The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030279	Propionibacterium freudenreichii strain CB129slpB chromosome, complete genome	2684198	140946	188730	2684198	integrase,transposase	Mycobacterium_phage(33.33%)	44	140943:141002	189817:189882
140943:141002	attL	CGGCTCATCGCGAATGAGAGTGTAGGAGCGGTCTGAATCCGCCGGCTTCGAGGAGCGATC	NA	NA	NA	NA
WP_044635852.1|140946_142257_-|transposase	ISL3-like element ISPfr18 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	69.8	4.5e-176
WP_013160219.1|142501_142918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055346715.1|142971_143487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114178974.1|143775_145071_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.9	1.1e-161
WP_147628947.1|145226_145415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155269314.1|145838_146273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155269313.1|146402_146864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036940981.1|147519_149052_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_036940978.1|149213_150404_+	acetate kinase	NA	NA	NA	NA	NA
WP_051733982.1|150507_151314_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036940975.1|151313_152108_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_044635847.1|153226_153736_+	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_036940972.1|153740_154157_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_036940969.1|154380_155343_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_114178746.1|155339_156182_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_162786059.1|156535_157360_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044635845.1|160137_160908_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.6e-11
WP_044635844.1|160907_161792_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036940964.1|163809_164997_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	45.5	7.9e-95
WP_114178750.1|165436_165595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162786060.1|165617_166073_+	glucosaminidase	NA	S5M633	Brevibacillus_phage	38.7	2.7e-19
WP_036940960.1|166089_167088_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.5	1.8e-71
WP_114178976.1|167092_168487_+	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036940954.1|168731_169613_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_114178754.1|169674_170073_-	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_112317700.1|170069_170795_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013159973.1|170906_171776_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	57.6	7.8e-92
WP_114178756.1|171786_172542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114178758.1|172664_173972_+|transposase	ISL3-like element ISPfr6 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	72.8	8.7e-188
WP_027587600.1|175016_175598_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.8	4.2e-17
WP_013162108.1|175594_176374_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013162109.1|176370_176703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036940636.1|177072_177546_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_051232795.1|177785_178250_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_080516165.1|178406_180374_-	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	31.2	6.3e-73
WP_013162114.1|180606_181914_-|transposase	ISL3-like element ISPfr6 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.0	1.8e-188
WP_013162099.1|182116_182590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162098.1|182599_183028_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044657895.1|183097_185230_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_036939336.1|185707_185971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162095.1|185974_186277_-	DUF4193 domain-containing protein	NA	NA	NA	NA	NA
WP_013162094.1|186860_187802_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.2	1.1e-17
WP_138427997.1|187798_188146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162093.1|188205_188730_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
189817:189882	attR	GATCGCTCCTCGAAGCCGGCGGATTCAGACCGCTCCTACACTCTCATTCGCGATGAGCCGCCAAAG	NA	NA	NA	NA
>prophage 2
NZ_CP030279	Propionibacterium freudenreichii strain CB129slpB chromosome, complete genome	2684198	2304821	2372004	2684198	integrase,transposase,protease	Bacillus_phage(33.33%)	53	2312921:2312956	2377232:2377267
WP_036942782.1|2304821_2306129_+|transposase	ISL3-like element ISPfr4 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.2	7.4e-195
WP_060762126.1|2306275_2307694_+|transposase	IS30-like element ISPfr9 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	2.1e-33
WP_036941092.1|2307843_2309199_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.8	5.5e-92
WP_080713575.1|2311224_2312592_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
2312921:2312956	attL	CCAGAGGGGCTCCCCACATGTGGGGAGCCCCTCTGG	NA	NA	NA	NA
WP_048733818.1|2313144_2314587_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_129931506.1|2314590_2315331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036942026.1|2315489_2318885_+	PPi-type phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_036942037.1|2319766_2320288_+	EXLDI protein	NA	NA	NA	NA	NA
WP_036942040.1|2320407_2321262_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013160148.1|2321304_2321949_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.9	5.1e-40
WP_036940051.1|2322040_2322775_-	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_036940054.1|2322953_2323241_+	cell division protein CrgA	NA	NA	NA	NA	NA
WP_162786093.1|2323645_2323951_+	DUF4862 family protein	NA	NA	NA	NA	NA
WP_114178938.1|2323947_2324589_+	DUF4862 family protein	NA	NA	NA	NA	NA
WP_036940059.1|2324815_2326162_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_013160143.1|2326172_2327147_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_036940063.1|2327143_2328256_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_080713501.1|2328400_2329123_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051733938.1|2331058_2332702_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.7	1.5e-19
WP_080713503.1|2333042_2333975_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036940097.1|2333974_2334337_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013160136.1|2334497_2336000_-	amino acid permease	NA	NA	NA	NA	NA
WP_013160135.1|2336252_2337143_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_013160134.1|2337220_2337913_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013160133.1|2337912_2339646_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	8.7e-34
WP_013160132.1|2339642_2341706_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	9.3e-59
WP_013160131.1|2341997_2342897_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112317753.1|2342914_2343634_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_112317816.1|2343651_2344101_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013160128.1|2344512_2345085_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013160127.1|2345081_2345747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160126.1|2345820_2346264_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_147628971.1|2346267_2346732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147628972.1|2346772_2347159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160123.1|2350813_2351413_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036940077.1|2351426_2352737_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.9	1.4e-12
WP_060762137.1|2353142_2353712_+	helix-turn-helix transcriptional regulator	NA	A0A2H4PE70	Mycobacterium_phage	39.7	7.5e-11
WP_013160119.1|2353742_2355032_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.1	5.3e-36
WP_013160118.1|2355262_2356219_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013160117.1|2356215_2356836_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013160116.1|2357117_2357318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162786094.1|2357372_2357537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160114.1|2357608_2357818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160112.1|2357852_2358152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114179013.1|2358387_2360127_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_112317817.1|2360392_2361448_-	dihydroorotate dehydrogenase-like protein	NA	NA	NA	NA	NA
WP_036940115.1|2361542_2365136_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_013160108.1|2365315_2366947_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_013160106.1|2367270_2367588_-	thiamine-binding protein	NA	NA	NA	NA	NA
WP_013160105.1|2367791_2368286_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155269295.1|2368264_2368414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097776134.1|2368752_2369962_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	31.0	2.7e-26
WP_114178940.1|2370162_2372004_+|transposase	IS30 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.1	5.1e-101
2377232:2377267	attR	CCAGAGGGGCTCCCCACATGTGGGGAGCCCCTCTGG	NA	NA	NA	NA
>prophage 3
NZ_CP030279	Propionibacterium freudenreichii strain CB129slpB chromosome, complete genome	2684198	2480896	2556553	2684198	tRNA,holin,transposase	Mycobacterium_phage(18.75%)	60	NA	NA
WP_013160063.1|2480896_2482171_-|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	35.8	2.8e-66
WP_013160062.1|2482318_2483923_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_036942954.1|2483802_2484789_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_013160060.1|2485346_2486027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162630576.1|2486319_2487273_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_114178950.1|2487265_2488165_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	53.3	4.8e-52
WP_162786098.1|2487864_2489016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036942956.1|2489253_2490243_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_036942958.1|2490444_2491644_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036942960.1|2491640_2493461_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.1e-14
WP_013160054.1|2493515_2495084_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.3	8.5e-105
WP_080713600.1|2495146_2495659_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_036942973.1|2495640_2496246_+	type-1 restriction enzyme EcoR124II specificity protein	NA	NA	NA	NA	NA
WP_036942976.1|2496242_2499281_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_081014329.1|2499828_2500923_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_013160051.1|2501037_2501991_-	hypothetical protein	NA	A0A0K1L687	Scale_drop_disease_virus	43.9	7.9e-21
WP_013160035.1|2503996_2504803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160036.1|2504980_2506516_-	gluconokinase	NA	NA	NA	NA	NA
WP_013160037.1|2506774_2507638_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_013160038.1|2507630_2508356_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_162786099.1|2508831_2509527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114178957.1|2509523_2510744_-	serine/threonine protein kinase	NA	A0A1M7XTW9	Cedratvirus	26.9	5.0e-12
WP_013160040.1|2511058_2511667_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1J0GVU2	Streptomyces_phage	44.1	1.2e-27
WP_044635867.1|2511885_2513190_-	citrate synthase	NA	NA	NA	NA	NA
WP_013160042.1|2513692_2514496_+	EcsC family protein	NA	NA	NA	NA	NA
WP_055346839.1|2514606_2515440_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_157761831.1|2515654_2517259_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013160045.1|2517280_2518429_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.8	1.6e-31
WP_080713591.1|2518601_2519561_-	phosphopantothenoylcysteine decarboxylase	NA	Q9HH70	Methanothermobacter_phage	39.4	1.1e-25
WP_013160047.1|2520198_2520543_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157763648.1|2520545_2521289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160195.1|2521316_2522624_+|transposase	ISL3-like element ISPfr1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	68.1	1.8e-169
WP_063493589.1|2522660_2522969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162786100.1|2522991_2523246_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080713571.1|2523236_2524181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112317757.1|2524892_2525252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097776134.1|2526278_2527489_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	31.0	2.7e-26
WP_013160028.1|2527576_2527774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036940431.1|2528503_2530918_+	nitric oxide reductase	NA	NA	NA	NA	NA
WP_036940428.1|2531926_2532691_+	slipin family protein	NA	A0A2K9L035	Tupanvirus	32.6	5.0e-26
WP_044636453.1|2532804_2533227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114179018.1|2533494_2534604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160019.1|2534787_2535351_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013160018.1|2535413_2536508_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_036943364.1|2536554_2536809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160015.1|2537420_2538209_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013160014.1|2538492_2539092_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
WP_036940611.1|2539095_2540100_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_036940614.1|2540238_2540619_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_013160011.1|2540615_2541080_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_013160010.1|2541135_2542050_+	peptidase E	NA	NA	NA	NA	NA
WP_013160009.1|2542056_2542752_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080713524.1|2542748_2544176_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	1.4e-21
WP_112317820.1|2544204_2545392_-	MFS transporter	NA	NA	NA	NA	NA
WP_013160006.1|2545463_2546462_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
WP_013160005.1|2547258_2548035_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	6.7e-18
WP_013160004.1|2548108_2549161_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_080516022.1|2551198_2552386_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_013160195.1|2552420_2553728_-|transposase	ISL3-like element ISPfr1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	68.1	1.8e-169
WP_114178960.1|2555221_2556553_+|transposase	ISL3-like element ISPfr3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.0	9.8e-195
