031311986.1|66500_69617_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
