The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	72	41304	5268719	integrase,terminase,coat,tRNA,holin,head,protease	Escherichia_phage(19.51%)	60	4365:4379	39964:39978
WP_004178849.1|72_453_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_029884066.1|455_695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029884065.1|727_1783_-|coat	phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.2	3.8e-101
WP_016529582.1|1779_2241_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_020804671.1|2240_3596_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
WP_114212793.1|3825_4833_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.5	4.8e-117
4365:4379	attL	TCGTCTGGCTGGCGT	NA	NA	NA	NA
WP_094794169.1|4759_6229_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	1.1e-149
WP_094794167.1|6241_7540_-|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	93.9	1.8e-241
WP_048294303.1|7523_7991_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_087499182.1|8021_8660_-	hypothetical protein	NA	H9C189	Pectobacterium_phage	75.6	6.1e-94
WP_048294297.1|9389_9740_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	37.2	7.9e-11
WP_065520805.1|9736_10231_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	93.9	3.9e-88
WP_019704119.1|10208_10433_-|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_114212794.1|10962_11646_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	8.9e-59
WP_032429601.1|11642_11783_-	YlcG family protein	NA	NA	NA	NA	NA
WP_114212795.1|11779_12415_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	1.0e-80
WP_032413853.1|12407_12578_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_114212796.1|12583_13180_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	3.6e-56
WP_087661456.1|13275_13533_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	74.7	2.7e-24
WP_032438688.1|13609_14536_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	41.5	4.8e-55
WP_114212797.1|14645_15320_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	53.6	1.1e-48
WP_004223219.1|15316_15697_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	95.2	6.0e-65
WP_004223216.1|15828_16053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223213.1|16052_16541_-	hypothetical protein	NA	A0A2H4N7C3	Pectobacterium_phage	34.9	1.9e-07
WP_114212798.1|16769_17183_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	37.8	5.5e-11
WP_046659684.1|17179_17404_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	52.9	5.7e-15
WP_004223202.1|17400_17703_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004178817.1|17702_18479_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
WP_032448145.1|18475_19204_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_004223188.1|19337_19559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201115.1|19598_19826_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_114212887.1|19937_20636_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.6	4.0e-107
WP_032426564.1|20997_22071_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	86.8	3.8e-181
WP_032426277.1|22109_22313_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.6e-19
WP_072140575.1|22622_22748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|22740_22935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042632508.1|23023_23308_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	1.9e-39
WP_014342891.1|23717_24053_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_049016883.1|24049_24673_+	YqaJ-like viral recombinase domain protein	NA	S0A2A9	Cellulophaga_phage	48.6	3.5e-46
WP_023283323.1|24669_24828_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_074384827.1|24824_25352_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	2.4e-56
WP_074384826.1|25565_26243_+	hypothetical protein	NA	Q71T76	Escherichia_phage	55.8	2.0e-58
WP_074384825.1|26239_26944_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.6	7.1e-27
WP_074384824.1|26940_27159_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	49.3	1.1e-10
WP_004223135.1|27160_27496_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004191604.1|27372_28536_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
WP_004143017.1|28966_29833_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004223130.1|29834_30047_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004191607.1|30092_31478_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|31653_32148_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004191610.1|32151_32874_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004223118.1|32981_33320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223115.1|33416_33926_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004223112.1|33922_34990_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151323.1|35101_36178_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004142997.1|36285_37431_-	porin	NA	NA	NA	NA	NA
WP_020316407.1|37522_37636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147400.1|37612_40027_-	ABC transporter permease	NA	NA	NA	NA	NA
39964:39978	attR	ACGCCAGCCAGACGA	NA	NA	NA	NA
WP_004151324.1|40023_40710_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
WP_004196998.1|40680_41304_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 2
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	2669808	2727140	5268719	integrase,terminase,tail,protease,transposase	Salmonella_phage(43.18%)	59	2670803:2670820	2729888:2729905
WP_004151980.1|2669808_2671275_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
2670803:2670820	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|2671342_2672920_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032447891.1|2673111_2674362_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.6	1.3e-204
WP_032447890.1|2674379_2674571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032447888.1|2674567_2675161_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	2.5e-110
WP_032447887.1|2675157_2675349_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	2.7e-13
WP_032447886.1|2675345_2676020_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	70.9	4.1e-88
WP_048264082.1|2676016_2676175_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_032458655.1|2676167_2676461_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
WP_004144294.1|2676570_2676819_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_032447885.1|2676867_2677749_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	4.0e-136
WP_032447884.1|2677745_2678567_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.6	6.2e-131
WP_004164029.1|2678563_2678863_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004197420.1|2679231_2679813_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	4.6e-64
WP_004152538.1|2679967_2680201_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_032447881.1|2680547_2681219_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	88.6	8.1e-97
WP_023339268.1|2681208_2681985_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	91.7	4.3e-57
WP_032447878.1|2682110_2682455_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	86.8	9.7e-54
WP_032458942.1|2682647_2683037_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.3	1.2e-15
WP_032458656.1|2683033_2683942_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A140XFY9	Salmonella_phage	81.0	1.3e-145
WP_032458657.1|2684489_2684702_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	1.1e-10
WP_023301597.1|2686076_2686406_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	8.7e-28
WP_032447991.1|2686463_2687048_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	1.9e-89
WP_032447875.1|2687044_2688520_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	5.4e-279
WP_032447874.1|2688516_2689305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|2690040_2690247_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032447873.1|2690261_2691944_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.5e-264
WP_032447872.1|2691940_2692240_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	67.4	6.9e-32
WP_032447871.1|2692236_2692560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032447870.1|2692571_2693276_+	peptidase	NA	G9L6C4	Escherichia_phage	71.4	8.3e-60
WP_023301604.1|2693290_2694277_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	3.3e-179
WP_032447865.1|2694330_2694768_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	2.8e-66
WP_032447864.1|2694778_2695120_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	69.9	1.2e-35
WP_032447863.1|2695170_2695494_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	84.1	2.6e-45
WP_023339246.1|2695493_2696099_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.0	2.5e-89
WP_114212835.1|2696098_2698576_+	hypothetical protein	NA	Q858G3	Salmonella_phage	85.0	0.0e+00
WP_114212836.1|2698575_2699040_+	hypothetical protein	NA	Q858G2	Salmonella_phage	80.5	4.5e-70
WP_004152437.1|2699039_2699579_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_114212837.1|2699589_2702106_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	80.6	0.0e+00
WP_114212838.1|2702102_2703905_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	74.7	1.8e-239
WP_114212839.1|2703909_2706384_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	95.3	0.0e+00
WP_032418553.1|2706925_2707114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409248.1|2707265_2707961_-	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	51.3	1.1e-61
WP_162784319.1|2708044_2708233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130948882.1|2708440_2709292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457410.1|2709505_2709799_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.0e-25
WP_004225014.1|2710444_2711413_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_004149289.1|2713193_2714726_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|2714729_2716790_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004145656.1|2716970_2717612_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_002913836.1|2717608_2718646_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004213188.1|2718909_2719803_+	ROK family protein	NA	NA	NA	NA	NA
WP_004174870.1|2719812_2721246_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|2721463_2722090_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|2722185_2723472_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|2723570_2724272_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_004899797.1|2724268_2725180_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.3	5.9e-74
WP_002913810.1|2725307_2725667_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|2725676_2727140_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
2729888:2729905	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 3
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	3042701	3049608	5268719	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|3042701_3043565_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|3043575_3044349_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|3044591_3045488_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899464.1|3045730_3047092_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|3047410_3048133_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|3048129_3049608_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	3317662	3365450	5268719	plate,transposase,protease	Bacillus_phage(22.22%)	41	NA	NA
WP_004899066.1|3317662_3318406_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_094793990.1|3318727_3320091_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.1	4.0e-74
WP_004899055.1|3320325_3321312_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004899052.1|3321304_3322105_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004899049.1|3322142_3322265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004148810.1|3322562_3322706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|3322882_3323824_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|3323917_3324907_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|3324932_3326264_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|3326291_3327500_+	propionate kinase	NA	NA	NA	NA	NA
WP_004899045.1|3327528_3329823_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	6.7e-159
WP_004225356.1|3329873_3330020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162784321.1|3330309_3331368_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|3331477_3332392_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004148804.1|3332401_3333688_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|3333684_3334560_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|3334556_3335276_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|3335281_3336175_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|3336458_3338102_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|3338151_3338628_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|3338726_3339653_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|3339956_3341252_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_004899032.1|3341263_3342073_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|3342047_3342947_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|3343056_3343539_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004189349.1|3343636_3344428_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_023283910.1|3344453_3344993_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|3345107_3345437_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032448048.1|3345606_3345768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004899025.1|3346005_3347346_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004899022.1|3347342_3347996_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004899020.1|3347999_3349697_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004899018.1|3350158_3352786_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	1.0e-17
WP_114212850.1|3352788_3354816_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	30.8	2.1e-71
WP_153517862.1|3354830_3355727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004899008.1|3356652_3356910_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004899005.1|3356914_3358126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004898999.1|3361677_3363441_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014599196.1|3363470_3364487_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004898993.1|3364467_3365004_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|3365006_3365450_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	4008261	4017676	5268719		Escherichia_phage(87.5%)	9	NA	NA
WP_162784315.1|4008261_4009896_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.7	9.0e-182
WP_004176258.1|4009950_4011216_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|4011246_4012335_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|4012421_4012682_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|4012979_4013840_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|4013860_4014622_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|4014883_4015786_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|4015797_4017063_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|4017055_4017676_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	4052882	4133811	5268719	integrase,terminase,portal,capsid,tail,head,protease	Salmonella_phage(19.05%)	86	4089419:4089434	4123795:4123810
WP_002903687.1|4052882_4053695_+|protease	serine protease	protease	NA	NA	NA	NA
WP_004224649.1|4053708_4053825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|4053868_4054198_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_004179723.1|4054184_4054547_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|4054989_4056024_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021313857.1|4056248_4057904_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004143107.1|4057903_4058746_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_004143106.1|4058763_4059063_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|4059055_4059889_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004224637.1|4059888_4060689_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_114212865.1|4060825_4061785_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	89.5	7.9e-53
WP_004152239.1|4061788_4062406_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004224636.1|4062405_4063308_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_002903632.1|4063297_4064224_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190310.1|4064381_4066037_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004224630.1|4066301_4067222_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|4067385_4067742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183910.1|4067897_4069514_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004224629.1|4069510_4070230_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004224626.1|4070210_4071161_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004152245.1|4071228_4074006_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
WP_002903581.1|4074722_4076159_+	anion permease	NA	NA	NA	NA	NA
WP_004224621.1|4076213_4077866_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_004224616.1|4078029_4079646_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|4081160_4081550_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004151556.1|4081542_4082307_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004224612.1|4082296_4083649_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004179693.1|4083658_4084861_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004151559.1|4084871_4085528_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|4085538_4086225_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|4086394_4087201_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|4087197_4087761_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_002903460.1|4087862_4088771_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114212866.1|4088937_4090248_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
4089419:4089434	attL	CGCATGTGCTCAAACA	NA	NA	NA	NA
WP_004176321.1|4090247_4091693_+	amidohydrolase	NA	NA	NA	NA	NA
WP_022615523.1|4091813_4092932_+	transporter	NA	NA	NA	NA	NA
WP_004214887.1|4093060_4094161_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_004214894.1|4095361_4095661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|4095828_4096473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615521.1|4096528_4097263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615520.1|4097275_4099429_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	6.2e-90
WP_032458762.1|4099501_4102579_-	kinase	NA	A0A286S259	Klebsiella_phage	61.6	0.0e+00
WP_023302607.1|4102575_4102956_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	79.4	7.9e-57
WP_023302606.1|4102968_4103445_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
WP_023302605.1|4103431_4103905_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
WP_023302604.1|4103926_4107505_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	59.1	1.2e-242
WP_023302603.1|4107567_4108089_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
WP_023302602.1|4108163_4108469_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_032424504.1|4108471_4108876_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	54.6	3.6e-31
WP_023302600.1|4108906_4109611_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_023302599.1|4109667_4110015_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|4110011_4110461_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_023302597.1|4110448_4110796_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.5e-41
WP_021313626.1|4110804_4111125_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_023302596.1|4111121_4111325_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
WP_021313628.1|4111363_4112572_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_032424503.1|4112586_4113240_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	1.0e-104
WP_023302594.1|4113226_4114456_-|portal	phage portal protein	portal	U5P411	Shigella_phage	81.2	5.0e-201
WP_023302593.1|4114650_4116381_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
WP_004884285.1|4116377_4116872_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_023302592.1|4117002_4117353_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	7.1e-52
WP_032424502.1|4117367_4117673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302590.1|4117984_4118335_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	2.1e-11
WP_023302589.1|4118331_4118871_-	lysozyme	NA	K7PM52	Enterobacteria_phage	79.0	1.0e-81
WP_023302588.1|4118873_4119122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302587.1|4119372_4120458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302586.1|4120457_4121450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302585.1|4121489_4121837_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	4.0e-55
WP_032424501.1|4121855_4122836_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.9e-134
WP_004184734.1|4122848_4123226_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_023302583.1|4123235_4124045_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	1.6e-110
4123795:4123810	attR	CGCATGTGCTCAAACA	NA	NA	NA	NA
WP_023302582.1|4124041_4125010_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	4.6e-85
WP_071787065.1|4125047_4125179_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	76.7	2.4e-13
WP_023302581.1|4125416_4125869_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	2.6e-67
WP_004197463.1|4125897_4126161_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
WP_004184740.1|4126262_4126739_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_004184742.1|4126910_4128065_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_004184745.1|4128448_4129372_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	4.5e-106
WP_004213349.1|4129459_4129759_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_004213351.1|4129758_4130544_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213355.1|4130671_4131016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530208.1|4131008_4131671_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_004213359.1|4131667_4131853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|4131972_4132233_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|4132844_4133003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004224598.1|4133295_4133811_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 7
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	4712082	4811932	5268719	plate,integrase,terminase,tRNA,portal,capsid,tail,head,protease,lysis,transposase	Salmonella_phage(52.54%)	104	4767792:4767812	4801031:4801051
WP_002898139.1|4712082_4713375_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_004224013.1|4713465_4714809_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
WP_004224009.1|4714817_4715429_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_114212873.1|4715551_4719877_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.3e-88
WP_000228469.1|4720012_4720507_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|4720790_4720922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|4721039_4722008_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_004224005.1|4722122_4723889_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	1.9e-20
WP_004224003.1|4723889_4725611_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|4725637_4726357_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4726710_4726929_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|4727048_4729328_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|4729358_4729676_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|4730001_4730223_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004191149.1|4730299_4732240_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_002896440.1|4732236_4733352_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004176693.1|4733498_4735157_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|4735576_4736272_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|4736387_4737287_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004176696.1|4737430_4739083_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147771.1|4739093_4740062_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_014599114.1|4740273_4740708_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004176700.1|4740859_4742578_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_004176702.1|4742616_4743618_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_004223986.1|4743628_4745071_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|4745158_4746172_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004209681.1|4746168_4746999_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_025368307.1|4747030_4748170_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004223978.1|4749047_4749563_+	lipoprotein	NA	NA	NA	NA	NA
WP_004223976.1|4749789_4750518_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	7.9e-29
WP_002896390.1|4750538_4751270_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|4751276_4751993_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004191163.1|4751992_4752661_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|4752844_4753576_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|4753662_4755135_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|4755131_4755848_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_004223969.1|4755926_4757054_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	2.3e-19
WP_002896376.1|4757095_4757584_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|4757641_4758487_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|4758483_4759437_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|4759447_4760614_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_004223967.1|4760744_4761857_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|4762205_4762685_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|4762773_4763676_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_004179133.1|4763790_4764513_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_002896354.1|4764496_4764784_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|4764986_4765250_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|4765256_4765640_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|4765906_4767592_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_032410194.1|4767569_4767707_-	hypothetical protein	NA	NA	NA	NA	NA
4767792:4767812	attL	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
WP_004223962.1|4767813_4768032_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	66.2	8.3e-19
WP_004223960.1|4768118_4769216_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	82.2	4.5e-169
WP_004223957.1|4769212_4769698_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	5.0e-64
WP_162784317.1|4769694_4772091_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.7	3.8e-104
WP_002896220.1|4772317_4772437_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004223950.1|4772451_4772751_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	77.0	1.4e-32
WP_004150986.1|4772803_4773319_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004223947.1|4773328_4774501_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	5.4e-205
WP_114212874.1|4774639_4775800_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.5	6.2e-44
WP_004223943.1|4775877_4776153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223940.1|4776166_4778392_-	hypothetical protein	NA	K4I5E8	Salmonella_phage	41.3	3.0e-10
WP_004223933.1|4778397_4778994_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.0	1.8e-55
WP_004223930.1|4778986_4779895_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	3.4e-106
WP_004174325.1|4779881_4780244_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
WP_004223927.1|4780240_4780813_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
WP_014599113.1|4780916_4781579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223923.1|4781591_4782044_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.4	6.5e-50
WP_004223921.1|4782036_4782468_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_162784326.1|4782430_4782589_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	3.1e-15
WP_004223918.1|4782563_4782992_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	5.6e-51
WP_004223915.1|4782996_4783506_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	9.5e-82
WP_004223911.1|4783486_4783702_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	85.9	1.5e-28
WP_002896155.1|4783705_4783909_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004223908.1|4783908_4784373_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	84.4	6.7e-74
WP_032458717.1|4784469_4785120_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.1	3.6e-102
WP_004223906.1|4785123_4786176_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	89.1	2.1e-171
WP_004223903.1|4786192_4787026_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	74.4	2.2e-99
WP_032458716.1|4787165_4788929_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	92.5	0.0e+00
WP_004223897.1|4788928_4789957_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.3	6.2e-173
WP_032448014.1|4790003_4791668_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
WP_004223883.1|4794665_4794893_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	80.0	7.8e-28
WP_004223882.1|4794892_4795129_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	55.4	8.2e-12
WP_004223879.1|4795196_4795538_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	80.5	1.3e-45
WP_004223870.1|4795501_4795702_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	80.3	1.2e-24
WP_004223868.1|4795709_4796219_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	82.1	1.4e-72
WP_004223867.1|4796251_4796473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223865.1|4796598_4797159_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	44.8	2.0e-40
WP_004223864.1|4797170_4797755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223862.1|4797765_4798839_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	40.0	1.1e-68
WP_004223857.1|4798816_4799188_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	6.2e-30
WP_162784327.1|4799339_4800293_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.6	2.0e-93
WP_004223853.1|4800733_4801030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123806901.1|4801253_4801511_-	hypothetical protein	NA	NA	NA	NA	NA
4801031:4801051	attR	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
WP_004223851.1|4801925_4802213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223848.1|4802457_4802727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223846.1|4802896_4803460_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004212672.1|4803542_4804745_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179130.1|4804744_4805557_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_004151718.1|4805594_4806827_-	multidrug efflux MFS transporter KdeA	NA	NA	NA	NA	NA
WP_004141974.1|4807154_4807748_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004151717.1|4807849_4808608_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
WP_004191175.1|4808646_4809849_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	8.5e-97
WP_032447437.1|4810501_4810630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225014.1|4810963_4811932_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
>prophage 8
NZ_CP030923	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 chromosome, complete genome	5268719	5250683	5268619	5268719		Cronobacter_phage(35.29%)	22	NA	NA
WP_029884077.1|5250683_5252867_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	1.3e-82
WP_029884076.1|5252953_5255425_-	hypothetical protein	NA	F1C5A7	Cronobacter_phage	45.2	1.1e-202
WP_016531193.1|5255411_5255807_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	52.8	2.3e-35
WP_004223344.1|5255803_5256274_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.0	9.9e-25
WP_023283377.1|5256273_5256750_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071609155.1|5256863_5257130_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_016531188.1|5257106_5257286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029884074.1|5257330_5257573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114212886.1|5257572_5261013_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	49.3	7.7e-167
WP_004151254.1|5261105_5261609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|5261736_5262522_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|5262587_5263301_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|5263290_5263461_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|5263560_5263920_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|5263936_5264407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|5264700_5264955_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|5264957_5265713_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|5265888_5266566_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|5266618_5267371_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004178853.1|5267439_5267832_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
WP_004151265.1|5267828_5268254_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_029884067.1|5268256_5268619_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
>prophage 1
NZ_CP030924	Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence	196000	17408	72317	196000	integrase,transposase	Salmonella_phage(17.65%)	44	48234:48254	73886:73906
WP_004225014.1|17408_18377_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_004026352.1|19034_19295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902422.1|19890_20097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026354.1|20551_21022_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004026357.1|21018_21462_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004213643.1|22163_22385_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	63.5	3.6e-17
WP_004213642.1|22529_22685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213640.1|22759_24886_-	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_004213635.1|25922_26444_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011154590.1|26668_26875_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.2	2.7e-11
WP_004213628.1|27331_28564_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_004213626.1|28548_29193_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
WP_074160420.1|29299_29527_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004213623.1|29542_30658_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_011154591.1|30719_34445_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.7	2.5e-46
WP_004902400.1|34549_35779_+	esterase family protein	NA	NA	NA	NA	NA
WP_004902397.1|36238_38413_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
WP_004213615.1|38474_38696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213613.1|38838_39741_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004213611.1|39813_40365_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004213609.1|40745_41378_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023302796.1|41920_42574_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004902370.1|45189_45756_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_029884223.1|45758_46550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902363.1|46612_47026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902361.1|47110_47599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026379.1|47650_48061_-	hypothetical protein	NA	NA	NA	NA	NA
48234:48254	attL	CGTCGGCTTTGTTGAATAAAT	NA	NA	NA	NA
WP_004225014.1|48292_49261_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_004214667.1|50903_51686_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004211835.1|54436_54973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004211839.1|57292_58303_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211841.1|59032_60199_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004117790.1|60198_61170_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004902307.1|62418_62601_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004215130.1|62797_63238_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004189161.1|63234_63585_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|63615_65208_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004213807.1|65476_66445_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004213821.1|67708_68152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|68161_68569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011154511.1|68611_69571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|70322_70646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213829.1|70797_71115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213833.1|71180_72317_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
73886:73906	attR	ATTTATTCAACAAAGCCGACG	NA	NA	NA	NA
