The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	349739	448712	4784688	terminase,integrase,capsid,tail,head,holin,portal,protease,transposase	Escherichia_phage(49.02%)	103	375370:375386	442836:442852
WP_001355499.1|349739_350948_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_000879833.1|352359_353157_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|353166_353718_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|353886_354219_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|354552_354867_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994454.1|355858_357517_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_114455192.1|357509_358505_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_162814782.1|358561_358822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114455193.1|358814_359501_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|359500_360874_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|360892_361336_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_114455194.1|361332_362460_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133119.1|362564_363029_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|363033_364038_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|364034_364448_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|364450_364816_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|364815_365553_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|365562_365832_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983977.1|365840_366626_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000104004.1|366915_367539_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|367582_367825_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|367933_368161_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_114455195.1|368458_369277_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_077896703.1|369273_370968_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|371177_371360_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|371438_372356_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212240.1|372528_373449_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_001537202.1|373437_373908_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	4.0e-34
WP_001157256.1|373888_375307_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
375370:375386	attL	GCGCTCAGCCAGCAGGT	NA	NA	NA	NA
WP_000826782.1|377415_378774_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.9e-05
WP_001339045.1|378773_379445_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|379577_379991_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740110.1|380099_381104_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240102.1|381104_381740_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007745.1|381996_382647_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079079.1|382989_383520_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	2.5e-56
WP_106667872.1|384499_384787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106667873.1|384800_385502_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	62.3	4.1e-59
WP_078207397.1|385511_385793_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	9.1e-18
WP_106667874.1|385792_388189_-|tail	phage tail protein	tail	I1TE37	Escherichia_virus	41.0	2.8e-83
WP_016231748.1|388253_388853_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	4.8e-101
WP_016231749.1|388920_392400_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000090871.1|392460_393093_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	7.2e-95
WP_019842931.1|393029_393773_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.6	8.8e-153
WP_106667875.1|393777_394476_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	2.0e-130
WP_001330090.1|394475_394832_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_021537294.1|394809_398037_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
WP_063101268.1|398083_398344_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.8	7.1e-41
WP_001312914.1|398385_398772_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_000097533.1|398771_399476_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|399535_399880_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_098704358.1|399876_400326_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.9	1.0e-63
WP_001147820.1|400322_400661_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|400669_400975_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_097444430.1|400986_401175_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	98.4	1.6e-26
WP_098704359.1|401226_402432_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	1.2e-223
WP_001193631.1|402446_403097_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466247.1|403074_404316_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000478567.1|404315_404498_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_001140891.1|404509_406267_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001317918.1|406266_406749_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001532429.1|406897_407248_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
WP_001532432.1|407386_407926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|407931_408198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|408415_408601_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|408817_409351_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193280.1|409414_409765_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|409769_409985_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064894.1|410780_411470_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000140004.1|411466_411832_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_024188444.1|411832_412888_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_024175747.1|412889_413168_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|413464_413857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|414000_414213_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_021526748.1|414447_414963_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	75.5	2.8e-36
WP_021537287.1|415128_415311_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.2e-26
WP_000761437.1|415404_415818_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	2.7e-58
WP_089423829.1|415814_416240_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	1.3e-63
WP_021511941.1|416280_417351_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_000693853.1|417422_417848_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261754.1|417844_418072_-	cell division control protein	NA	NA	NA	NA	NA
WP_000444613.1|418171_418816_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_000379575.1|419093_419249_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|419408_419627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|419630_419795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|420194_420383_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070256.1|420379_420571_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_114455196.1|420664_423136_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096344.1|423194_423398_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|423397_424423_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001442913.1|424658_425456_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_032159762.1|425945_433022_+	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_000378575.1|434650_435967_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|436068_437523_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|437865_438582_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001396178.1|439211_440855_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011008.1|440972_441923_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011462.1|442024_442942_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
442836:442852	attR	ACCTGCTGGCTGAGCGC	NA	NA	NA	NA
WP_000986321.1|443399_444335_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001166160.1|444396_445476_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|445487_446231_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|446227_446773_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_085948316.1|447438_448712_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 2
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	611691	619999	4784688		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001326004.1|611691_613692_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001378226.1|613816_614278_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_000950409.1|614317_614788_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001326002.1|614834_615554_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|615550_617236_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|617457_618189_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|618248_618356_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|618336_619068_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|619072_619999_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 3
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	825558	886955	4784688	integrase,transposase,tRNA	Shigella_phage(28.57%)	45	858500:858518	899401:899419
WP_001283581.1|825558_826371_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|826370_827384_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|827449_828586_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615821.1|828684_829680_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|829676_830855_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|831119_832340_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683804.1|832498_834505_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|834625_834904_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|834937_835486_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447355.1|835485_836295_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043821.1|836294_837119_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|837122_838208_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|838242_839175_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|839340_839892_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_106486969.1|840687_841961_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	2.3e-169
WP_000730291.1|842208_842733_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|842729_843200_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|843196_843745_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|843719_844472_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000033328.1|847214_847778_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|848461_848947_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425058.1|849149_851294_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|851293_852604_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|852783_853068_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001295701.1|853439_854780_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776768.1|856386_857142_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|857435_858368_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
858500:858518	attL	ATTCCTGCAGGGGACACCA	NA	NA	NA	NA
WP_001131472.1|858693_859884_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
WP_072003506.1|861149_861305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165811.1|862141_862441_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000839828.1|862617_864978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032318120.1|865621_866638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093090.1|867119_869318_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000117529.1|869314_870631_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000424706.1|870634_872944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123863910.1|873694_873985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824228.1|875218_876508_+	MFS transporter	NA	NA	NA	NA	NA
WP_000864948.1|876479_877505_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024241484.1|878048_878867_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	1.5e-65
WP_032300942.1|878902_879205_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000950719.1|882781_883120_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000186597.1|883113_883401_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001361993.1|884159_884519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000906844.1|884566_885238_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087903688.1|885742_886955_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	8.9e-102
899401:899419	attR	ATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 4
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	1042038	1048252	4784688	transposase	Escherichia_phage(66.67%)	8	NA	NA
WP_000017552.1|1042038_1042191_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000075997.1|1042208_1042385_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	96.4	3.8e-22
WP_000169547.1|1042431_1042731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878219.1|1042727_1043594_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001317257.1|1043971_1044490_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000755184.1|1044505_1045045_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	94.4	3.8e-44
WP_000138288.1|1045139_1046717_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1046785_1048252_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 5
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	1251815	1258955	4784688		Escherichia_phage(83.33%)	6	NA	NA
WP_001272897.1|1251815_1254377_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141308.1|1254482_1255139_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.8	1.1e-48
WP_001272549.1|1255189_1255987_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|1256152_1257061_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590385.1|1257057_1258320_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|1258316_1258955_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	2501435	2582051	4784688	terminase,integrase,capsid,tail,lysis,head,holin,plate,transposase,portal,protease,tRNA	Escherichia_phage(32.0%)	92	2532109:2532155	2566108:2566154
WP_000560983.1|2501435_2501873_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|2501917_2502859_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|2502922_2503831_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|2504059_2504371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|2504371_2504662_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|2505266_2505485_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|2505703_2505946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|2506275_2507205_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2507201_2507837_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|2507833_2508736_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|2508748_2511799_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753583.1|2511992_2512826_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|2512978_2514019_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931336.1|2514068_2515817_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019461.1|2515816_2516887_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446026.1|2516876_2518328_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|2518338_2518785_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|2519097_2519412_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|2519421_2520246_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001325794.1|2520487_2521747_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144052.1|2521743_2523213_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|2523500_2524337_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|2524320_2525259_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063502.1|2525255_2526290_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|2526574_2527195_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|2527454_2528438_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270263.1|2528586_2529261_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2529366_2530740_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2530736_2531435_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2531584_2532085_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2532109:2532155	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_025237963.1|2532271_2533252_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.4	2.3e-185
WP_016237179.1|2533321_2533615_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	99.0	1.0e-48
WP_001308179.1|2533751_2534024_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217671.1|2534193_2534694_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_025653498.1|2534757_2534982_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	8.8e-32
WP_025653499.1|2534981_2535281_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	2.5e-45
WP_001113264.1|2535283_2535508_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|2535504_2535780_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_025653500.1|2535769_2538055_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	98.8	0.0e+00
WP_014640573.1|2538054_2538507_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_000554771.1|2538506_2538713_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001143634.1|2538955_2539894_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000570053.1|2539890_2540928_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_000368931.1|2540920_2541994_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000038182.1|2542409_2543444_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_000156872.1|2543443_2545216_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|2545389_2546244_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_047662263.1|2546302_2547376_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	2.5e-201
WP_088539806.1|2547379_2548123_+|terminase	terminase endonuclease subunit	terminase	Q94MF3	Enterobacteria_phage	99.2	5.1e-124
WP_000988642.1|2548222_2548732_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	100.0	1.9e-90
WP_001773438.1|2548731_2548935_+|tail	tail protein X	tail	A0A0F7LCK1	Escherichia_phage	98.5	8.8e-31
WP_000123124.1|2548938_2549220_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|2549219_2549717_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_032286569.1|2549731_2550157_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	100.0	1.8e-62
WP_001534990.1|2550144_2550570_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	100.0	4.5e-69
WP_072127147.1|2550541_2550715_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	1.5e-23
WP_000917190.1|2550677_2551145_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_001001786.1|2551137_2551590_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_033557336.1|2551656_2552292_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	99.5	1.3e-112
WP_000127164.1|2552288_2552636_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121497.1|2552640_2553549_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_001285313.1|2553541_2554072_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_088539808.1|2554082_2556092_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.3	0.0e+00
WP_001164114.1|2556095_2556623_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	95.4	1.8e-91
WP_085948316.1|2556674_2557948_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000014362.1|2558174_2559074_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001286683.1|2559393_2560584_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_001251408.1|2560596_2561115_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2561171_2561447_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2561479_2561599_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021568196.1|2561591_2564039_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	99.9	0.0e+00
WP_000978900.1|2564053_2564533_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_000882968.1|2564532_2565696_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000468308.1|2565777_2565996_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|2566232_2567135_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2566108:2566154	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|2567315_2568278_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|2568597_2569587_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708998.1|2569693_2570449_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|2570503_2571271_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|2571378_2571978_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|2572078_2572519_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|2572730_2573030_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|2573056_2573485_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|2573489_2574236_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|2574332_2575343_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|2575477_2576986_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|2577008_2577854_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2578278_2578524_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2578608_2579094_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2579186_2580113_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|2580179_2581511_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208243.1|2581520_2582051_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 7
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	3353227	3365682	4784688	integrase	Enterobacteria_phage(37.5%)	13	3355366:3355380	3366741:3366755
WP_000749863.1|3353227_3354283_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3354570_3355674_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
3355366:3355380	attL	AAACGCTGGATTTTC	NA	NA	NA	NA
WP_000893255.1|3355685_3356939_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_021511808.1|3357294_3358509_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	1.3e-132
WP_000035054.1|3358936_3359140_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001019369.1|3359583_3360417_+	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|3360409_3360592_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021513511.1|3360585_3361653_+	ash family protein	NA	NA	NA	NA	NA
WP_001065738.1|3361645_3361840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3361836_3362100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3362096_3362318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021513512.1|3362310_3362913_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_001244106.1|3362925_3365682_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
3366741:3366755	attR	GAAAATCCAGCGTTT	NA	NA	NA	NA
>prophage 8
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	3618231	3682203	4784688	terminase,tail,lysis,head,portal,protease,tRNA	Enterobacteria_phage(46.43%)	61	NA	NA
WP_001295836.1|3618231_3618855_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|3618825_3619512_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561845.1|3619508_3621923_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021529774.1|3622351_3626563_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_096262929.1|3626543_3627035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|3628036_3629131_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|3629199_3630126_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|3630355_3630838_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141276.1|3630915_3631731_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001297446.1|3631820_3633602_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	6.0e-38
WP_000943556.1|3633614_3634391_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|3634490_3635369_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401117.1|3635537_3636992_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006903.1|3637051_3638413_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|3638469_3639771_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|3639792_3640938_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540996.1|3641066_3641852_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001297443.1|3641862_3643098_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703911.1|3643119_3644169_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|3644485_3646153_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495372.1|3646162_3647422_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001301143.1|3647432_3648248_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|3648244_3649138_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815522.1|3649332_3650400_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|3650396_3650906_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|3651023_3651746_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|3651748_3652243_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|3652416_3653802_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|3653837_3654359_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3654466_3654679_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_096262930.1|3654680_3655547_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.2	1.3e-30
WP_000776555.1|3656027_3656570_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988378.1|3656789_3657482_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|3660133_3661141_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250424.1|3661151_3661667_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|3661669_3662302_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_000433949.1|3663655_3664027_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_000206813.1|3664026_3664332_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|3664331_3664694_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008165.1|3664684_3665221_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|3665348_3666173_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|3666238_3666601_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|3667071_3667587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204780.1|3667712_3668096_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|3668285_3669383_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|3669971_3670187_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|3670186_3670684_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|3670900_3671083_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|3671173_3671467_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001298896.1|3671757_3672168_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|3672453_3672660_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|3672824_3673019_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453623.1|3673407_3673953_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	5.2e-94
WP_001027290.1|3673927_3675853_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198146.1|3675849_3676056_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	1.3e-29
WP_001326104.1|3676052_3676412_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	96.2	1.6e-54
WP_044059726.1|3676506_3677040_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.1e-92
WP_000239881.1|3677094_3677763_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|3677819_3678125_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001160804.1|3679812_3680274_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103149.1|3680301_3682203_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.7e-27
>prophage 9
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	4483125	4517261	4784688	integrase,tail,lysis,tRNA,transposase	Escherichia_phage(62.5%)	39	4485093:4485107	4506243:4506257
WP_001389212.1|4483125_4484358_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|4484612_4485596_+	zinc transporter ZntB	NA	NA	NA	NA	NA
4485093:4485107	attL	TTTATCGAGCAGCTG	NA	NA	NA	NA
WP_000123719.1|4486073_4487447_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.6e-52
WP_001157408.1|4487575_4488511_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	7.7e-146
WP_000040858.1|4488562_4489798_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_000079604.1|4489799_4490015_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|4490093_4490303_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|4490295_4490490_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|4490546_4491356_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105139.1|4491348_4493949_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000632297.1|4494050_4494326_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|4494400_4494571_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_112021577.1|4494570_4494792_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	1.7e-35
WP_001312793.1|4495233_4495722_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|4495718_4495874_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|4495884_4496064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|4496306_4496726_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|4496805_4497060_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693800.1|4497056_4497479_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.1	5.0e-68
WP_001326319.1|4497556_4498345_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	1.4e-42
WP_000788982.1|4498351_4499098_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	1.3e-114
WP_000450652.1|4499120_4499846_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	6.1e-82
WP_001151415.1|4499862_4500285_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.9	2.2e-60
WP_000686865.1|4500421_4500694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214879.1|4500964_4501633_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001326322.1|4502244_4502583_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940312.1|4503453_4504053_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	7.2e-105
WP_000228032.1|4504052_4504343_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640107.1|4504339_4504882_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000839596.1|4506167_4506383_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
4506243:4506257	attR	CAGCTGCTCGATAAA	NA	NA	NA	NA
WP_001135296.1|4506382_4506880_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_001228696.1|4507096_4507282_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001697073.1|4507478_4508936_+	TrkG potassium ion Trk transporter	NA	NA	NA	NA	NA
WP_001291108.1|4509073_4509862_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	3.3e-49
WP_001228247.1|4511554_4512154_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	5.4e-100
WP_000741769.1|4512218_4514594_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_114455226.1|4514593_4514899_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	52.8	2.4e-16
WP_085948316.1|4514895_4516168_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_001326214.1|4516220_4517261_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	84.1	1.6e-160
>prophage 10
NZ_CP031105	Escherichia coli strain AMSCJX02 chromosome, complete genome	4784688	4728567	4779002	4784688	terminase,tail,lysis,portal,protease	Enterobacteria_phage(48.98%)	65	NA	NA
WP_000527752.1|4728567_4730028_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	2.5e-42
WP_000347482.1|4730116_4731400_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4732003_4732117_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|4732185_4732419_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087134.1|4732737_4733328_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.8e-24
WP_071528129.1|4733425_4733515_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	82.8	1.1e-06
WP_000355601.1|4733555_4733849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021560598.1|4733891_4734932_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_094259113.1|4734941_4735223_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	9.1e-18
WP_094259114.1|4735219_4737607_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	48.5	9.9e-105
WP_114455229.1|4737665_4741061_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.4	0.0e+00
WP_001445893.1|4741121_4741769_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
WP_094276436.1|4741666_4742410_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_021568043.1|4742415_4743114_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.4	1.1e-131
WP_000447253.1|4743123_4743453_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372030.1|4743452_4746509_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.1	0.0e+00
WP_001161009.1|4746480_4746810_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|4746818_4747205_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211128.1|4747265_4748009_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001079419.1|4748019_4748421_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677120.1|4748417_4749008_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001283158.1|4749019_4749295_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	6.6e-45
WP_001097047.1|4749287_4749611_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	7.2e-51
WP_085961001.1|4749697_4751725_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_000985958.1|4751669_4753178_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001072975.1|4753177_4753390_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934104.1|4753386_4755489_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000373425.1|4755488_4755983_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001031431.1|4756545_4756752_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_001445895.1|4757052_4757463_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	1.0e-62
WP_001019606.1|4757614_4757788_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|4757959_4758115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|4758194_4758260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|4758262_4758451_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4758461_4758674_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|4759037_4759535_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|4759531_4760065_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|4760061_4760373_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|4760377_4760593_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|4761346_4761562_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_001047082.1|4762237_4762990_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	2.1e-130
WP_001445896.1|4763003_4764053_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.7e-112
WP_032157702.1|4764054_4764333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980984.1|4764399_4764651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|4764867_4765080_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_021568046.1|4765635_4766301_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001366387.1|4766354_4766588_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_001151183.1|4766584_4767007_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_000054497.1|4767047_4768013_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_000705360.1|4767993_4768515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|4768498_4768726_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|4768806_4769214_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379591.1|4769382_4769535_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001320327.1|4769546_4769912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|4769880_4770081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935596.1|4770592_4771447_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000450218.1|4771457_4771646_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093903.1|4771642_4771834_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_114455230.1|4771926_4774398_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	5.0e-59
WP_001296941.1|4774485_4774722_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_162814784.1|4774756_4776037_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
WP_001531709.1|4776062_4776167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836054.1|4776224_4777244_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|4777255_4778470_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4778675_4779002_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 1
NZ_CP031107	Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence	203856	66038	119948	203856	integrase,transposase,protease	Macacine_betaherpesvirus(36.36%)	43	80699:80718	133678:133697
WP_001513510.1|66038_67010_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	31.7	3.2e-25
WP_000092896.1|67270_67483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343071.1|67495_68071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817028.1|69289_70261_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|70260_71427_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_001513513.1|73294_75037_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.4	2.7e-19
WP_001513514.1|75039_76581_-	lasso peptide isopeptide bond-forming cyclase	NA	NA	NA	NA	NA
WP_001513515.1|76583_77210_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_001513516.1|77549_77726_+	lasso peptide microcin J25	NA	NA	NA	NA	NA
WP_001523378.1|78852_79065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387373.1|79793_80051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053270998.1|80146_80593_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.8e-28
80699:80718	attL	TATCACTTAAATAAGTGATA	NA	NA	NA	NA
WP_089638411.1|80712_81985_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
WP_001513526.1|82861_83644_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.0	3.0e-50
WP_001159871.1|83644_83950_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|83951_84170_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001513525.1|84725_85415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513524.1|85446_86136_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_001261287.1|86554_86785_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|86781_87198_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001513523.1|87359_89498_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001261286.1|89884_90115_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|90111_90528_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|90602_92168_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|92152_93175_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000973520.1|94631_96833_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|96914_98192_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|98188_99931_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011908.1|99930_100878_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|100878_102603_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095526.1|102738_103932_+	MFS transporter	NA	NA	NA	NA	NA
WP_001318207.1|104311_104692_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000968139.1|105934_106792_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|106788_107646_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|107642_108470_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|108469_109384_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000361611.1|112364_113342_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001603634.1|113626_114367_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_032145890.1|114487_114676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312822.1|115050_115953_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771476.1|116021_117131_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280979.1|117563_118517_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|119789_119948_-|transposase	transposase	transposase	NA	NA	NA	NA
133678:133697	attR	TATCACTTAAATAAGTGATA	NA	NA	NA	NA
>prophage 2
NZ_CP031107	Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence	203856	152445	180083	203856	transposase,protease	Stx2-converting_phage(37.5%)	20	NA	NA
WP_001183604.1|152445_154560_+	microcin H47 export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|154729_155041_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|155018_155255_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|156194_156464_+	membrane protein	NA	NA	NA	NA	NA
WP_001017347.1|156460_157441_+	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_089626652.1|157495_157690_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	3.1e-25
WP_000381395.1|157693_159265_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_004023834.1|159284_159632_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.9	1.5e-46
WP_114455237.1|159631_160279_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.4e-21
WP_085955967.1|160327_161673_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.5e-75
WP_000171090.1|161867_162029_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.1	3.8e-21
WP_000612591.1|162025_162373_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001696784.1|164549_168683_-|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	4.3e-297
WP_096001968.1|170711_171924_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	5.5e-168
WP_000124098.1|172234_172600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487120.1|173066_174077_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
WP_001323889.1|174665_176243_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001323888.1|176396_176564_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|176552_177113_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|177116_180083_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
>prophage 1
NZ_CP031108	Escherichia coli strain AMSCJX02 plasmid pAMSC3, complete sequence	27197	930	5040	27197		Escherichia_phage(100.0%)	8	NA	NA
WP_001683864.1|930_1665_-	DUF551 domain-containing protein	NA	A0A2I6TCG8	Escherichia_phage	95.6	2.1e-77
WP_044063754.1|1661_1952_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	99.0	4.3e-47
WP_001683862.1|1951_2371_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	99.3	4.3e-72
WP_032144474.1|2370_2928_-	3'-5' exoribonuclease	NA	A0A2I6TCA6	Escherichia_phage	98.4	1.6e-106
WP_153275786.1|2993_3167_-	hypothetical protein	NA	A0A2I6TCC8	Escherichia_phage	100.0	1.0e-27
WP_001542485.1|3430_4141_-	hypothetical protein	NA	A0A2I6TCB3	Escherichia_phage	100.0	8.8e-134
WP_001386907.1|4130_4352_-	hypothetical protein	NA	A0A2I6TCB1	Escherichia_phage	100.0	2.1e-33
WP_001495876.1|4443_5040_+	XRE family transcriptional regulator	NA	A0A2I6TCW0	Escherichia_phage	100.0	2.8e-109
>prophage 2
NZ_CP031108	Escherichia coli strain AMSCJX02 plasmid pAMSC3, complete sequence	27197	9470	27005	27197		Escherichia_phage(95.45%)	23	NA	NA
WP_001555405.1|9470_9797_+	hypothetical protein	NA	O64345	Escherichia_phage	63.6	1.6e-34
WP_061091773.1|9799_10195_+	hypothetical protein	NA	A0A2I6TCB8	Escherichia_phage	97.7	6.5e-70
WP_001542488.1|10885_11050_+	host cell division inhibitor Icd-like protein	NA	A0A2I6TCE0	Escherichia_phage	98.1	1.9e-20
WP_114455238.1|11046_11280_+	hypothetical protein	NA	A0A2I6TCC2	Escherichia_phage	92.2	7.8e-31
WP_001542490.1|11276_11441_+	hypothetical protein	NA	A0A2I6TCD0	Escherichia_phage	94.1	7.4e-20
WP_114455239.1|11486_13406_-	protelomerase	NA	A0A2I6TCW8	Escherichia_phage	98.7	0.0e+00
WP_114455239.1|13788_15708_+	protelomerase	NA	A0A2I6TCW8	Escherichia_phage	98.7	0.0e+00
WP_001542490.1|15753_15918_-	hypothetical protein	NA	A0A2I6TCD0	Escherichia_phage	94.1	7.4e-20
WP_114455238.1|15914_16148_-	hypothetical protein	NA	A0A2I6TCC2	Escherichia_phage	92.2	7.8e-31
WP_001542488.1|16144_16309_-	host cell division inhibitor Icd-like protein	NA	A0A2I6TCE0	Escherichia_phage	98.1	1.9e-20
WP_001542487.1|16685_16973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061091773.1|17000_17396_-	hypothetical protein	NA	A0A2I6TCB8	Escherichia_phage	97.7	6.5e-70
WP_001555405.1|17398_17725_-	hypothetical protein	NA	O64345	Escherichia_phage	63.6	1.6e-34
WP_001683860.1|17913_21909_-	hypothetical protein	NA	A0A2I6TD01	Escherichia_phage	95.1	0.0e+00
WP_001495876.1|22154_22751_-	XRE family transcriptional regulator	NA	A0A2I6TCW0	Escherichia_phage	100.0	2.8e-109
WP_001386907.1|22842_23064_+	hypothetical protein	NA	A0A2I6TCB1	Escherichia_phage	100.0	2.1e-33
WP_001542485.1|23053_23764_+	hypothetical protein	NA	A0A2I6TCB3	Escherichia_phage	100.0	8.8e-134
WP_153275786.1|24027_24201_+	hypothetical protein	NA	A0A2I6TCC8	Escherichia_phage	100.0	1.0e-27
WP_032144474.1|24266_24824_+	3'-5' exoribonuclease	NA	A0A2I6TCA6	Escherichia_phage	98.4	1.6e-106
WP_001683862.1|24823_25243_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	99.3	4.3e-72
WP_044063754.1|25242_25533_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	99.0	4.3e-47
WP_001683864.1|25529_26264_+	DUF551 domain-containing protein	NA	A0A2I6TCG8	Escherichia_phage	95.6	2.1e-77
WP_096975400.1|26477_27005_+	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	95.2	1.5e-37
>prophage 1
NZ_CP031109	Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence	46827	16957	26137	46827	transposase	Escherichia_phage(28.57%)	9	NA	NA
WP_000731968.1|16957_17491_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	2.0e-21
WP_001067855.1|18407_19112_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|19121_19592_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|19611_20400_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|20399_20918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|20922_21339_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|21724_22429_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003124096.1|22585_23146_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_013362812.1|25168_26137_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
>prophage 1
NZ_CP031110	Escherichia coli strain AMSCJX02 plasmid pAMSC5, complete sequence	50124	3021	14113	50124	integrase,transposase	Enterobacteria_phage(42.86%)	8	1171:1182	12389:12400
1171:1182	attL	AAACTGCCGCCG	NA	NA	NA	NA
WP_114455244.1|3021_3552_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	33.3	1.7e-09
WP_000845048.1|3653_4667_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|4869_5220_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|5345_5906_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|5908_8875_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000027057.1|9343_10204_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|10386_10944_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|11107_14113_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
12389:12400	attR	CGGCGGCAGTTT	NA	NA	NA	NA
