The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1083827	1090967	5023979		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1083827_1084466_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590384.1|1084462_1085725_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|1085721_1086630_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1086795_1087593_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141340.1|1087643_1088300_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1088405_1090967_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1163988	1171456	5023979	integrase,transposase	Escherichia_phage(66.67%)	6	1154853:1154866	1171766:1171779
1154853:1154866	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000878196.1|1163988_1164855_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_053888044.1|1165006_1166725_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	2.1e-306
WP_000214990.1|1166726_1168475_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|1168546_1168963_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1169001_1170231_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1170973_1171456_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1171766:1171779	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 3
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1291395	1347041	5023979	tail,integrase,holin,terminase,protease	Escherichia_phage(49.06%)	62	1294494:1294510	1332164:1332180
WP_001299507.1|1291395_1292862_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|1292930_1294508_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1294494:1294510	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_114107223.1|1294700_1295957_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	1.5e-237
WP_001077940.1|1295953_1296148_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
WP_087888281.1|1296144_1296795_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.6	9.5e-127
WP_097499713.1|1296787_1297039_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	1.5e-40
WP_000675390.1|1297196_1297445_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063834.1|1297494_1298436_-	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
WP_114107224.1|1298432_1299254_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	99.3	6.8e-162
WP_114107225.1|1299250_1299550_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	1.7e-46
WP_000836293.1|1299858_1300443_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001282457.1|1300597_1300828_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
WP_000402893.1|1300978_1301179_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_114107226.1|1301194_1302010_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	5.9e-118
WP_001406039.1|1302006_1302792_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_021558026.1|1302909_1303257_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
WP_114107227.1|1303318_1303897_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	65.1	5.1e-39
WP_114107228.1|1304009_1304552_+	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	89.4	1.3e-76
WP_033883752.1|1304551_1304902_+	DUF2591 family protein	NA	G9L6B5	Escherichia_phage	72.4	5.6e-41
WP_001129690.1|1304894_1305233_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	1.3e-58
WP_114107229.1|1305273_1305948_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	1.5e-119
WP_114107230.1|1305944_1307420_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	6.4e-296
WP_001280573.1|1307510_1307882_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	99.2	1.1e-63
WP_000335899.1|1308589_1308796_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_114107231.1|1308810_1310490_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.4e-302
WP_000133160.1|1310486_1310783_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_059333270.1|1310785_1311481_+	peptidase	NA	G9L6C4	Escherichia_phage	99.6	1.3e-94
WP_000268715.1|1311495_1312482_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_000627074.1|1312533_1312971_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
WP_000012377.1|1312981_1313317_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000424495.1|1313367_1313691_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_114107232.1|1313690_1314296_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.0	8.9e-111
WP_114107233.1|1314295_1316767_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	98.9	0.0e+00
WP_000568023.1|1316766_1317231_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_000332878.1|1317230_1317776_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_114107234.1|1317775_1320289_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
WP_114107235.1|1320285_1322088_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.3	0.0e+00
WP_114107236.1|1322093_1324568_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
WP_114107237.1|1324763_1325060_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	1.6e-49
WP_114107238.1|1325091_1325253_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	98.1	7.2e-20
WP_000947646.1|1325346_1325886_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_114107239.1|1326095_1326746_-	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	66.2	1.7e-43
WP_001188252.1|1327063_1327321_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_114107240.1|1327516_1330156_+	SGNH/GDSL hydrolase family protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	78.6	1.3e-97
WP_114107241.1|1330255_1330660_+	hypothetical protein	NA	T1SA79	Salmonella_phage	91.8	5.6e-61
WP_042970607.1|1330646_1330955_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	2.7e-47
WP_113264236.1|1330944_1331574_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.1	9.3e-111
WP_089674140.1|1331570_1332053_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	89.4	4.6e-70
WP_000755179.1|1332270_1332810_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
1332164:1332180	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_001295476.1|1332825_1333344_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|1333654_1333846_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|1333863_1334016_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000772775.1|1334197_1336441_+	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_001121363.1|1336479_1338021_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000529576.1|1338025_1340092_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001028614.1|1340262_1340901_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|1340900_1341938_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|1342262_1342889_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1342974_1344264_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_000247065.1|1344313_1345060_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000166449.1|1345197_1345557_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000489667.1|1345577_1347041_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1709364	1718806	5023979		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1709364_1710291_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1710295_1711027_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1711007_1711115_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1711174_1711906_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1712127_1713813_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1713809_1714529_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1714575_1715046_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1715086_1715548_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1715672_1717673_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_114107242.1|1717669_1718806_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 5
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1758786	1825867	5023979	tail,head,integrase,portal,holin,terminase,tRNA,protease	Enterobacteria_phage(36.23%)	83	1762019:1762034	1783565:1783580
WP_000476011.1|1758786_1760148_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|1760250_1760547_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1760548_1760845_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000137873.1|1761576_1762299_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
1762019:1762034	attL	ATCTCTTCGATTTTTG	NA	NA	NA	NA
WP_000675149.1|1762295_1763699_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	1.6e-33
WP_000130867.1|1763695_1765111_-	MFS transporter	NA	NA	NA	NA	NA
WP_000667541.1|1765111_1768189_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197868.1|1768189_1771312_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000678962.1|1771311_1772559_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_024234252.1|1772902_1773976_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	94.7	1.2e-190
WP_039264506.1|1773953_1774172_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_001504522.1|1774256_1774880_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	93.3	1.3e-104
WP_001504521.1|1775202_1775763_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	5.2e-97
WP_001504519.1|1775995_1776280_-	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	89.4	2.8e-43
WP_024238365.1|1776279_1776501_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_001308571.1|1776599_1776881_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_032240676.1|1776891_1777083_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_032240674.1|1777055_1777238_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	93.3	5.3e-27
WP_000186789.1|1777234_1777915_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
WP_000100844.1|1777911_1778697_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995439.1|1778702_1778999_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000358700.1|1779073_1779217_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_001198858.1|1779209_1779350_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_052908307.1|1779422_1779791_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.3e-64
WP_000213975.1|1779973_1780174_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_157912242.1|1780298_1780436_-	hypothetical protein	NA	Q716D9	Shigella_phage	97.8	2.5e-21
WP_001504518.1|1780444_1780786_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	64.6	5.7e-30
WP_000528775.1|1781229_1782006_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_024167659.1|1781993_1782536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250469.1|1782633_1783341_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
WP_001180318.1|1783419_1783647_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
1783565:1783580	attR	CAAAAATCGAAGAGAT	NA	NA	NA	NA
WP_001504516.1|1783753_1784050_+	bacteriophage CII family protein	NA	A0A0N7KZD0	Stx2-converting_phage	96.9	8.3e-46
WP_052905266.1|1784082_1784982_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.0	5.7e-170
WP_032313406.1|1784978_1785680_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	2.2e-129
WP_000145894.1|1785676_1785967_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000229809.1|1786039_1786246_+	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_000810176.1|1786253_1786700_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|1786696_1787224_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254221.1|1787220_1787403_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_001505174.1|1787906_1789679_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001108084.1|1790241_1790808_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223933.1|1790782_1791385_+	hypothetical protein	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001505172.1|1791381_1792047_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	1.3e-131
WP_001235460.1|1792043_1792667_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|1792919_1793663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1793748_1793907_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_033816266.1|1793987_1794386_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284515.1|1794528_1794744_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001504032.1|1794743_1795241_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	99.4	2.6e-92
WP_122996710.1|1795457_1795664_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	92.6	1.9e-28
WP_001504034.1|1795904_1796429_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	1.0e-86
WP_001307652.1|1796723_1796918_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1797307_1797853_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_114107243.1|1797827_1799753_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1799749_1799956_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_053897481.1|1799952_1801554_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
WP_000123236.1|1801534_1802854_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|1802863_1803196_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_072162251.1|1804316_1804712_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_053881501.1|1804723_1805077_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
WP_000975054.1|1805089_1805668_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683128.1|1805664_1806060_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_053888056.1|1806067_1806808_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
WP_000479153.1|1806823_1807246_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1807227_1807662_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_053888054.1|1807654_1810216_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.3	0.0e+00
WP_053888053.1|1810212_1810542_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152639.1|1810541_1811240_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_053890196.1|1811245_1811989_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|1811925_1812558_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_053888051.1|1812617_1816115_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
WP_053891083.1|1816185_1816785_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	6.3e-109
WP_000268905.1|1816849_1818163_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|1818164_1818434_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|1818539_1819421_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652080.1|1819644_1820493_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
WP_021351651.1|1820596_1820968_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001448642.1|1821411_1821987_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001002868.1|1822187_1822568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|1822651_1822873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|1822885_1823539_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767389.1|1824042_1824519_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001389241.1|1824577_1825867_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 6
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1875013	1941726	5023979	tail,capsid,plate,head,integrase,portal,terminase,lysis,transposase	Salmonella_phage(73.91%)	74	1866939:1866954	1944803:1944818
1866939:1866954	attL	CAGCGCCACCGCCAGT	NA	NA	NA	NA
WP_000399648.1|1875013_1875994_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_053887959.1|1876249_1877515_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114237.1|1877666_1878482_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|1878627_1881060_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|1881065_1881965_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424890.1|1882095_1882758_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000137925.1|1882833_1883583_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397362.1|1883582_1884818_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|1885021_1885987_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001296993.1|1885973_1887845_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090164.1|1887864_1889403_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|1889420_1890341_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|1890343_1891255_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|1891432_1893781_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|1895164_1896490_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|1896702_1897086_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555022.1|1897196_1898312_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|1898308_1898935_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|1899181_1900384_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|1900430_1901189_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_001440570.1|1901246_1901843_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180096.1|1902127_1903360_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|1903400_1903685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|1903770_1904586_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|1904585_1905794_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|1905877_1906414_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_053902328.1|1906564_1906834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053902327.1|1906894_1907926_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	4.3e-105
WP_053902326.1|1908017_1908569_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_053902325.1|1908565_1909765_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_053902324.1|1909773_1910667_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	45.5	1.9e-40
WP_000187760.1|1910792_1911014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1911046_1911556_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_072184948.1|1911563_1911860_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_053902323.1|1911977_1912319_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	2.5e-54
WP_053902322.1|1912386_1912620_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	4.1e-32
WP_000752613.1|1912619_1912847_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_053902321.1|1912843_1913146_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	53.4	4.4e-10
WP_053902320.1|1913142_1914000_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
WP_053902319.1|1913996_1916411_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_001154431.1|1916563_1916752_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|1916762_1916996_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|1917188_1917524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324531.1|1918617_1919592_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_000520398.1|1919616_1920642_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.0e-171
WP_001098431.1|1920641_1922408_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_114107244.1|1922550_1923384_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	1.2e-121
WP_053902279.1|1923400_1924459_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_053902278.1|1924462_1925113_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_000673521.1|1925208_1925673_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000868169.1|1925672_1925876_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000171568.1|1925879_1926095_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069909.1|1926075_1926588_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727856.1|1926589_1926967_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001337513.1|1926963_1927392_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_001039945.1|1927487_1927919_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000829146.1|1927911_1928358_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993769.1|1928426_1929005_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	2.5e-94
WP_053902277.1|1929001_1929361_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.9	2.0e-54
WP_001583364.1|1929347_1930256_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001086836.1|1930248_1930854_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_053902276.1|1930850_1932410_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.9	1.5e-194
WP_000384228.1|1932409_1933012_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.5	5.4e-92
WP_053902275.1|1932983_1933424_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.0	8.0e-53
WP_123058834.1|1933450_1933840_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.8	4.7e-12
WP_000905027.1|1933870_1934437_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046140.1|1934579_1935752_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	2.7e-204
WP_001207656.1|1935761_1936277_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001281009.1|1936331_1936634_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1936648_1936768_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_053902282.1|1936760_1939838_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.7	0.0e+00
WP_053902283.1|1939834_1940320_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.4e-66
WP_053902284.1|1940316_1941417_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	2.0e-177
WP_000972391.1|1941507_1941726_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1944803:1944818	attR	ACTGGCGGTGGCGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	2241436	2298047	5023979	tail,capsid,plate,head,integrase,portal,holin,terminase,tRNA,protease	Shigella_phage(43.14%)	76	2263430:2263445	2291425:2291440
WP_064560027.1|2241436_2242666_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	2.9e-132
WP_000953272.1|2243031_2243220_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|2243277_2244306_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001440693.1|2244295_2244535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2244527_2244761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204981.1|2244753_2244987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2244992_2245292_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|2245288_2246689_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|2246889_2247141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052924698.1|2247137_2247548_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2247558_2247831_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2247957_2248182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|2248433_2248640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|2248639_2249695_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|2249707_2250043_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|2250055_2250469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2250674_2251217_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2251472_2251754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735406.1|2252355_2253816_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2253815_2254487_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2254654_2256025_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|2256028_2256670_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001378857.1|2256705_2257812_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|2257865_2258327_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2258336_2258990_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|2259161_2260412_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_024232539.1|2260870_2263993_+	hypothetical protein	NA	NA	NA	NA	NA
2263430:2263445	attL	ACCATGCCTAAAAATA	NA	NA	NA	NA
WP_024232540.1|2264419_2264890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024232541.1|2264990_2266118_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	61.2	6.1e-121
WP_001527050.1|2266098_2266344_-	phage excisionase	NA	NA	NA	NA	NA
WP_114107245.1|2266398_2266944_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.7	1.2e-93
WP_000159356.1|2267463_2267655_+	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_001020634.1|2268172_2268865_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_024232543.1|2268962_2269223_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	1.3e-39
WP_000515845.1|2269215_2269767_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_071791755.1|2269942_2270122_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.1e-15
WP_000104963.1|2270111_2271053_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_072179006.1|2271049_2271544_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	5.6e-87
WP_000210164.1|2271543_2271870_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001603275.1|2271866_2272256_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.2e-68
WP_024232546.1|2272275_2273073_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_032262265.1|2273080_2274070_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	9.9e-192
WP_032197074.1|2274083_2274836_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	4.5e-136
WP_000779379.1|2275050_2275320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001459463.1|2275529_2276324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283162.1|2276432_2276819_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	99.2	9.2e-61
WP_000422365.1|2276805_2277087_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	9.7e-20
WP_024232323.1|2277086_2277701_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	8.5e-93
WP_000522147.1|2277708_2277978_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	5.3e-23
WP_000184049.1|2278159_2278549_-	hypothetical protein	NA	A0A1L5C299	Pseudoalteromonas_phage	65.5	1.7e-38
WP_001135100.1|2278647_2278998_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	77.6	2.3e-50
WP_000929173.1|2279124_2279619_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_122988410.1|2279852_2281349_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.8e-298
WP_000605606.1|2281360_2281543_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|2281542_2282784_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_024232324.1|2282761_2283412_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	1.1e-117
WP_024232325.1|2283426_2284632_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.5	8.5e-222
WP_016243469.1|2284681_2284909_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.3	1.5e-23
WP_016243470.1|2284883_2285207_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	96.3	4.8e-55
WP_053887938.1|2285203_2285614_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	2.5e-72
WP_016243472.1|2285588_2286095_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.2	7.2e-90
WP_024232326.1|2286091_2286652_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.3	5.7e-104
WP_016243474.1|2286660_2286831_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	6.1e-25
WP_001759749.1|2286814_2288311_+|tail	phage tail sheath family protein	tail	U5P0H3	Shigella_phage	99.0	3.4e-276
WP_000090998.1|2288310_2288667_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661051.1|2288666_2288936_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_016243475.1|2289077_2290910_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.5	4.8e-301
WP_000679479.1|2291001_2291532_+	hypothetical protein	NA	NA	NA	NA	NA
2291425:2291440	attR	ACCATGCCTAAAAATA	NA	NA	NA	NA
WP_024232470.1|2291593_2292922_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.3	2.5e-243
WP_000999503.1|2292918_2293998_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_001259088.1|2293997_2294546_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000424728.1|2294545_2294971_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_000785301.1|2294957_2296016_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_024232471.1|2296006_2296591_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_001526915.1|2297242_2297680_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	7.2e-46
WP_000639074.1|2297651_2298047_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
>prophage 8
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	2712439	2766087	5023979	tail,integrase,portal,holin,terminase,lysis,protease	Enterobacteria_phage(50.0%)	65	2723837:2723852	2767270:2767285
WP_001429305.1|2712439_2713030_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	57.8	2.0e-22
WP_122988840.1|2713051_2713129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023999.1|2713239_2713509_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	1.7e-42
WP_114107246.1|2713510_2714824_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	96.3	9.4e-73
WP_114107247.1|2714883_2718297_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.8	0.0e+00
WP_097729395.1|2718357_2719005_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	4.3e-111
WP_114107248.1|2718902_2719646_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_114107249.1|2719651_2720350_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	6.6e-134
WP_000447253.1|2720359_2720689_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_097729350.1|2720688_2723754_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.4	0.0e+00
WP_052970427.1|2723725_2724055_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
2723837:2723852	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001298500.1|2724063_2724450_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211106.1|2724509_2725253_-|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_001079419.1|2725263_2725665_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677106.1|2725661_2726240_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|2726251_2726527_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_123057854.1|2726519_2726843_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	9.4e-51
WP_097729354.1|2726929_2728957_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_123058836.1|2728901_2730482_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	1.3e-289
WP_001072975.1|2730409_2730622_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_097729358.1|2730618_2732721_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|2732720_2733212_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_053897389.1|2733719_2734274_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	87.0	1.2e-85
WP_053897387.1|2734476_2734914_-|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	95.9	7.9e-69
WP_053897385.1|2734910_2735444_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	6.7e-102
WP_052931675.1|2735507_2735858_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	84.5	9.6e-33
WP_000839572.1|2735862_2736078_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_021526742.1|2736975_2737857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021526743.1|2737872_2738136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190350.1|2738125_2738524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190351.1|2738559_2738925_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	6.4e-56
WP_053897382.1|2738917_2739295_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	4.1e-37
WP_097729342.1|2739295_2740351_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	9.8e-89
WP_001345469.1|2740352_2740631_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
WP_000961821.1|2740798_2741011_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_023307888.1|2741292_2742051_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122996371.1|2742749_2742914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307887.1|2742910_2743657_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.9	1.9e-110
WP_023307886.1|2743679_2744426_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	1.3e-111
WP_023307885.1|2744432_2745398_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.3e-58
WP_023307884.1|2745419_2745845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097729338.1|2745828_2746152_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023307882.1|2746276_2746753_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	44.1	4.4e-12
WP_053897478.1|2747073_2747229_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_053897472.1|2747230_2747806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053897474.1|2748292_2748481_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_053897476.1|2748477_2748669_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_114107251.1|2748761_2751242_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	63.0	4.5e-60
WP_001296941.1|2751326_2751563_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_073978404.1|2751582_2752878_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.7e-155
WP_001360138.1|2752897_2753008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|2753065_2754085_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|2754096_2755311_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2755516_2755843_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|2755977_2756319_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2756353_2756914_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2756916_2757627_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2757734_2758040_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_077759395.1|2758238_2759696_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	5.1e-120
WP_162754397.1|2760192_2761182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898379.1|2761254_2761746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178825.1|2762177_2762918_-	KilA-N domain-containing protein	NA	M4R311	Vibrio_phage	30.2	1.8e-12
WP_000153249.1|2762919_2763309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113585.1|2763720_2764089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162754396.1|2764500_2766087_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2767270:2767285	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 9
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3161620	3211831	5023979	tail,capsid,head,integrase,portal,holin,terminase	Enterobacteria_phage(33.33%)	59	3210387:3210403	3225553:3225569
WP_095111390.1|3161620_3161752_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|3162098_3163079_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101711.1|3163255_3163525_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.6	3.5e-43
WP_114107254.1|3163526_3164840_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.6	5.9e-75
WP_001408020.1|3164904_3165528_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_000515030.1|3165596_3169073_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
WP_000649829.1|3169206_3169734_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122988838.1|3169924_3170557_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.2	1.2e-102
WP_000194790.1|3170502_3171246_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_001299882.1|3171251_3171950_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|3171949_3172279_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_053888046.1|3172275_3174855_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_000533425.1|3174835_3175249_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479086.1|3175275_3175707_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|3175720_3176473_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|3176480_3176876_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|3176872_3177448_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|3177462_3177816_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|3177808_3178183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|3178234_3179263_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|3179320_3179668_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254038.1|3179704_3181210_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_052909326.1|3181199_3182792_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.6	1.9e-184
WP_000259002.1|3182788_3182995_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_052905469.1|3182978_3184907_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.5e-260
WP_000235436.1|3184878_3185388_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|3185790_3186015_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|3186096_3186411_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3186938_3187124_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3187345_3187459_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3187679_3188213_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3188372_3188645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|3188900_3189107_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000023256.1|3189554_3191405_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001064889.1|3192945_3193635_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_001217464.1|3193631_3193991_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
WP_024232456.1|3194003_3195053_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	2.1e-107
WP_032312299.1|3195054_3195333_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000980999.1|3195399_3195651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887487.1|3195867_3196080_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	81.4	1.1e-23
WP_122993170.1|3196124_3196232_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	84.8	9.4e-08
WP_001124204.1|3196336_3196972_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000827088.1|3196958_3198332_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001227887.1|3199370_3200213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001340033.1|3200652_3200853_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	93.9	5.9e-11
WP_157861261.1|3200959_3201502_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	9.8e-85
WP_000020543.1|3201413_3202454_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.9e-89
WP_000705374.1|3202425_3202977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|3202960_3203188_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|3203265_3203673_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379593.1|3203864_3204020_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171943.1|3204179_3204398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340038.1|3204401_3204566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3204966_3205155_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_024232529.1|3205435_3207907_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.5e-58
WP_097729331.1|3207965_3208169_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533621.1|3208168_3209194_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001302302.1|3209429_3210227_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
3210387:3210403	attL	TCCAGTCAGAGGAGCCA	NA	NA	NA	NA
WP_024232530.1|3210568_3211831_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.1	1.6e-69
WP_024232530.1|3210568_3211831_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.1	1.6e-69
3225553:3225569	attR	TCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 10
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3324174	3371777	5023979	tail,capsid,head,integrase,portal,holin,terminase,lysis,protease	Enterobacteria_phage(50.0%)	72	3346019:3346034	3373485:3373500
WP_001504413.1|3324174_3325416_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	86.2	1.1e-219
WP_024167648.1|3325753_3326314_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	62.8	5.4e-62
WP_106409363.1|3326304_3326499_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|3326443_3326986_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023459.1|3327206_3327476_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268905.1|3327477_3328791_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_053891246.1|3328855_3329455_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	2.6e-110
WP_114107255.1|3329521_3332920_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.5	0.0e+00
WP_000090891.1|3332979_3333612_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_053890196.1|3333548_3334292_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3334297_3334996_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_053888053.1|3334995_3335325_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_053888054.1|3335321_3337883_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.3	0.0e+00
WP_000459457.1|3337875_3338310_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3338291_3338714_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_053888056.1|3338729_3339470_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
WP_000683128.1|3339477_3339873_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975054.1|3339869_3340448_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_053881501.1|3340460_3340814_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
WP_072162251.1|3340825_3341221_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_032209073.1|3341262_3342288_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	2.0e-187
WP_001299443.1|3342342_3342675_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|3342684_3344004_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_053897481.1|3343984_3345586_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
WP_000198149.1|3345582_3345789_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_114107243.1|3345785_3347711_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
3346019:3346034	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453587.1|3347685_3348231_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|3348620_3348815_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_024232585.1|3349002_3349620_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	5.5e-92
WP_000092318.1|3349769_3350207_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|3350203_3350701_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|3350700_3350907_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023271.1|3351354_3353205_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000499454.1|3353503_3353662_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3353747_3354491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3354675_3355365_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3355379_3355502_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3355840_3356800_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|3357011_3357200_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|3357196_3357559_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002251.1|3357555_3357846_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|3357838_3358051_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|3358043_3358220_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|3358219_3358579_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254220.1|3358581_3358758_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000153280.1|3358754_3359282_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736904.1|3359278_3359719_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_000145931.1|3359792_3360083_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788869.1|3360079_3360781_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000185522.1|3360777_3361677_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	2.1e-172
WP_001177650.1|3361711_3361990_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|3362098_3362284_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|3362364_3363015_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_001358311.1|3363327_3363600_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001066169.1|3363616_3364198_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065374.1|3364458_3364827_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3364899_3365064_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3365032_3365176_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995467.1|3365250_3365547_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_001358309.1|3365552_3366338_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000186848.1|3366334_3367015_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682305.1|3367011_3367194_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000548514.1|3367166_3367358_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001395510.1|3367368_3367650_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763369.1|3367748_3367970_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
WP_000111054.1|3367966_3368218_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
WP_000748282.1|3368516_3369131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129736.1|3369424_3369763_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_000762731.1|3369791_3370220_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000545741.1|3370303_3370471_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3370510_3370729_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3370706_3371777_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3373485:3373500	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 11
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3590540	3658633	5023979	tail,capsid,head,integrase,portal,terminase,lysis,tRNA,transposase,protease	Enterobacteria_phage(45.45%)	76	3602450:3602496	3648426:3648472
WP_000878218.1|3590540_3591407_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169541.1|3591403_3591703_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033803329.1|3591895_3592273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024232415.1|3592789_3593305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420810.1|3593969_3595106_+|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|3595374_3597612_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_024232317.1|3597598_3600571_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|3600571_3601462_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|3601644_3602406_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3602450:3602496	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201810.1|3602919_3603873_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3604122_3604872_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000239874.1|3605734_3606403_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|3606768_3606882_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3606950_3607184_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|3607500_3608091_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_053888049.1|3608188_3608764_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279133.1|3608763_3612162_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_053891083.1|3612226_3612826_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	6.3e-109
WP_053888051.1|3612896_3616394_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
WP_000090891.1|3616453_3617086_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_053890196.1|3617022_3617766_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3617771_3618470_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_053888053.1|3618469_3618799_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_162816085.1|3618795_3619569_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	93.4	2.6e-86
WP_162816082.1|3619607_3619976_-	hypothetical protein	NA	A0A0K2FI43	Enterobacteria_phage	93.4	1.3e-51
WP_000459457.1|3621348_3621783_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3621764_3622187_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_053888056.1|3622202_3622943_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
WP_000683141.1|3622950_3623346_-|tail	phage tail protein U	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975054.1|3623342_3623921_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_053881501.1|3623933_3624287_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
WP_072162251.1|3624298_3624694_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_032209073.1|3624735_3625761_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	2.0e-187
WP_001299443.1|3625815_3626148_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|3626157_3627477_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_053897481.1|3627457_3629059_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
WP_000198149.1|3629055_3629262_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_114107258.1|3629258_3631184_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3631158_3631704_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001421937.1|3632093_3632288_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3632452_3632659_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3632944_3633355_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3633645_3633939_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3634029_3634212_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3634428_3634926_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3634925_3635141_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3635729_3636827_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|3637016_3637400_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001358249.1|3637417_3638407_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001061408.1|3638414_3639212_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_000767127.1|3639231_3639621_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|3639617_3639944_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001573323.1|3639943_3640438_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000104957.1|3640434_3641376_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|3641365_3641545_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515870.1|3641720_3642272_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_000205494.1|3642309_3642510_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3642607_3643234_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559922.1|3643461_3643977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3644447_3644810_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3644875_3645700_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|3645827_3646364_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3646354_3646717_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_053888029.1|3646716_3647022_+	hypothetical protein	NA	U5P0J0	Shigella_phage	94.1	3.2e-48
WP_000433949.1|3647021_3647393_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_000051902.1|3647248_3648412_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|3648746_3649379_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3648426:3648472	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|3649381_3649897_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691054.1|3649907_3650915_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001347862.1|3650927_3653537_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988379.1|3653567_3654260_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_024232318.1|3654479_3655022_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3655502_3656369_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3656370_3656583_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3656690_3657212_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3657247_3658633_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 12
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3955880	3975676	5023979	plate,transposase	uncultured_Caudovirales_phage(50.0%)	15	NA	NA
WP_050553122.1|3955880_3956981_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_033882877.1|3956980_3958117_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000786991.1|3958516_3958774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508713.1|3958775_3963269_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
WP_053888043.1|3963344_3965486_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|3965695_3966214_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|3966910_3967411_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3967445_3967670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056975.1|3967720_3969196_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611738.1|3969202_3969616_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393855.1|3969619_3971470_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_097729325.1|3971433_3972516_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3972540_3973821_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3973817_3974342_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246449.1|3974344_3975676_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NZ_CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	4223193	4303450	5023979	tail,capsid,plate,head,integrase,portal,holin,terminase,tRNA,transposase,protease	Shigella_phage(43.1%)	89	4272709:4272724	4304161:4304176
WP_000399648.1|4223193_4224174_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000738723.1|4224433_4224730_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|4224943_4226230_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|4226230_4227163_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264697.1|4227164_4229627_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|4229707_4229773_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223177.1|4229986_4230673_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4231072_4231213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4231308_4232025_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920306.1|4232084_4233437_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|4233494_4234919_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|4234918_4235608_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4235620_4236094_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4236304_4237174_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4237170_4237818_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001297279.1|4237869_4238391_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000399648.1|4238660_4239641_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000068679.1|4239754_4240081_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4240170_4242108_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4242318_4243986_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|4244292_4245525_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|4245545_4246928_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4246976_4247945_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|4248050_4248695_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105865.1|4248722_4249739_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|4250194_4250914_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4250993_4252217_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4252268_4253591_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|4253717_4254497_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143257.1|4254754_4256305_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_053897282.1|4256276_4257140_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563068.1|4257252_4258035_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|4258031_4259105_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4259226_4259388_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4259514_4260120_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4260512_4262099_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217553.1|4262318_4262567_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_001766808.1|4262875_4263880_+|protease	Clp protease	protease	NA	NA	NA	NA
WP_001766807.1|4264093_4264450_-	recombinase family protein	NA	M1T2R9	Escherichia_phage	93.9	3.1e-55
WP_021567774.1|4264479_4264869_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.8	3.6e-12
WP_053902275.1|4264895_4265336_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.0	8.0e-53
WP_000384228.1|4265307_4265910_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.5	5.4e-92
WP_106479300.1|4265909_4266710_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	6.1e-51
WP_114107263.1|4266713_4267298_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	5.4e-113
WP_000785301.1|4267288_4268347_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_000424728.1|4268333_4268759_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_000643721.1|4268758_4269307_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	3.6e-95
WP_114107264.1|4269306_4270386_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.7e-205
WP_162816083.1|4270382_4271711_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.2	7.9e-245
WP_072666585.1|4271771_4273607_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	2.5e-305
4272709:4272724	attL	TCGGCATCATCACCAA	NA	NA	NA	NA
WP_000661054.1|4273748_4274018_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|4274017_4274374_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_072666584.1|4274373_4275870_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	96.4	4.5e-265
WP_000497757.1|4275853_4276024_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_072666583.1|4276032_4276593_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	8.8e-105
WP_000224836.1|4276589_4277096_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_072666582.1|4277070_4277481_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	3.3e-69
WP_000924829.1|4277477_4277801_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000766100.1|4277879_4279109_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4279119_4279722_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923135.1|4279714_4280941_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
WP_122986947.1|4281088_4282585_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	3.1e-290
WP_000929174.1|4282835_4283321_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_072731282.1|4283446_4283797_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	7.5e-62
WP_016159276.1|4283924_4284359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174171.1|4284884_4285277_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	87.5	5.9e-55
WP_001542445.1|4285273_4285888_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.5	2.8e-112
WP_000422366.1|4285887_4286169_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_072731279.1|4286155_4286542_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	99.2	1.6e-60
WP_001569330.1|4286621_4286879_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
WP_001047106.1|4287029_4287782_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	1.1e-137
WP_001360050.1|4287795_4288785_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_044687610.1|4288792_4289602_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_000767103.1|4289621_4290011_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_000210155.1|4290007_4290334_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_086812988.1|4290333_4290828_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	2.8e-86
WP_001677149.1|4290824_4291643_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_001446924.1|4291639_4291864_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_104681826.1|4291868_4292705_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.6	8.4e-152
WP_104681827.1|4292701_4293253_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	99.5	7.6e-101
WP_000649477.1|4293296_4293497_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|4293587_4294262_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000135680.1|4294930_4295293_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|4295358_4296183_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008209.1|4296310_4296847_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_001242723.1|4296837_4297200_+	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000206803.1|4297199_4297820_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_104681761.1|4298216_4302044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218277.1|4302226_4303450_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
4304161:4304176	attR	TTGGTGATGATGCCGA	NA	NA	NA	NA
>prophage 1
NZ_CP030940	Escherichia coli strain AMSHJX01 plasmid pAMSH1, complete sequence	257394	157028	214293	257394	transposase,protease,integrase	Escherichia_phage(23.08%)	59	151675:151688	160513:160526
151675:151688	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_000795947.1|157028_158204_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|158374_158587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|158947_160030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|160196_161696_-	kinase	NA	NA	NA	NA	NA
160513:160526	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|161721_163359_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|163358_164399_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|164484_165123_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|165122_165764_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|165786_166425_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|166887_167355_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|167372_168581_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|168591_169548_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|169547_170627_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|170628_171402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|171394_172537_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|172546_173605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|173927_174509_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|174508_175666_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|175688_176144_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_114107275.1|176166_177207_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.2	1.0e-77
WP_000116677.1|177255_177834_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|177901_178477_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|178905_180147_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|180709_180991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|181040_181232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|181323_181695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|182037_182430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|183033_183327_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|183331_184657_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|184717_184924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|185025_185436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|185448_186264_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_000490638.1|187288_187954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|188011_188392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|189034_189853_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|189849_191055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114107276.1|191334_192654_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|192904_194332_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|194546_195062_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|195064_195961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|196182_196416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|197077_197308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|197644_198106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|198135_198543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|198593_198911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|199287_199638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|201802_202507_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_021598067.1|203202_204087_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|204303_205518_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|205545_205851_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032153701.1|206117_207317_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001493764.1|207422_208073_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|208104_208347_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|208652_209489_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|209488_210292_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|210352_211168_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|211475_212327_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|213082_213787_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|213891_214293_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP030940	Escherichia coli strain AMSHJX01 plasmid pAMSH1, complete sequence	257394	239647	247643	257394	transposase,integrase	Escherichia_phage(33.33%)	10	238859:238871	244361:244373
238859:238871	attL	CATAACATCAAAC	NA	NA	NA	NA
WP_001067858.1|239647_240352_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032495703.1|240342_240564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015387340.1|240610_241486_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001067858.1|242083_242788_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|243269_244283_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|244574_245129_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
244361:244373	attR	GTTTGATGTTATG	NA	NA	NA	NA
WP_001749986.1|245225_245678_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|245810_246284_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_000679427.1|246462_246810_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|246803_247643_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
